KASP molecular marker method related to powdery mildew resistance of highland barley and application of KASP molecular marker method

Abstract

The invention discloses a KASP molecular marker method related to powdery mildew resistance of highland barley and application of the KASP molecular marker method, and belongs to the technical field of molecular markers. Two groups of KASP molecular marker primers are developed by analyzing a highland barley genome and aiming at key SNP sites on a specific chromosome. Wherein the first group of primers is designed aiming at the SNP site of the 711384649 site on the second chromosome of the highland barley, and the second group of primers is designed aiming at the SNP site of the 711384825 site on the second chromosome of the highland barley. By utilizing the primer combinations, the resistance of highland barley plants to powdery mildew can be efficiently and accurately identified. The detection method disclosed by the invention has the advantages of high accuracy, rapid detection, low cost, short period, simplicity and convenience in operation and the like, can effectively assist in breeding work of a novel powdery mildew resistant highland barley variety, and has an important application value and a wide development prospect.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker technology, specifically relating to a KASP molecular marker method for resistance to powdery mildew in highland barley and its application. Background Technology

[0002] Barley (Hordeum vulgare L. var. nudum), belonging to the genus Hordeum in the family Poaceae, also known as naked barley, is not only a staple food and livestock feed, but also a raw material for beer, pharmaceuticals, and health products due to its rich nutritional value and unique taste. In recent years, due to factors such as global warming, powdery mildew damage in barley has significantly increased, becoming a major disease restricting the quality and high yield of barley. For a long time, breeding and planting disease-resistant varieties has been a key measure for controlling barley powdery mildew. Developing molecular markers for detecting powdery mildew resistance in barley has significant application value for screening powdery mildew-resistant barley germplasm resources and rapidly identifying powdery mildew-resistant plants during the breeding process.

[0003] KASP (Kompetitive Allele-Specific PCR) technology uses fluorescent probes to specifically identify gene loci, enabling genotyping. It can be used to detect SNP and InDel loci. Compared to traditional molecular markers such as SSR, RFLP, and InDel, KASP markers offer advantages such as faster detection speed, lower cost, and ease of large-scale application. KASP technology does not rely on DNA fragment size for genotyping, avoiding the cumbersome steps and low throughput of traditional gel electrophoresis methods, making it particularly suitable for high-throughput molecular detection platforms. Therefore, identifying functional SNP loci associated with barley powdery mildew resistance and developing KASP molecular markers suitable for high-throughput molecular detection platforms for barley powdery mildew resistance has significant application value for improving the breeding efficiency and level of barley in my country. Summary of the Invention

[0004] In order to solve the above-mentioned problems in the existing technology, the purpose of this invention is to provide a KASP molecular marker method for resistance to powdery mildew in highland barley and its application.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] This invention provides a molecular marker primer combination for detecting resistance to powdery mildew in highland barley, the molecular marker primer combination consisting of two specific upstream primers and one downstream primer;

[0007] The two specific upstream primers are a first upstream primer for detecting whether position 711384649 on chromosome 2 of barley is a C base and a second upstream primer for detecting whether position 711384649 on chromosome 2 of barley is an A base. The downstream primer can be used together with the first upstream primer or the second upstream primer to amplify the fragment containing position 711384649 on chromosome 2 of barley.

[0008] Alternatively, the two specific upstream primers may be a first upstream primer for detecting whether position 711384825 on chromosome 2 of barley is a G base and a second upstream primer for detecting whether position 711384825 on chromosome 2 of barley is an A base. The downstream primer may be used together with the first or second upstream primer to amplify the fragment containing position 711384825 on chromosome 2 of barley.

[0009] Furthermore, the two specific upstream primers are a first upstream primer containing the nucleotide sequence shown in SEQ ID No. 1 and a second upstream primer containing the nucleotide sequence shown in SEQ ID No. 2, respectively, and the downstream primer contains the nucleotide sequence shown in SEQ ID No. 3;

[0010] Alternatively, the two specific upstream primers may be a first upstream primer containing the nucleotide sequence shown in SEQ ID No. 4 and a second upstream primer containing the nucleotide sequence shown in SEQ ID No. 5, and the downstream primer may contain the nucleotide sequence shown in SEQ ID No. 6.

[0011] Further, the nucleotide sequence of the first upstream primer is shown in SEQ ID No. 1, the nucleotide sequence of the second upstream primer is shown in SEQ ID No. 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 3;

[0012] Alternatively, the nucleotide sequence of the first upstream primer is shown in SEQ ID No. 4, the nucleotide sequence of the second upstream primer is shown in SEQ ID No. 5, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 6.

[0013] Furthermore, the 5' ends of the first upstream primer and the second upstream primer are respectively connected to fluorescent label sequences, the fluorescent labels being selected from FAM or HEX, and the fluorescent labels of the first upstream primer and the second upstream primer are different.

[0014] Furthermore, the first upstream primer is fluorescently labeled with FAM, and the second upstream primer is fluorescently labeled with HEX.

[0015] The present invention also provides a kit for detecting resistance to powdery mildew in highland barley, the kit comprising the above-described molecular marker primer combination.

[0016] This invention also provides a method for identifying resistance to powdery mildew in highland barley, the method comprising the following steps:

[0017] S1. Extract genomic DNA from the barley sample to be tested;

[0018] S2. Using the genomic DNA of the barley sample to be tested obtained in step S1 as a template, PCR amplification was performed using the above-mentioned molecular marker primer combination to obtain PCR products;

[0019] S3. Genotyping the PCR products obtained in step S2:

[0020] The genotype of barley at position 711384649 on chromosome 2 is A:A, A:C, or C:C;

[0021] The genotype of barley at position 711384825 on chromosome 2 is A:A, A:G, or G:G;

[0022] If the genotype at position 711384649 on chromosome 2 of barley is C:C and the genotype at position 711384825 on chromosome 2 is G:G, it is classified as susceptible; if the genotype at position 711384649 on chromosome 2 of barley is A:A or A:C and the genotype at position 711384825 on chromosome 2 is A:A or A:G, it is classified as resistant.

[0023] Furthermore, the PCR amplification reaction system includes KASP 2×PCR mix, the genome of the barley sample to be tested, and the above-mentioned molecular marker primer combination.

[0024] Furthermore, the PCR amplification reaction program is as follows: 95℃ for 15 min; 95℃ for 10 s, 65℃ for 60 s, 10 cycles, decreasing by 1℃ per cycle; 95℃ for 10 s, 57℃ for 60 s, 30 cycles; 30℃

[0025] 30s.

[0026] The present invention also provides the application of the above-mentioned molecular marker primer combination in identifying or assisting in the identification of barley powdery mildew resistance, preparing kits for identifying barley powdery mildew resistance, and in barley-assisted breeding.

[0027] The present invention has achieved the following beneficial effects:

[0028] This invention analyzes the barley genome and develops two sets of KASP molecular marker primers targeting key SNP sites on specific chromosomes. The first set of primers targets the SNP site at position 711384649 on barley chromosome 2, with primer sequences shown in SEQ ID NO. 1–3; the second set of primers targets the SNP site at position 711384825 on barley chromosome 2, with primer sequences shown in SEQ ID NO. 4–6. Using these primer combinations, this invention can efficiently and accurately identify the resistance of barley plants to powdery mildew. The detection method of this invention has advantages such as high accuracy, rapid detection, low cost, short cycle, and simple operation, and can effectively assist in the breeding of new barley varieties resistant to powdery mildew, possessing significant application value and broad development prospects.

[0029] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.

[0030] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following examples. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description

[0031] Figure 1 Manhattan diagram for GWAS analysis of powdery mildew resistance in highland barley.

[0032] Figure 2 This study examines two CA and GA base mutations that are significantly associated with powdery mildew resistance, and their relationship with powdery mildew resistance in barley.

[0033] Figure 3 The image shows the detection results of the KASP-649 molecular marker on barley with different resistance levels.

[0034] Figure 4 The image shows the detection results of KASP-825 molecular marker on barley with different resistance. Detailed Implementation

[0035] The raw materials and equipment used in this invention are all known products, obtained by purchasing commercially available products.

[0036] The following experiments, where no temperature is specified, are reactions conducted under normal temperature conditions, which is room temperature, or 25±5℃.

[0037] Example 1: Design of KASP molecular marker primer combinations for resistance to powdery mildew in highland barley

[0038] The experimental materials of highland barley used in the molecular marker development work and their anti-white powder grades are shown in Table 1.

[0039] Table 1. Barley experimental materials and powdery mildew resistance grades used in this invention.

[0040]

[0041]

[0042] 1. Inoculation and resistance grading of barley powdery mildew.

[0043] The powdery mildew identification and evaluation system for barley, established in previous research of this invention, was used for powdery mildew inoculation and disease identification. Barley seeds were soaked for 6 hours, then wrapped in double layers of sterile, moist gauze and placed in a 25℃ light incubator for germination. After germination, 10 germinating barley seeds were sown in 6cm×6cm×7cm flowerpots filled with sterile substrate soil. When the barley seedlings reached the two-leaf-one-heart stage, powdery mildew was inoculated using a spray inoculation method. A disposable sprayer was used to evenly spray the bacterial solution onto the barley leaves, with an inoculation volume of 15mL per seedling. The inoculated barley was then cultured in a plant culture room with a stable environment (temperature 20±1℃, day / night light duration 14h / 10h, relative humidity 70-80%).

[0044] Fifteen days after inoculation, the number of diseased plants and the severity of the disease were investigated, and the area of ​​leaf lesions was calculated. Based on the area of ​​leaf lesions, the disease resistance level of barley was classified. The disease severity classification of barley powdery mildew and the corresponding plant symptoms are shown in Table 2.

[0045] Table 2 Grading Table for Barley Powdery Mildew

[0046] White powder resistance level Plant symptoms Level 0 Leaves without disease Level 1 A small amount of white powdery substance appeared on the leaves, covering an area of ​​less than 5%. Level 2 The leaves are covered with a white powdery substance covering 5% to 15% of their surface area. Level 3 The leaves are covered with a white powdery substance covering 15% to 30% of their surface area. Level 4 The area covered by white powdery substance on the leaves is >30%.

[0047] 2. Sample collection and DNA extraction

[0048] After the resistance identification process was completed, leaf samples were collected from the test materials and placed in 2 mL centrifuge tubes. These tubes were then flash-frozen in liquid nitrogen and stored at -80°C. Before the experiment, the leaves were ground into powder using a leaf homogenizer, and DNA was extracted using the CTAB method. The specific procedure was as follows:

[0049] (1) Set the oven to 60°C in advance and soak the small steel balls in ethanol.

[0050] (2) The CTAB extract was preheated in an oven at 60°C.

[0051] (3) Add small steel balls to the centrifuge tube containing the leaf sample and grind it with a grinder for 40 Hz and 20 s.

[0052] (4) Check if the centrifuge tube is broken, add 700 μL of CTAB extraction solution, shake vigorously to mix, and heat in an oven at 60°C for 0.5 h, inverting and mixing once every 10 min during the process.

[0053] (5) Cool the centrifuge tube to room temperature, add 700 μL of a mixture of chloroform and isoamyl alcohol in a volume ratio of 25:1 in a fume hood, mix slowly for 2 min, let stand for 3 min, and centrifuge at 10000 r for 8 min.

[0054] (6) Use a pipette to draw about 500 μL of supernatant into a new centrifuge tube, add 700 μL of chloroform and isoamyl alcohol in a volume ratio of 25:1, let stand for 3 min, centrifuge at 10000 r for 8 min.

[0055] (7) Use a pipette to draw 400 μL of supernatant into a 1.5 mL centrifuge tube, add twice the volume of pre-cooled isopropanol, and gently invert to mix.

[0056] (8) After placing the centrifuge tube in a -20℃ refrigerator for 0.5 hours, centrifuge at 8000 r for 2 min and discard the supernatant.

[0057] (9) Add 500 μL of 75% ethanol to wash, let stand for 8-15 min, centrifuge at 8000 r for 1.5 min.

[0058] (10) Repeat step (9).

[0059] (11) Open the centrifuge tube cap and place it in a fume hood overnight to allow it to evaporate.

[0060] (12) Add 40 μL ddH2O to dissolve the DNA.

[0061] (13) The concentration and quality of DNA were detected using an ultra-micro spectrophotometer, and the DNA was then stored at -20°C.

[0062] 3. SNP site selection

[0063] In a previous genome-wide association study (GWAS) of resistance to powdery mildew in highland barley, this invention identified two base mutation sites, CA and GA, in the 705-712 Mb region of chromosome 2 that are significantly associated with powdery mildew resistance. Figure 1As shown. To further clarify the association between these sites and resistance, this invention selected two of the most significantly related SNP sites on chromosome 2 of the barley genome for in-depth analysis. SNP site 711384649 on chromosome 2: This site contains an A / C base mutation, corresponding to genotypes A:A, A:C, and C:C. The A:A and A:C genotypes are resistant, while the C:C genotype is susceptible. SNP site 711384825 on chromosome 2: This site contains an A / G base mutation, corresponding to genotypes A:A, A:G, and G:G. The A:A and A:G genotypes are resistant, while the G:G genotype is susceptible. The relationship between the combination of these two mutation sites and the disease resistance of the material is shown in [the diagram]. Figure 2 Based on these two mutation sites, this invention successfully designed and developed corresponding KASP (Kompetitive Allele Specific PCR) molecular markers. These markers can effectively distinguish materials with powdery mildew resistance level 0 from materials with other resistance levels.

[0064] 4. Develop KASP markers for SNP sites and design primer sets for detecting these markers.

[0065] Develop KASP markers for use in marker-assisted selection breeding.

[0066] (1) The KASP primers for the SNP site at position 711384649 on chromosome 2 of the barley genome consist of two upstream primers, KASP-649FAM and KASP-649HEX, and one downstream primer, KASP-649R.

[0067] KASP-649-FAM:5'- GAAGGTGACCAAGTTCATGCT AGCTTTAACAA CAGGGCTAAAAGTGTC(SEQID No.1)

[0068] KASP-649-HEX:5'- GAAGGTCGGAGTCAACGGATT AGCTTTAACAA CAGGGCTAAAAGTGTA(SEQID No.2)

[0069] KASP-649-R:CATTGATAGGTATAAAGCACGTCTTGTTGCTAAG(SEQ ID No.3)

[0070] KASP-649-FAM is a primer with a FAM fluorescent tag sequence at the 5' end (the underlined region in SEQ ID No. 1). Together with the downstream primer KASP-649-R, it amplifies the fragment with the target SNP site C. The fluorescent signal of the FAM group can be detected by an enzyme-linked immunosorbent assay (ELISA) reader or a fluorescence quantitative PCR instrument.

[0071] KASP-649-HEX is a primer with a HEX fluorescent tag sequence at its 5' end (the underlined region in SEQ ID No. 2). It works with KASP-649-R to amplify the fragment at the target SNP site A. The fluorescent signal of the HEX group can be detected by an ELISA reader or a real-time PCR instrument.

[0072] (2) The KASP primers for the SNP site at position 711384825 on chromosome 2 of the barley genome consist of two upstream primers, KASP-825-FAM and KASP-825-HEX, and one downstream primer, KASP-825R.

[0073] KASP-825-FAM:5'- GAAGGTGACCAAGTTCATGCT TGCATACATGA CGTGGTAAGTGAGG(SEQID No.4)

[0074] KASP-825-HEX:5'- GAAGGTCGGAGTCAACGGATT TGCATACATGA CGTGGTAAGTGAGA(SEQID No.5)

[0075] KASP-825-R:TGCGTTCTTACATGGCATTCTGGAAGAGGA(SEQ IDNo.6)

[0076] KASP-825-FAM is a primer with a FAM fluorescent tag sequence at its 5' end (underlined region in SEQ ID No. 4). Together with the downstream primer KASP-825-R, it amplifies the fragment targeting SNP site A. The fluorescent signal of the FAM group can be detected by an ELISA reader or a quantitative PCR instrument. KASP-825-HEX is a primer with a HEX fluorescent tag sequence at its 5' end (underlined region in SEQ ID No. 5). Together with KASP-825-R, it amplifies the fragment targeting SNP site G. The fluorescent signal of the HEX group can be detected by an ELISA reader or a quantitative PCR instrument.

[0077] The following experimental examples demonstrate the beneficial effects of the present invention.

[0078] Experimental Example 1: Establishment of a method for detecting resistance to powdery mildew in highland barley

[0079] 1. Phenotypic data

[0080] Thirty different levels of powdery mildew resistant barley materials, as shown in Table 1, and four barley materials from the core germplasm resource bank (08-1127 and 08-1280 are foreign varieties; XL is a Xila series variety, a local Tibetan variety) were sown. Genomic DNA was extracted from leaf samples of the seedlings using the CTAB method. At the two-leaf-one-heart stage, powdery mildew fungi of the Poaceae family were inoculated using a spray inoculation method. Phenotypic identification was performed 20 days after inoculation to obtain powdery mildew resistance phenotypic data.

[0081] 2. Genotyping

[0082] After extracting the genomic DNA, the DNA concentration was detected using an ultra-micro spectrophotometer, and the sample DNA was diluted to 100 ng·μL⁻¹ using ddH₂O. Amplification was performed using KASP-649 primer pairs and KASP-825 primer pairs, respectively. The total volume of the KASP reaction was 10 μL, and the KASP reaction system consisted of 5 μL of KASP 2×PCR mix, 5 μL of the barley genomic DNA to be tested, and 0.14 μL of PCR primer mixture.

[0083] KASP reaction PCR program:

[0084] 95℃ for 15 minutes;

[0085] 95℃ for 10 seconds, 65℃ for 60 seconds (10 cycles, decreasing by 1℃ per cycle);

[0086] 95℃ for 10 seconds, 57℃ for 60 seconds, 30 cycles;

[0087] 30℃ for 30 seconds.

[0088] Fluorescence scanning and genotyping: After amplification, fluorescence scanning was performed using a Bio-Rad CFX96 real-time quantitative PCR instrument, and the fluorescence values ​​were read for genotyping.

[0089] Genotyping criteria:

[0090] (1) When using the KASP-649 primer set for amplification, if only the HEX group fluorescence signal is displayed, then the genotype of the SNP site of the barley to be tested is AA (i.e., the homozygous type of the SNP site in the genome is A).

[0091] If only the FAM group shows a fluorescent signal, then the genotype of the SNP site of the barley to be tested is CC (i.e., the homozygous type of the SNP site in the genome is C).

[0092] If both FAM and HEX fluorescent signals are displayed, then the genotype of the SNP site in the barley to be tested is A:C (i.e., the SNP site in the genome is a heterozygous type of A and C).

[0093] (2) When using the KASP-825 primer set for amplification, if only the HEX group fluorescence signal is displayed, then the genotype of the SNP site of the barley to be tested is AA (i.e., the homozygous type of the SNP site in the genome is A).

[0094] If only the FAM group shows a fluorescent signal, then the genotype of the SNP site of the barley to be tested is GG (i.e., the homozygous type of the SNP site in the genome is G).

[0095] If both FAM and HEX fluorescent signals are displayed, then the genotype of the SNP site in the barley to be tested is A:G (i.e., the SNP site in the genome is a heterozygous type of A and G).

[0096] Phenotypic-genotypic association analysis:

[0097] Plants with consistent genotypes at level 0 were classified as effective disease-resistant plants and assigned the genotype value A; plants with consistent genotypes at level 4 were classified as effective disease-susceptible plants and assigned the genotype value B; heterozygotes of all disease-resistant levels were classified as effective plants and assigned the genotype value H; samples that could not be defined or had no signal were indicated by “-” (Table 3).

[0098] Table 3. Genotyping results of 34 highland barley samples

[0099] serial number Anti-white powder level KASP-649 KASP-825 WDM03683 Level 0 A A WDM001925 Level 0 H H WDM00853 Level 0 A A WDM001496 Level 0 A H WDM03744 Level 0 H A ZDM4732 Level 0 H H ZYM2611 Level 0 - A ZYM1288 Level 0 H H ZYM1844 Level 0 H A ZDM5599 Level 0 H H 08-1127 Level 1 H H 08-1280 Level 1 - H ZDM08193 Level 3 B B ZDM08205 Level 3 B B ZDM8219 Level 3 - - ZDM08814 Level 3 B B ZDM7562 Level 3 B - ZDM5542 Level 4 B B ZDM5539 Level 4 B - ZDM4787 Level 4 B B ZDM5694 Level 4 - B ZDM5709 Level 4 B B ZDM4672 Level 4 B B ZDM4789 Level 4 B B ZDM02657 Level 4 B B ZDM8217 Level 4 B B ZDM2592 Level 4 B B XL5 Level 4 B - XL6 Level 4 - B ZYM0957 Level 4 B B ZYM2195 Level 4 B B ZYM3088 Level 4 B B ZDM4279 Level 4 B B ZDM4310 Level 4 B B

[0100] In summary, this invention, through analysis of the barley genome, developed two sets of KASP molecular marker primers targeting key SNP sites on specific chromosomes. The first set of primers targets the SNP site at position 711384649 on barley chromosome 2, with primer sequences shown in SEQ ID NO. 1–3; the second set of primers targets the SNP site at position 711384825 on barley chromosome 2, with primer sequences shown in SEQ ID NO. 4–6. This invention utilizes these primer combinations to efficiently and accurately identify the resistance of barley plants to powdery mildew. The detection method of this invention has advantages such as high accuracy, rapid detection, low cost, short cycle, and simple operation, and can effectively assist in the breeding of new barley varieties resistant to powdery mildew, possessing significant application value and broad development prospects.

Claims

1. A molecular marker primer combination for detecting resistance to powdery mildew in highland barley, characterized in that, The molecular marker primer combination consists of two specific upstream primers and one downstream primer; The two specific upstream primers are a first upstream primer for detecting whether position 711384649 on chromosome 2 of barley is a C base and a second upstream primer for detecting whether position 711384649 on chromosome 2 of barley is an A base. The downstream primer can be used together with the first upstream primer or the second upstream primer to amplify the fragment containing position 711384649 on chromosome 2 of barley. Alternatively, the two specific upstream primers may be a first upstream primer for detecting whether position 711384825 on chromosome 2 of barley is a G base and a second upstream primer for detecting whether position 711384825 on chromosome 2 of barley is an A base. The downstream primer may be used together with the first or second upstream primer to amplify the fragment containing position 711384825 on chromosome 2 of barley.

2. The molecular marker primer combination according to claim 1, characterized in that, The two specific upstream primers are a first upstream primer containing the nucleotide sequence shown in SEQ ID No. 1 and a second upstream primer containing the nucleotide sequence shown in SEQ ID No. 2, respectively, and the downstream primer contains the nucleotide sequence shown in SEQ ID No. 3; Alternatively, the two specific upstream primers may be a first upstream primer containing the nucleotide sequence shown in SEQ ID No. 4 and a second upstream primer containing the nucleotide sequence shown in SEQ ID No. 5, and the downstream primer may contain the nucleotide sequence shown in SEQ ID No.

6.

3. The molecular marker primer combination according to claim 2, characterized in that, The nucleotide sequence of the first upstream primer is shown in SEQ ID No. 1, the nucleotide sequence of the second upstream primer is shown in SEQ ID No. 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 3; Alternatively, the nucleotide sequence of the first upstream primer is shown in SEQ ID No. 4, the nucleotide sequence of the second upstream primer is shown in SEQ ID No. 5, and the nucleotide sequence of the downstream primer is shown in SEQ ID No.

6.

4. The molecular marker primer combination according to any one of claims 1 to 3, characterized in that, The first upstream primer and the second upstream primer each have a fluorescent label sequence attached to their 5' ends. The fluorescent labels are selected from FAM or HEX, and the fluorescent labels of the first upstream primer and the second upstream primer are different.

5. The molecular marker primer combination according to claim 4, characterized in that, The first upstream primer is fluorescently labeled FAM, and the second upstream primer is fluorescently labeled HEX.

6. A kit for detecting resistance to powdery mildew in highland barley, characterized in that, The kit comprises the molecular marker primer combination as described in any one of claims 1 to 5.

7. A method for identifying resistance to powdery mildew in highland barley, characterized in that, The identification method includes the following steps: S1. Extract genomic DNA from the barley sample to be tested; S2. Using the genomic DNA of the barley sample to be tested obtained in step S1 as a template, PCR amplification is performed using the molecular marker primer combination described in any one of claims 1 to 4 to obtain PCR products; S3. Genotyping the PCR products obtained in step S2: The genotype of barley at position 711384649 on chromosome 2 is A:A, A:C, or C:C; The genotype of barley at position 711384825 on chromosome 2 is A:A, A:G, or G:G; If the genotype at position 711384649 on chromosome 2 of barley is C:C and the genotype at position 711384825 on chromosome 2 is G:G, it is classified as susceptible; if the genotype at position 711384649 on chromosome 2 of barley is A:A or A:C and the genotype at position 711384825 on chromosome 2 is A:A or A:G, it is classified as resistant.

8. The identification method according to claim 7, characterized in that, The PCR amplification reaction system includes KASP 2×PCR mix, the genome of the barley sample to be tested, and the molecular marker primer combination according to any one of claims 1 to 5.

9. The identification method according to claim 7 or 8, characterized in that, The PCR amplification reaction program was as follows: 95℃ for 15 min; 95℃ for 10 s, 65℃ for 60 s, 10 cycles, decreasing by 1℃ per cycle; 95℃ for 10 s, 57℃ for 60 s, 30 cycles; 30℃ for 30 s.

10. The use of the molecular marker primer combination according to any one of claims 1 to 5 in identifying or assisting in the identification of powdery mildew resistance in barley, preparing a kit for identifying powdery mildew resistance in barley, and in barley-assisted breeding.

Images