SNP (Single Nucleotide Polymorphism) molecular marker related to litchi fruit weight and application of SNP molecular marker

Abstract

The invention relates to an SNP molecular marker related to litchi fruit weight and application thereof, and belongs to the technical field of molecular biology. The SNP molecular marker related to the litchi fruit weight is based on a seedless litchi reference genome, the SNP molecular marker is located in a litchi SL05G0138630 gene coding region, and is located at the 27564818th basic group of a litchi chromosome 5, and the basic group is A or G. The application finds that a non-synonymous SNP site in a coding region of the litchi SL05G0138630 gene is closely associated with the litchi fruit weight phenotype, the variety with the weight of the litchi fruit can be efficiently identified by detecting the polymorphic site, the invention further discloses an identification method for the molecular level of the variety with the weight of the litchi fruit, and the molecular level of the variety with the weight of the litchi fruit can be identified by an SNP-based typing method. And cheap and accurate gene SNP typing can be achieved, so that the purpose of efficiently and accurately identifying the weight variety of the litchi fruit is achieved.

Description

Technical Field

[0001] This application relates to the field of molecular biology, and in particular to a SNP molecular marker related to the weight of litchi fruit and its application. Background Technology

[0002] Lychee (Litchi chinensis sonn., Sapindaceae family) is an important tropical fruit tree species worldwide, prized for its edible aril. Grown in over 20 countries, lychee is an integral part of their local economies. Its excellent nutritional properties, unique flavor, and appealing color make it one of the most attractive tropical and subtropical fruits on the international market. Lychee is not only sold fresh but is also ideally suited for processing. Dried lychee, canned lychee pulp, lychee juice, and lychee wine are the main processed forms of lychee. Currently, lychee wine is the most profitable processed product in the lychee industry, canned lychee pulp is the second largest processed product, while dried lychee is a more valuable investment with a wider market reach.

[0003] Lychee is an evergreen tree that can reach a height of about 10 meters. When ripe, the peel is mostly bright red with small, scaly bumps that are slightly prickly to the touch. The seed is nearly spherical and enclosed in an aril (flesh). Lychee flowers from March to April and fruits from May to August. The pulp of the lychee is rich in various bioactive components, such as polysaccharides, polyphenols, and gamma-aminobutyric acid (GABA). These components have been reported to have antioxidant, anti-obesity, liver-protective, and immunomodulatory effects. The Compendium of Materia Medica records that lychee has the effects of nourishing blood, tonifying the liver and spleen, relieving pain, calming the nerves, and preventing diarrhea.

[0004] In the late 1970s, techniques for studying DNA differences between individuals were proposed and applied. Differences in DNA molecules directly reflect individual differences, unaffected by external environmental influences. Therefore, it gradually replaced the previous method of distinguishing individuals by visually observing external phenotypic differences. Simultaneously, with the development of molecular biology, various DNA molecular marker technologies have been widely researched and applied, from RFLP and AFLP to the later-developed SNP. These molecular markers have played a crucial role in constructing fingerprint profiles for analytical research.

[0005] However, previous molecular markers all have some drawbacks. RFLP technology is relatively cumbersome to operate, has low polymorphic information content, and has significant limitations in individual identification; RAPD technology has poor reproducibility and unstable results, requiring repeated optimization of reaction conditions to obtain reliable results; AFLP technology has high requirements for genomic purity and reaction conditions; while SSR technology has advantages over the previous ones, such as high polymorphism detection rate, large information content, simple experimental operation, and stable and reliable results, it also suffers from low detection efficiency and low reproducibility. SNP, as a third-generation molecular marker, possesses unique advantages. It effectively solves the non-reproducibility problem of SSR markers and has the following advantages: firstly, it has abundant loci, almost distributed throughout the entire genome; secondly, it has rich polymorphism and higher genetic stability than SSR; and thirdly, SNP detection methods are becoming increasingly simple and efficient, showing excellent application prospects.

[0006] Fruit weight is one of the most important agronomic traits in litchi breeding, directly determining litchi yield. Currently, litchi breeding mainly employs traditional methods, which suffer from drawbacks such as long cycles and low efficiency. SNP-based molecular marker breeding allows for rapid screening at the DNA level, significantly improving the efficiency and accuracy of litchi fruit weight identification. Furthermore, it can identify individuals with superior traits during the litchi seedling stage, thereby shortening the breeding cycle and accelerating the breeding process. Therefore, finding an SNP molecular marker related to litchi fruit weight can provide an important technical foundation for reducing the complexity and cost of detecting important agronomic traits in litchi and improving the efficiency of molecular marker-assisted breeding. Summary of the Invention

[0007] In view of this, this application provides an SNP molecular marker related to the weight of litchi fruit and its application, which can effectively overcome the defects of the prior art.

[0008] The first aspect of this application provides a SNP molecular marker associated with litchi fruit weight, based on the litchi reference genome (NCBI: ASM4269212v1: https: / / www.ncbi.nlm.nih.gov / nuccore / JBAOJE000000000). This SNP molecular marker is located in the coding region of the litchi SL05G0138630 gene, at base position 27564818 on chromosome 5 of the litchi, and the base is either A or G. Specifically, the polymorphism at this locus is significantly associated with fruit weight; the fruit weight of the genotype with base type A at this locus is significantly greater than that of the genotype with base type G. The AA genotype is identified as the fruit weight haplotype Hap1, and the GG genotype is identified as the fruit weight haplotype Hap2. That is, genotype AA is a highly significant molecular marker for larger litchi fruit weight, and genotype GG is a highly significant molecular marker for smaller fruit weight.

[0009] A second aspect of this application also provides a primer pair for detecting the aforementioned SNP molecular markers, wherein the nucleotide sequence of the primer pair is:

[0010] Forward primer 5'-3': TCAAGTACGACAGCAGAGCC;

[0011] Reverse primers 3'-5': AGTCTCTCTTCCCCCTGTGG.

[0012] Specifically, genomic DNA of litchi to be identified is extracted. Using the extracted genomic DNA as a template, forward and reverse primers containing the SNP molecular marker fragments are designed together to amplify the target fragment by PCR. The SNP is genotyped using sequencing. When the genotype at position 27564818 on chromosome 5 is AA, it is a heavy-fruited variety. When the genotype is GG, it is a light-fruited litchi variety.

[0013] The third aspect of this application also provides the application of the above-mentioned SNP molecular markers or primer pairs in regulating the weight of litchi fruits.

[0014] Preferably, the SNP molecular marker is used in the auxiliary selection of weight traits in litchi fruit.

[0015] The fourth aspect of this application also provides a method for identifying the above-mentioned SNP molecular markers, comprising the following steps:

[0016] (1) A GWAS population was constructed from 169 litchi materials from six major litchi producing areas in China. Fresh tender leaves of litchi were used as samples for DNA extraction. After the litchi matured, the fruit weight was investigated as phenotypic data for GWAS analysis.

[0017] (2) After digesting the genomic DNA with enzymes, ligate it with the adapter to construct a genomic sequencing library. Use the HiSeq2500 sequencing platform to perform paired-end sequencing on the sequencing library.

[0018] (3) Perform quality control and filtering on the generated sequencing data, compare the qualified data with the reference genome sequence, and obtain SNP information in the population;

[0019] (4) The obtained SNP information was subjected to genome-wide association analysis to obtain SNP molecular markers that were significantly associated with the weight of litchi fruit.

[0020] The fifth aspect of this application also provides a method for identifying the varietal weight of fruits at the molecular level, comprising the following steps:

[0021] By extracting litchi genomic DNA and using the extracted DNA as a template, forward and reverse primers containing the aforementioned SNP molecular marker fragments were designed to amplify the target fragments via PCR. The SNPs were then genotyped using sequencing sequences, thereby achieving the goal of efficiently and accurately identifying varieties with high and low fruit weight.

[0022] Compared with the prior art, this application has the following advantages:

[0023] 1. This application discovers that a non-synonymous SNP site in the coding region of the litchi SL05G0138630 gene is closely associated with the litchi fruit weight phenotype. By detecting this polymorphic site, litchi varieties with high and low fruit weight can be efficiently identified. This application also discloses a molecular-level identification method for litchi varieties with high and low fruit weight. Through SNP-based genotyping, inexpensive and accurate gene SNP genotyping can be achieved, thereby achieving the goal of efficiently and accurately identifying litchi varieties with high and low fruit weight.

[0024] 2. This application discloses a SNP molecular marker related to litchi fruit weight and its application. Using genome-wide association analysis, a SNP molecular marker associated with litchi fruit weight was obtained. This SNP molecular marker is a non-synonymous mutation site located at position Chr5:27564818 in the coding region of the litchi SL05G0138630 gene on chromosome 5, with bases A or G. This SNP molecular marker can serve as an auxiliary selection marker for fruit weight during litchi breeding, effectively improving the accuracy of litchi variety selection and accelerating the variety breeding process. This application also discloses a molecular-level identification method for varieties with high and low fruit weight. By extracting litchi genomic DNA, using the extracted DNA as a template, forward and reverse primers containing the SNP molecular marker fragment are designed for PCR amplification of the target fragment. Sequencing sequences are then used to genotype the SNP, thereby achieving efficient and accurate identification of varieties with high and low fruit weight. Attached Figure Description

[0025] To more clearly illustrate the technical solutions in this application or the prior art, the drawings used in the description of this application or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this application. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0026] Figure 1 The litchi fruits of different weights were included, with two wild species weighing less than 10 grams (g) and two cultivated species weighing more than 15 grams (g).

[0027] Figure 2Statistical analysis of fruit weight traits in litchi populations was conducted, where the horizontal axis represents the weight of litchi fruits in grams (g), and the vertical axis represents the number of samples within that weight range. The analysis revealed that fruit weight exhibits a normal distribution in the litchi population, demonstrating a genetic effect.

[0028] Figure 3 Manhattan plot for association analysis of fruit weight trait in litchi population based on MLM model. In the Manhattan plot, the horizontal axis represents the genomic location of each SNP, and the vertical axis represents the negative logarithm of the P-value of each SNP site under the MLM model.

[0029] Figure 4 This is a comparative analysis diagram of the weight of two genotype fruits in litchi from embodiments of this application;

[0030] Figure 5 The expression levels of candidate gene SL05G0138630 in the peel and pulp of fruits of different weights were determined.

[0031] Figure 6 The alignment results of the sequence containing the SNP molecular marker protected in this application in NCBI;

[0032] Figure 7 This application relates to a pair of primers whose pre-amplification results in NCBI show that they can amplify to the SNP site protected by this patent: position 27564818 on chromosome 5. Detailed Implementation

[0033] To make the objectives, technical solutions, and advantages of this application clearer, the technical solutions of this application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this application, not all embodiments. Based on the embodiments of this application, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this application.

[0034] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the experimental materials used in the following embodiments were all purchased from commercial channels. The following embodiments define this application and describe how this application used GWAS mapping of the novel agronomic trait fruit weight to screen for the SL05G0138630 gene, which determines the weight of litchi fruit. The structural annotation information of the SL05G0138630 gene is shown in Table 1.

[0035] Table 1. Gene structure annotation information for SL05G0138630

[0036]

[0037] The non-synonymous SNPs in their coding regions were found to be highly correlated with the weight phenotype of litchi fruit, and can be used as molecular markers for the identification of litchi fruit weight varieties. Based on the following description and these embodiments, those skilled in the art can determine the basic characteristics of this application, and various changes and modifications can be made to this application to suit different uses and conditions without departing from the spirit and scope of this application. To better understand the technical content of this application, the following detailed description, in conjunction with specific embodiments, further illustrates this application.

[0038] Example 1 - Population Building and Data Acquisition

[0039] (1) A GWAS population was constructed from 169 litchi materials from different regions. Fresh young leaves of litchi were used as samples for DNA extraction. After the litchi matured, the fruit weight was investigated as phenotypic data for GWAS analysis. Figure 1 This indicates that there are significant differences in the morphology of litchi fruits within this litchi population.

[0040] (2) Genomic DNA was ligated to DNA fragments by Bacrode, amplified by PCR, purified, and a Hyper-seq genome sequencing library was constructed. The genome sequencing library was sequenced at both ends using the HiSeq 2500 sequencing platform.

[0041] (3) The generated sequencing data were quality controlled and filtered. The data that passed the quality control were compared with the reference genome sequence of seedless litchi to obtain SNP information in the population.

[0042] Example 2 - Phenotypic Data Survey and DNA Extraction

[0043] Fresh lychee leaves were collected, and DNA was extracted from the lychee using the CTAB method. After the lychees ripened, three lychees of uniform size were selected, and their weights were measured using calipers. The average weight was then recorded. Figure 2 This indicates that the weight of litchi fruits in this population follows a normal distribution, allowing for further analysis.

[0044] 1. Extraction and detection of litchi DNA

[0045] One to two plants were selected from each material, and 5-8 grams of their fresh leaves were taken for DNA extraction.

[0046] (1) Weigh 5-8g of material and grind it three to four times with liquid nitrogen;

[0047] (2) Place the powder into a 2 ml centrifuge tube containing 800 μL of 2×CTAB extraction buffer;

[0048] (3) Add 60 μL of mercaptoethanol and mix well. Preheat at 60°C for 30 min.

[0049] (4) Mix well two to three times during the process, then remove the sample and place it at room temperature;

[0050] (5) After the sample has cooled to a constant temperature, add 800 μL of chloroform:isoamyl alcohol (24:1).

[0051] (6) Mix by shaking and centrifugation at 12000 rpm for 15 min;

[0052] (7) Take the supernatant into a new 2ml Eppendorf tube and add 1.5 times the volume of 1×CTAB precipitate;

[0053] (8) Let stand for 20-30 minutes, then centrifuge at 12000 rpm for 15 minutes;

[0054] (9) Dry the precipitate and dissolve it in 200ul TE-buffer.

[0055] (10) Add 400 μL of 95% ethanol solution and 20 μL of 3M NaAC, and precipitate at -20°C for 1 h;

[0056] (11) Centrifuge at 12000 rpm for 15 min;

[0057] (12) Wash with 500ul of 75% ethanol, centrifuge at 12000rpm for 10min; open the lid and let it sit at room temperature until the residual ethanol evaporates.

[0058] (13) Add 30-50ul TE-buffer; the extracted DNA can be used immediately for the next experiment or stored at -40°C.

[0059] (14) Agarose gel electrophoresis detection; DNA integrity was detected by 2%wt agarose gel (60V electrophoresis for 35min).

[0060] Example 3 - GWAS mapping and genes associated with litchi fruit weight phenotype

[0061] Quality control and filtering of the generated sequencing data: The raw Illumina sequencing data was optimized and human error reduced using a Perl script (http: / / afsmseq.sourceforge.net / ). Quality control criteria were MAF < 0.05, deletion rate > 0.9%, and HW (Hardy-Weinberg index) > 0.0001. The optimized sequencing reads were aligned to the seedless litchi reference genome using BWA software. SNP identification was performed using GATK software. After obtaining SNP locus information for each sample, population-level integration was conducted.

[0062] SNP annotation is based on the gene structure annotation file of the seedless litchi reference genome. Using snpEff software, the locations of SNPs are classified into spacer regions, untranslated regions (including 3-terminal and 5-terminal untranslated regions), intron regions, and codon regions. SNPs in codon regions can be further divided into synonymous codons and non-synonymous codons based on whether they cause amino acid changes. Insertions and deletions within exon regions can be classified into frameshift mutations and non-frameshift mutations based on whether they result in frameshift mutations.

[0063] Genome-wide association analysis (GWA) was performed on litchi fruit weight traits in this population using high-quality SNP and indel data. A mixed linear model (MLM) was used in TASSEL 5.0 software for the association analysis. Plink software was used to adjust the data format, converting VCF files to tfam and tped formats recognizable by emmax software. The kinship matrix generated by TASSEL was used to correct for population structure and random polygenic effects. A significance threshold of P ≤ 1 × 10⁻⁶ was set. -6 Significant GWAS signals were identified.

[0064] Results analysis:

[0065] The GWAS analysis results of litchi fruit weight traits are shown in the figure. Figure 3 . Figure 3 The image shows a Manhattan plot of the association analysis results, where the X-axis represents the location of each SNP on the genome, and the Y-axis represents the negative logarithm of the P-value for each SNP site, base 10.

[0066] The statistical significance threshold is set to P ≤ 1×10⁻⁶. -6Five significantly associated SNPs were successfully located on chromosomes 5 and 13, containing a total of 128 candidate genes. LD-block analysis was performed on the SNP locus SL05_27520767, which had the highest significance among the five loci, revealing 49 genes within the linkage interval. Based on litchi gene functional annotation information, a gene SL05G0138630 was identified, functionally annotated as Coatmer protein I (COPI). COPI proteins have been reported to be involved in plant growth and development, and studies in Arabidopsis have shown its association with plant growth, development, and stress resistance. A non-synonymous SNP locus SL05_27564818 (A / G) was identified in the coding region of the SL05G0138630 gene. Based on this SNP, we determined that the fruit weight of the genotype with base type A was significantly greater than that of the genotype with base type G. The AA genotype was identified as the fruit weight haplotype Hap1, and the GG genotype as the fruit light haplotype Hap2. Among these, 127 litchi samples were identified as fruit weight haplotype Hap1, with an average fruit weight of 18.8g, while 27 samples were identified as fruit light haplotype Hap2, with an average fruit weight of 10.1g. The fruit weight of varieties containing Hap1 was significantly higher than that of varieties containing Hap2.

[0067] The amplification primers for the SNP molecular markers related to litchi fruit weight included: forward primer 5'-3': TCAGTACGACAGCAGAGCC and reverse primer 3'-5': AGTCTCTCTTCCCCCTGTGG. Fruit weight and DNA extraction were performed on 169 litchi populations for verification. The genotypes and fruit weights of each tested plant are shown in the table below. Among the 169 litchi varieties, the largest fruit weight was of the cultivated variety GD-10 from Guangdong, with genotype AA and a fruit weight of 53.3g. The smallest fruit weight was of the wild variety BWLQSX03S from Bawangling, Hainan, with genotype GG and a fruit weight of 2.524g. Figure 4 This is a graph showing the effect of different genotypes at this SNP locus on regulating litchi fruit weight. Figure 4 It can be seen that the fruit weight of litchi samples with genotype AA is significantly higher than that of samples with genotype GG. The genotypes and fruit weights of 169 litchi samples are shown in Table 2-4.

[0068] Table 2

[0069]

[0070] Table 3

[0071]

[0072] Table 4

[0073]

[0074] Example 4 - Litchi fruit weight measurement and expression level analysis of SL05G0138630 gene in different fruit weight varieties and different tissues

[0075] Six litchi varieties with different fruit weights were selected for transcriptome sequencing. These six varieties also differed in peel color, peel roughness, and fruit shape. Sequencing sites included the pulp, seed, and peel. Among the selected varieties, Fei Zi Xiao, seedless litchi, and Lizhi Wang had fruits weighing over 15g, and were designated as large fruits. The remaining three materials were wild litchi, with fruits weighing less than 10g, and were designated as small fruits. Figure 5 As shown, the expression level of this gene is significantly higher in the pulp than in the pit and peel, and the expression level is significantly higher in the pulp of large fruits than in the pulp of small fruits.

[0076] like Figure 6 As shown, the sequence containing this SNP site can be perfectly aligned to the Lizhi WGS sequencing library on NCBI, indicating that the sequence is genuine and valid.

[0077] like Figure 7 As shown, the primer sequence can be pre-amplified in the NCBI database to the location of the aforementioned SNP site.

[0078] This application obtains SNP molecular markers related to litchi fruit weight through the above-mentioned method for identifying litchi fruit weight. These SNP molecular markers can be used as molecular markers significantly related to litchi fruit weight and can be applied in the auxiliary selection of litchi fruit weight traits, which is beneficial to improving the accuracy of litchi variety selection and accelerating the variety breeding process.

[0079] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of this application, and are not intended to limit them. Although this application has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of this application.

Claims

1. A SNP molecular marker related to litchi fruit weight, characterized in that, Based on the reference genome of seedless litchi, the SNP molecular marker is located in the coding region of the litchi SL05G0138630 gene, at base position 27564818 on chromosome 5 of litchi, and the base is A or G.

2. A primer pair for detecting the SNP molecular marker of claim 1, characterized in that, The nucleotide sequences of the primer pair are as follows: Forward primer 5'-3': TCAAGTACGACAGCAGAGCC; Reverse primers 3'-5': AGTCTCTCTTCCCCCTGTGG.

3. The application of the SNP molecular marker of claim 1 or the primer pair of claim 2 in regulating the weight of litchi fruit.

4. The application as described in claim 3, characterized in that, Application of the SNP molecular markers in the auxiliary selection of weight traits in litchi fruit.

5. A method for identifying the SNP molecular marker of claim 1, characterized in that, Includes the following steps: (1) A GWAS population was constructed from 169 litchi materials from six major litchi producing areas in China. Fresh tender leaves of litchi were used as samples for DNA extraction. After the litchi matured, the fruit weight was investigated as phenotypic data for GWAS analysis. (2) After digesting the genomic DNA with enzymes, ligate it with the adapter to construct a genomic sequencing library. Use the HiSeq2500 sequencing platform to perform paired-end sequencing on the sequencing library. (3) Perform quality control and filtering on the generated sequencing data, compare the qualified data with the reference genome sequence, and obtain SNP information in the population; (4) The obtained SNP information was subjected to genome-wide association analysis to obtain SNP molecular markers that were significantly associated with the weight of litchi fruit.

6. A method for identifying the varietal weight of fruits at the molecular level, characterized in that, Includes the following steps: By extracting litchi genomic DNA and using the extracted DNA as a template, forward and reverse primers containing the SNP molecular marker fragment described in claim 1 are designed together to amplify the target fragment by PCR. The SNP is then genotyped using sequencing sequences, thereby achieving the goal of efficiently and accurately identifying varieties with high and low fruit weight.

Images