Recombinant I-type collagen and application thereof

By using a Pichia pastoris expression system and artificial intelligence-optimized methods, the challenges of recombinant collagen expression and purification have been solved, achieving high stability and high activity, promoting skin repair and healing, and enabling its application in medical and cosmetic products.

CN120887976AActive Publication Date: 2025-11-04ZHEJIANG JIBEI BIOTECHNOLOGY CO LTD
View PDF 9 Cites 0 Cited by

Patent Information

Application Number
CN202511431079.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-09
Publication Date
2025-11-04
Estimated Expiration
2045-10-09

AI Technical Summary

Technical Problem

In existing technologies, recombinant collagen expressed in prokaryotes suffers from insufficient post-translational modification, making it difficult to achieve hydroxylation and glycosylation of natural collagen. Purification is difficult and costly, prokaryotic and mammalian cell culture are costly, and degradation during fermentation is verified, resulting in low production efficiency.

Method used

Using the Pichia pastoris expression system, artificial intelligence was used to predict highly active sequences, insert integrin sites (RGD), optimize gene sequences through restriction enzyme sites, and insert into expression vectors to form highly stable and highly expressed recombinant type I collagen, which is secreted into the culture medium supernatant, reducing the difficulty of protein purification.

Benefits of technology

It achieves efficient and stable expression of recombinant type I collagen, promotes the proliferation of skin fibroblasts, improves skin, and promotes wound healing, and has applications in the medical and cosmetic fields.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120887976A_ABST
    Figure CN120887976A_ABST
Patent Text Reader

Abstract

According to the recombinant I-type collagen and the application thereof, the recombinant I-type collagen is secreted in a culture medium supernatant by utilizing the characteristic that pichia pastoris can secrete and express recombinant protein, so that the difficulty of protein purification is reduced. In addition, the integrin site RGD is inserted into the collagen to form the recombinant I-type collagen with high stability and high expression. Comprehensive cell relative proliferation and cell relative adhesion experiments show that the recombinant I-type collagen not only has the ability of promoting skin fibroblast proliferation, but also has the effects of improving skin, promoting wound healing, promoting skin layer fibroblast adhesion and the like. Therefore, the recombinant I-type collagen has huge potential application in the fields of skin care, beauty treatment, medical treatment and the like.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present disclosure relates to the field of bioengineering, in particular to a recombinant collagen type I and application thereof. BACKGROUND

[0002] Collagen is the most abundant protein in the human body (25-30%), widely distributed in skin, bone, tendon and other tissues, and has the functions of maintaining tissue morphology and promoting repair. The global collagen market size reached 103 billion yuan in 2019, and is expected to continue to grow to 152 billion yuan in the future, mainly applied in medical cosmetology, functional skincare, tissue engineering and other fields.

[0003] Traditional collagen is mainly extracted from animal tissues by acid, alkali or enzyme method, but there are problems such as animal source disease risk (such as viral contamination), high immunogenicity, long production cycle (3-5 months), and strong dependence on animal resources for large-scale production. Now the mainstream is to obtain by gene recombinant expression, and the gene engineering technology produces recombinant collagen by microorganism or eukaryotic expression system, which has the following advantages: High safety: avoid animal source pathogen risk, low immunogenicity; Customization: can design humanized sequence or truncated fragment, optimize function (such as promoting cell adhesion, three-helix structure stability); High production efficiency: microorganism (such as Pichia pastoris) culture cycle only needs 2-3 days, suitable for industrialization amplification.

[0004] However, at present, prokaryotic expression has the problem of insufficient post-translational modification, which makes it difficult to realize the hydroxylation and glycosylation of natural collagen, affects the function, and needs multiple purification means to reach the medical device level requirement, in addition, the cost of endotoxin control is high. The cost of plant cell culture and mammalian cell culture is high, and the culture medium and process need to be further optimized. In addition, the existing collagen type I generally has a degradation verification in the fermentation process, which leads to purification difficulty. SUMMARY

[0005] In order to solve the above problems, the present application provides a recombinant collagen type I and application thereof.

[0006] In one aspect of the present application, a recombinant collagen type I is provided, and a preparation method of the recombinant collagen type I, the method comprising the following steps: Selecting amino acid monomers meeting the high activity sequence condition and repeating 8 times to obtain an optimized human collagen type I amino acid sequence; Reverse designing a gene sequence based on the human collagen type I amino acid sequence; The gene sequence designed based on the codon usage of the host cell is removed from at least one enzyme cutting site and synthesized to obtain an optimized target gene; The enzyme cutting site is re-introduced into the target gene and inserted into an expression vector, the recombinant plasmid is recombined and transferred into a host cell for expression to obtain the recombinant collagen type I.

[0007] Preferably, the amino acid sequence of the human collagen type I amino acid sequence is shown in SEQ ID NO: 1.

[0008] Preferably, the nucleotide sequence of the target gene is shown in SEQ ID NO: 2.

[0009] Preferably, the removed enzyme cutting site includes Xhol and NotI enzyme cutting sites.

[0010] Preferably, the enzyme cutting site re-introduced into the target gene includes Xhol and NotI enzyme cutting sites.

[0011] Preferably, the expression vector is pPIC9K.

[0012] In another aspect of the present application, a recombinant collagen type I is prepared by the above-mentioned preparation method.

[0013] In another aspect of the present application, a host cell comprising the recombinant collagen type I prepared by the above-mentioned preparation method or the above-mentioned recombinant collagen type I is also provided.

[0014] Preferably, the host cell is Pichia pastoris.

[0015] In another aspect of the present application, the recombinant collagen type I is also used in the preparation of medicines, food, cosmetics, health products or medical devices.

[0016] Technical effects of the present application: The present application utilizes the characteristics of Pichia pastoris that can secrete and express recombinant proteins, and the recombinant collagen type I is secreted in the supernatant of the culture medium, reducing the difficulty of protein purification, and using artificial intelligence to predict high activity, high expression and high stability sites. In addition, the integrin site RGD is ingeniously inserted into the collagen protein (the Xhol and NotI double enzyme cutting sites are introduced into the target gene and inserted into the expression vector pPIC9K), forming a recombinant collagen type I with high stability and high expression.

[0017] Based on the above experiments on relative cell proliferation and relative cell adhesion, it can be seen that the recombinant type I collagen of this invention not only promotes the proliferation of skin fibroblasts, but also improves skin condition, promotes wound healing, and enhances the adhesion of dermal fibroblasts. Therefore, the recombinant type I collagen of this invention has enormous potential applications in skincare, beauty, and medical fields.

[0018] Other features and aspects of this disclosure will become clear from the following detailed description of exemplary embodiments with reference to the accompanying drawings. Attached Figure Description

[0019] The accompanying drawings, which are included in and form part of this specification, illustrate exemplary embodiments, features, and aspects of this disclosure together with the specification and serve to explain the principles of this disclosure.

[0020] Figure 1 This is a schematic diagram illustrating the construction of recombinant plasmids; Figure 2 Genome sequencing diagram of the expressing strain (landscape orientation); Figure 3 A schematic diagram of SDS-PAGE gel running of the fermentation products of the expression strain; Figure 4 This is a schematic diagram of SDS-PAGE running of the target protein after purification of recombinant type I collagen product. Figure 5 This is a schematic diagram of the relative adhesion rate (100%) of HSF cells. Figure 6 This is a schematic diagram of the relative proliferation rate (100%) of HSF cells. Detailed Implementation

[0021] Various exemplary embodiments, features, and aspects of this disclosure will now be described in detail with reference to the accompanying drawings. The same reference numerals in the drawings denote elements that have the same or similar functions. Although various aspects of the embodiments are shown in the drawings, they are not necessarily drawn to scale unless specifically indicated otherwise.

[0022] The term “exemplary” as used herein means “serving as an example, embodiment, or illustration.” Any embodiment illustrated herein as “exemplary” is not necessarily to be construed as superior to or better than other embodiments.

[0023] Furthermore, to better illustrate this disclosure, numerous specific details are set forth in the following detailed description. Those skilled in the art will understand that this disclosure can be practiced without certain specific details. In some instances, means, components, and circuits well known to those skilled in the art have not been described in detail in order to highlight the main points of this disclosure.

[0024] The reagents, devices, etc. used in the present application can be provided by the laboratory or purchased on the market.

[0025] The present application adopts the Pichia expression system, utilizes the characteristic of Pichia that can secrete and express recombinant proteins, secretes recombinant type I collagen in the culture medium supernatant, reduces the difficulty of protein purification, and utilizes artificial intelligence to predict high activity, high expression, and high stability sites. In addition, the integrin site RGD is ingeniously inserted into the collagen protein to form a recombinant type I collagen with high stability and high expression.

[0026] Example 1, construction of Pichia expression system containing recombinant type I collagen Take pPIC9K (purchased from Invitrogen Company) as the backbone, introduce the optimized gene sequence into the multiple cloning site (Xhol and NotI) respectively, obtain pPIC9K-COll-I, and finally transform into Pichia GS115, the detailed steps are as follows: 1. According to the human type I collagen mature peptide sequence published by the protein resource database UniProt (website https: / / www.uniprot.org / ), select a high-activity sequence (GERGAAGLPGPKGDRGDAGPKGADGSPGPAGPQGPRGDKGETGEQGDRGIKGERGAAGLPGPKGDRGDAGPKGADGSPGPAGPQGPRGDKGETGEQGDRGIKGERGAAGLPGPKGDRGDAGPKGADGSPGPAGPQGPRGDKGETGEQGDRGIK) and repeat it 8 times, to obtain the optimized human type I collagen amino acid sequence as shown in SEQ ID NO: 1.

[0027] Among them, the operation steps of selecting a high-activity sequence and repeating multiple times can refer to the following embodiments: Step 1: Obtain human type I collagen mature peptide sequence Use keyword search: In the search box of UniProt database, input the keywords related to "human type I collagen mature peptide sequence", such as "Homo sapiens type I collagen mature peptide sequence", and then screen out the results related to the target sequence.

[0028] Confirm sequence information: carefully check the search results to confirm whether the obtained sequence information is the human type I collagen mature peptide sequence, including species information, sequence length, sequence annotation, etc., to ensure the accuracy and integrity of the sequence.

[0029] Step 2: Understand the characteristics of high-activity sequence Review literature: Use academic search engines such as PubMed, Web of Science, etc. to search for research literature on high-activity sequences of human collagen type I. These documents may report some high-activity sequences with specific functions (such as promoting cell proliferation, enhancing collagen synthesis, etc.) and their characteristics.

[0030] Analyze the relationship between sequence structure and function: Understand the structure and functional characteristics of human collagen type I, as well as the relationship between different sequence regions and activity. For example, certain specific amino acid composition, sequence pattern or domain may be related to high activity.

[0031] Refer to existing research results: Refer to the characteristics and standards of high-activity sequences determined in existing research to provide reference for subsequent sequence selection.

[0032] Step 3: Select high-activity sequence Sequence alignment and analysis: Use bioinformatics software such as ClustalW, MAFFT, etc. to align the obtained mature peptide sequence of human collagen type I with known high-activity sequences. Through alignment analysis, find out the similar regions with high-activity sequences.

[0033] Evaluate sequence activity potential: According to the characteristics and standards of high-activity sequences, evaluate each region in the mature peptide sequence of human collagen type I. Consider factors such as amino acid composition, sequence length, structural characteristics, etc. to predict the activity potential of each region.

[0034] Determine high-activity sequence: Based on the results of sequence alignment and activity evaluation, select a sequence with high activity potential as the target high-activity sequence. Record the start and end positions of the sequence and the specific amino acid sequence.

[0035] Step 4: Repeat the selected high-activity sequence Manual copy and paste: If the number of repetitions is small, you can manually copy the selected high-activity sequence and paste it into the appropriate text editing tool, repeating the number of times required.

[0036] Use scripting programming: If the number of repetitions is large, you can use a programming language (such as Python, Perl, etc.) to write a script to perform sequence repetition operations. Here is an example code using Python to implement sequence repetition: # Define the selected high-activity sequence active_sequence = "ABCDE" # Replace with the actual selected high-activity sequence # Define the number of repetitions repeat_times = 5 # Replace with the actual number of repetitions required # Repeated Sequence repeated_sequence = active_sequence * repeat_times print(repeated_sequence). Step 5: Verify the accuracy of the repeated sequence Sequence Length Check: Calculate the length of the repeated sequence and ensure it matches the expected length. The length of the repeated sequence should be equal to the length of the selected high-activity sequence multiplied by the number of repetitions.

[0037] Sequence Content Check: Carefully inspect the content of the repeated sequence to ensure that each repeated unit has the same amino acid sequence as the selected high-activity sequence, without any errors or omissions.

[0038] Use Sequence Verification Tools: Use bioinformatics software or online tools, such as the seqret tool from EMBOSS, to verify the format and content of the repeated sequence.

[0039] Use the online design tool Jcat (http: / / www.jcat.de / ) to design the gene sequence in reverse, targeting the preferred codons for expression in Pichia pastoris. Remove the Xhol and NotI restriction enzyme sites during the design process. Commission Jinshui Biotechnology Co., Ltd. to synthesize the optimized COll-I gene. The optimized gene sequence is shown in SEQ ID NO:2. Construction of Recombinant Strains: Introduce the target gene shown in SEQ ID NO.2 into the Xhol and NotI double enzyme digestion sites and insert it into the expression vector pPIC9K to obtain a recombinant plasmid (schematic diagram see Figure 1 ), linearize the recombinant plasmid and electrically transform it into Pichia pastoris GS115, identify the colonies by PCR and send them to Beijing Qikexing Biotechnology Co., Ltd. for sequencing (schematic diagram see Figure 2 ). The base sequences of primers F and R are shown in SEQ ID NO:3 and SEQ ID NO:4, respectively: SEQ ID NO:3, tttataaatactactattgccagcat; SEQ ID NO:4, tgccggccctaaaggcgccgatggaa.

[0040] Example 2: Screening of Pichia pastoris expression strains containing recombinant type I collagen The recombinants were coated on YPD solid plates containing G418 at concentrations of 0.5 mg / ml, 1 mg / ml, 2 mg / ml, and 4 mg / ml, respectively, and incubated in a 30°C incubator for 2-3 days, and the growth state of the recombinants was observed.

[0041] Example 3: Preliminary expression of Pichia pastoris expression bacteria containing recombinant collagen type I The identified positive strains (1#, 2#, 3#, and 4#) were inoculated into conical flasks containing 10 ml of BMGY, and incubated at 30°C and 220 r / min overnight until OD600=2-6 (logarithmic growth, about 16-18 h). The cells were collected by centrifugation at 5000 r / min for 5 min at room temperature, and the supernatant was removed. The cells were resuspended with 10 ml of BMMY, and induced for expression. 1 ml of the culture medium was sampled every 24 h, and methanol was added to a final concentration of 0.5% for continued induction. The samples at the following time points, 0, 24, 48, 72, and 96 h, were centrifuged at 10000 r / min for 2 min to collect the supernatant, which was subjected to 96 h SDS-PAGE gel running verification (schematic diagram shown in Figure 3 , Lane is the lane, Lane 1 is the control group, and Lane 2-5 are the four positive clones, respectively), and it was found that after 96 h of shaking flask induction, protein SDS-PAGE gel running verification found that 2-4 positive clones were expressed.

[0042] Example 4: Purification of recombinant collagen type I product The fermentation broth of the 2# strain in Example 3 was centrifuged to collect the supernatant. The supernatant was filtered through a filter membrane, and then subjected to gel column chromatography separation and purification. The product was obtained by freeze-drying. The specific purification steps of the human recombinant collagen protein are as follows: the fermentation broth was centrifuged at 4200 rpm for 30 min to collect the supernatant. The supernatant was concentrated and washed by ultrafiltration membrane to remove salt and pigment. An appropriate amount of the collagen protein solution was subjected to SP resin column chromatography separation and purification. The eluate containing collagen protein was washed, desalted, concentrated, and exchanged by ultrafiltration membrane. The target protein was collected by freeze-drying machine. The SDS-PAGE gel running verification of the target protein is shown in Figure 4 It was found that after cationic purification, only one target band appeared in the SDS-PAGE gel, and the purity was ≥95%).

[0043] Example 5: Relative proliferation rate of recombinant collagen type I Logarithmic growth period HSF cells (human skin fibroblasts) and 1 x 10 5HSF cells were seeded at a density of 100 µL / mL in 96-well plates, divided into control and experimental groups. Cells were incubated in a CO2 incubator at 37°C and 5% CO2 for 24 h. A serum-free culture medium was used to prepare a 0.5 mg / mL solution of recombinant type A XVII collagen obtained in Example 4, and the solution was sterilized by filtration through a 0.22 µm filter. After 24 h of routine culture, the old culture medium was discarded, and 100 μL of serum-free culture medium was added. The control group received an equal volume of serum-free culture medium, while the experimental group received 100 μL of recombinant type I collagen sample solution, with three replicates per group. After another 24 h of culture, the culture medium was discarded, and 100 μL of CCK-8 (purchased from Sangon Biotech (Shanghai) Co., Ltd.) diluted 10-fold with serum-free culture medium was added to each well. Cells were then incubated in a cell culture incubator for another 2 h. The relative cell proliferation rate was detected using the CCK-8 assay, with absorbance measured at 450 nm using a microplate reader. Calculate cell proliferation rate (RGR) % = (Experimental group absorbance value / Normal control group absorbance value) × 100% (e.g., Figure 6 (As shown) Within the selected concentration range, it has a certain cell proliferation ability and no cytotoxicity.

[0044] Example 6: Adhesion Experiment of Recombinant Type I Collagen HSF cells (human skin fibroblasts) in logarithmic growth phase were taken at a concentration of 1×10⁻⁶. 5 HSF cells were seeded at a density of 100 µL / mL in 96-well plates, divided into control and experimental groups. The plates were incubated in a CO2 cell culture incubator at 37°C and 5% CO2 for 24 h. A serum-free culture medium was used to prepare a 0.5 mg / mL solution of the recombinant type I collagen obtained in Example 4, and the solution was sterilized by filtration through a 0.22 µm filter. After 24 h of routine culture, the old culture medium was discarded, and 100 μL of serum-free culture medium was added. The control group received an equal volume of serum-free culture medium, while the experimental group received 100 μL of the recombinant type I collagen sample solution, with three replicates per group. After another 24 h of culture, the culture medium was discarded, and 100 μL of CCK-8 (purchased from Sangon Biotech (Shanghai) Co., Ltd.) diluted 10-fold with serum-free culture medium was added to each well. The plates were then incubated in a cell culture incubator for 2 h, and the absorbance was measured at 450 nm using a microplate reader. The relative cell adhesion rate was thus determined (see schematic diagram). Figure 5 DMEM (serum-free culture medium) is sufficient. Cell adhesion rate reflects collagen activity. Higher protein activity provides a better external environment for cells in a shorter time, aiding cell adhesion. Using the adhesion rate of the control group as 1, the relative cell adhesion activity of triple-helix recombinant humanized type III collagen can be calculated.

[0045] From the above cell relative proliferation and cell relative adhesion experiments, it can be seen that the recombinant collagen type I has the effects of promoting skin fibroblast proliferation, improving skin, promoting wound healing, promoting skin layer fibroblast adhesion and the like, and the recombinant collagen type I is secreted on the culture medium supernatant by using the characteristics of Pichia pastoris capable of secreting and expressing recombinant proteins, the difficulty of protein purification is reduced, and the high activity, high expression and high stability site of the recombinant collagen type I are predicted by using artificial intelligence. In addition, the integrin site RGD is ingeniously inserted into the collagen protein to form a kind of recombinant collagen type I with high stability and high expression. Support and structure, improve skin barrier, promote wound healing, and can be well applied to medical and cosmetic fields and the like.

[0046] The above is only a general description and implementation method of the present application, and does not limit the patent protection scope of the present application, but any equivalent changes made according to the specification and drawings of the present application, or directly or indirectly using the patent of the present application to other related technical fields, are considered to be within the protection scope of the patent of the present application.

[0047] The choice of terms used herein is intended to best explain the principles of the embodiments, practical applications or improvements to the technology in the market, or to enable other ordinary skilled persons in the art to understand the embodiments disclosed herein.

Claims

1. A method for preparing recombinant type I collagen, characterized in that, The method includes the following steps: Amino acid monomers that meet the high-activity sequence conditions were selected and repeated 8 times to obtain the optimized amino acid sequence of human type I collagen. Gene sequences were designed based on the reverse amino acid sequence of human type I collagen. The gene sequence designed based on the codon pair orientation required for host cell expression is subjected to removal of at least one restriction enzyme site and then synthesized to obtain the optimized target gene; The target gene is reintroduced into the restriction enzyme site and inserted into the expression vector. The recombinant plasmid is then transferred to the host cell for expression and secretion to obtain the recombinant type I collagen.

2. The preparation method according to claim 1, characterized in that, The amino acid sequence of the human type I collagen is shown in SEQ ID NO:

1.

3. The preparation method according to claim 1, characterized in that, The nucleotide sequence of the target gene is shown in SEQ ID NO:

2.

4. The preparation method according to claim 1, characterized in that, The restriction enzyme sites removed include Xhol and NotI restriction enzyme sites.

5. The preparation method according to claim 1, characterized in that, The reintroduction of restriction enzyme sites for the target gene includes Xhol and NotI restriction sites.

6. The preparation method according to claim 1, characterized in that, The expression vector is pPIC9K.

7. A recombinant type I collagen, prepared by any one of claims 1-6.

8. A host cell comprising the recombinant type I collagen prepared by any one of claims 1-6 or as described in claim 7.

9. The host cell according to claim 8, characterized in that, The host cell is Pichia pastoris.

10. The use of the recombinant type I collagen prepared by any one of claims 1-6 or as described in claim 7 in the preparation of pharmaceuticals, food, cosmetics, health products or medical devices.

Citation Information

Patent Citations

  • Polypeptide, production method and uses thereof

    CN109293783A

  • Long-acting heat-resistant collagen as well as preparation method and application thereof

    CN116987179A

  • Collagen peptide as well as preparation method and application thereof

    CN118146352A

  • Novel recombinant collagen as well as preparation method and application thereof

    CN118290566A

  • Type I recombinant collagen, vector, host cell and application thereof

    CN118852409A