Akkermansia massiliensis LTA21F2 and application thereof

Abstract

The invention discloses an Akkermansia massiliensis LTA21F2 strain and an application of the Akkermansia massiliensis LTA21F2 strain, and belongs to the technical field of microorganisms. The strain is preserved in the Guangdong Microbial Culture Collection Center on December 04, 2022, the preservation address is the 5th floor of the building 59, No.100 Courtyard, Xianlie Middle Road, Guangzhou, and the preservation number is GDMCC No: 63035. The Akkermansia massiliensis anaerobic fermentation bacterial liquid provided by the invention is high in viable count and strong in oxygen tolerance, still has a survival rate of more than 90% after being exposed in air for 12 hours, the viable count in a sample is increased by 25.26% after being stressed by 1.5 M H2O2 for 2 hours, and the strain has a section of characteristic sequence which can be used as a specific molecular marker, and has the characteristics of high growth rate, high viable count and the like when being subjected to enlarged culture in a 200L fermentation tank.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of microbial technology, in particular to a strain of Akkermansia massiliensis LTA21F2 and its application. BACKGROUND

[0002] The number of human intestinal microorganisms is about 100 trillion, which plays a crucial role in maintaining the health status of the host and the normal physiological process. Among them, probiotics can colonize the intestinal tract and have various health benefits to the host. In recent years, scholars from many countries have found that Akkermansia (AKK for short) as a new generation of representative probiotics, the abundance is related to various diseases of human beings, and has become a research hotspot in the field of intestinal microbial health function. Akkermansia muciniphila is a representative strain of Akkermansia, which was first isolated by Derrien et al. in 2004 and accounts for 3-5% of the composition of human intestinal flora community. The bacteria have been reported to have various health benefits, including treating obesity, metabolic syndrome, inflammatory bowel disease and diabetes, and assisting tumor immunotherapy and delaying aging. Unlike Akkermansia muciniphila, Akkermansia massiliensis (the bacteria have no clear Chinese name, and this paper will call it Akkermansia muciniphila for the time being) is a new species of Akkermansia reported by Sokhna Ndongo et al. in December 2022 (DOI: 10.1038 / s41598-022-25873-0). The bacteria belong to Verrucomicrobiota, Verrucomicrobiae, Verrucomicrobiales, Akkermansiaceae, and Akkermansia. In June 2024, Ritesh Kumar et al. reported that Akkermansia sp. DSM 33459 and the model strain A. mucinipphila ATCC 835 have an average nucleotide identity of 87.5%, and have significant differences in fatty acid spectrum and carbon source utilization (cells, DOI: 10.3390 / cells11132084). Further, from the phenotype and phylogenetic position, it is clear that the strain is a new species of Akkermansia (i.e. Akkermansia massiliensis), which has the potential to develop into the next generation of probiotics beneficial to human health.

[0003] As a strict anaerobic bacteria, Akkermansia has strict requirements for nutrients and grows slowly, resulting in a low number of viable bacteria in the culture solution. On the one hand, AKK bacteria have low oxygen tolerance. Becken et al. reported that the survival rate of some AKK bacterial isolates exposed to oxygen for 24 h was 60%, and there were also some strains that were extremely sensitive to oxygen, with a survival rate of <0.01% at 12 h (mBio, DOI: 10.1128 / mBio.00478-21). On the other hand, it is difficult to culture. In the method for high-density culture of AKK bacteria invented by Zhang Yixuan et al., the viable count of AKK bacteria can reach 10 10 CFU / mL (CN110079474B), which has been greatly improved compared to the previous one, but still has limitations for large-scale industrial production. Therefore, exploring strains with high oxygen tolerance and developing techniques for producing high-density AKK bacterial strains have become technical bottlenecks and exploration directions for new generations of probiotic resource exploration and industrial production. However, as of now, there have been no reports on Akkermansia muciniphila massiliensis live bacterial preparations and their applications. SUMMARY

[0004] The purpose of the present application is to provide a strain of Akkermansia massiliensis LTA21F2 and its application, in order to solve the problems existing in the prior art.

[0005] To achieve the above-mentioned purpose, the present application provides the following solutions:

[0006] One of the technical solutions of the present application is a strain of Akkermansia massiliensis LTA21F2 (AKK-LTA21F2 for short), which was deposited at the Guangdong Microbial Culture Collection Center on December 4, 2022, at 5 / F, No. 59 Building, Guangzhou Xianlie Middle Road 100 Courtyard, with a preservation number of GDMCC No: 63035.

[0007] The second technical solution of the present application is a microbial agent, which comprises the Akkermansia massiliensis LTA21F2.

[0008] The third technical solution of the present application is a preparation method of the microbial agent, comprising the following steps: centrifuging the fermentation broth of Akkermansia massiliensis LTA21F2 to obtain bacterial slurry; mixing the freeze-dried product protectant with the bacterial slurry at a mass ratio of 20:1, and freeze-drying, to obtain the microbial agent freeze-dried powder.

[0009] The application discloses an application of Akkermansia massiliensis LTA21F2 or the microbial inoculant in preparation of a product for regulating intestinal flora.

[0010] The application discloses an application of Akkermansia massiliensis LTA21F2 or the microbial inoculant in preparation of a product for regulating intestinal flora.

[0011] The product is a medicine or a feed.

[0012] The application discloses an application of Akkermansia massiliensis LTA21F2 or the microbial inoculant in preparation of a product for regulating intestinal flora.

[0013] The application discloses an application of Akkermansia massiliensis LTA21F2 or the microbial inoculant in preparation of a product for regulating intestinal flora.

[0014] The product is a medicine or a feed.

[0015] Based on the above technical scheme, the application has the following technical effects:

[0016] (1) The Akkermansia massiliensis LTA21F2 has the characteristics of oxygen tolerance and high viable cell count, and the survival rate is more than 90% after exposure to air for 12 hours; in the pilot production, the viable cell count of the fermentation liquor obtained by fermentation in a 200L fermentation tank is more than 10 15 CFU / mL, and the viable cell count of the freeze-dried powder prepared from the sludge obtained by centrifugation of the fermentation liquor sample is more than 10 16 CFU / g.

[0017] (2) The Akkermansia massiliensis LTA21F2 screened in the application has a characteristic sequence, and can be used as a specific molecular recognition marker of the strain.

[0018] (3) The Akkermansia massiliensis LTA21F2 screened in the application can significantly improve the health signs of mice, prolong the survival rate of 24-month-old natural aging mice by 30%, significantly improve the oxidative stress level of the aging mice, reduce the whole-body inflammation level of the mice, enhance the immunity of the mice, significantly reduce the aspartate aminotransferase level of the aging mice, restore the glucose content of the natural aging mice to the normal level, and is beneficial to maintaining the normal health life signs of the mice.

[0019] (4) The Akkermansia massiliensis LTA21F2 screened by the application has the ability to improve the anxiety level and learning and memory ability of the aging mice, avoid hippocampus damage of the aging mice, and enhance the antioxidant level and reduce the inflammatory response of the brain tissue; can also regulate the pathological characteristics of the colon tissue of the aging mice, can colonize in the natural aging mice and make the intestinal flora pattern of the natural aging mice tend to be younger, and has a certain regulation and improvement effect on the intestinal flora of the natural aging mice. BRIEF DESCRIPTION OF DRAWINGS

[0020] Figure 1 Gram staining diagram of AKK-LTA21F2.

[0021] Figure 2 Colony morphology diagram of AKK-LTA21F2.

[0022] Figure 3 Phylogenetic evolution tree of AKK-LTA21F2.

[0023] Figure 4 Whole genome circle diagram of AKK-LTA21F2.

[0024] Figure 5 Specific molecular marker of AKK-LTA21F2. Wherein, A is the gel electrophoresis result of PCR amplification of AKK specific primer (corresponding to capital letter) and AKK-LTA21F2 strain characteristic sequence primer (corresponding to small letter) respectively, and B is the gel electrophoresis result of PCR amplification product of AKK-LTA21F2 characteristic sequence primer used by a plurality of strains.

[0025] Figure 6 Oxygen exposure tolerance and hydrogen peroxide stress adaptability of AKK-LTA21F2. Wherein, A is the colony growth condition of the same gradient counting plate exposed to air for 12h, and B is the colony growth condition of AKK-LTA21F2 after growing in liquid medium containing 1.5M H2O2 for 2h.

[0026] Figure 7 Carbon source utilization characteristics of AKK-LTA21F2.

[0027] Figure 8 Live bacteria count result of AKK-LTA21F2 fermentation broth after expansion culture.

[0028] Figure 9 Live bacteria count result of AKK-LTA21F2 freeze-dried bacteria powder produced by expansion culture.

[0029] Figure 10 Effect of AKK-LTA21F2 intervention on survival rate of aging mice.

[0030] Figure 11 AKK-LTA21F2 intervention on the influence of aging-related markers in aging mice. Among them, A is the mouse serum oxidative stress index, B is the mouse serum inflammatory factor, C is the mouse serum biochemical index.

[0031] Figure 12 AKK-LTA21F2 intervention on the improvement of anxiety level in aging mice. Among them, A is the mouse open field experiment walking track chart, B is the number of times the mouse enters the center, C is the total moving distance of the mouse, and D is the number of times the mouse stands on the hind legs.

[0032] Figure 13 AKK-LTA21F2 intervention on the improvement effect of learning and memory ability in aging mice. Among them, A is the mouse water maze experiment trajectory chart, B is the escape latency of the mouse in the continuous 5-day water maze experiment; C is the residence time of the mouse in the target quadrant, and D is the number of times the mouse crosses the platform.

[0033] Figure 14 AKK-LTA21F2 intervention on the influence of oxidative stress and inflammatory factors in the brain tissue of aging mice. Among them, A is the mouse brain tissue oxidative stress index, and B is the mouse brain tissue inflammatory factor index.

[0034] Figure 15 AKK-LTA21F2 intervention on the influence of colon histopathology in aging mice. Among them, A is the mouse brain tissue oxidative stress index, and B is the mouse brain tissue inflammatory factor index.

[0035] Figure 16 AKK-LTA21F2 intervention on the influence of intestinal flora in mice. Among them, A is the intestinal flora door level composition of the three groups of mice, B is the intestinal flora family level composition of the three groups of mice, and C is the intestinal flora genus level composition of the three groups of mice. DETAILED DESCRIPTION

[0036] The technical solutions described in the present application are conventional solutions in the art if not specifically stated, and the reagents or raw materials used are purchased from commercial channels or are already published if not specifically stated.

[0037] The present application provides a strain of Akkermansia massiliensis LTA21F2, which was deposited with the Guangdong Microbial Culture Collection Center on December 4, 2022, at the address of 100 Xianlie Road, Guangzhou, China, in Building 59, 5th Floor, with the preservation number of GDMCC No: 63035.

[0038] The present application also provides a microbial inoculant comprising the Akkermansia massiliensis LTA21F2.

[0039] The embodiment of the present application further provides a preparation method of the microbial agent, comprising the following steps: centrifuging the fermentation liquid of Akkermansia massiliensis LTA21F2 to obtain bacterial slurry; mixing a freeze-dried product protective agent with the bacterial slurry according to a mass ratio of 20:1, and freeze-drying, so as to obtain the freeze-dried microbial agent powder.

[0040] In some specific embodiments, the freeze-dried product protective agent comprises skimmed milk powder, sucrose and trehalose; the mass ratio of the milk powder, sucrose and trehalose is 6:1:1; and the mass ratio of the freeze-dried product protective agent to the bacterial slurry is 20:1.

[0041] The embodiment of the present application further provides application of Akkermansia massiliensis LTA21F2 or the microbial agent in preparation of an anti-aging and life-prolonging product.

[0042] In some specific embodiments, the Akkermansia massiliensis LTA21F2 enhances immunity and maintains normal and healthy vital signs by improving the levels of oxidative stress, inflammation and liver function indicators; and plays an anti-aging and life-prolonging role by enhancing the integrity of the colon barrier function and regulating intestinal flora.

[0043] The embodiment of the present application further provides an anti-aging and life-prolonging product comprising the Akkermansia massiliensis LTA21F2 or the microbial agent.

[0044] The embodiment of the present application further provides application of the Akkermansia massiliensis LTA21F2 or the microbial agent in preparation of an anti-anxiety drug.

[0045] The embodiment of the present application further provides an anti-anxiety drug comprising the Akkermansia massiliensis LTA21F2 or the microbial agent.

[0046] The embodiment of the present application further provides application of the Akkermansia massiliensis LTA21F2 or the microbial agent in preparation of a product for improving learning ability and memory.

[0047] The embodiment of the present application further provides a product for improving learning ability and memory comprising the Akkermansia massiliensis LTA21F2 or the microbial agent.

[0048] The application further provides application of the Akkermansia massiliensis LTA21F2 or the microbial agent in preparation of a medicine for enhancing the antioxidant level of brain tissue and reducing inflammatory response.

[0049] The application further provides a medicine for enhancing the antioxidant level of brain tissue and reducing inflammatory response, which comprises the Akkermansia massiliensis LTA21F2 or the microbial agent.

[0050] The application further provides application of the Akkermansia massiliensis LTA21F2 in preparation of a product for enhancing the integrity of the colon barrier and regulating intestinal flora.

[0051] The application further provides a product for enhancing the integrity of the colon barrier and regulating intestinal flora, which comprises the Akkermansia massiliensis LTA21F2.

[0052] The product is a medicine or a feed.

[0053] The application further provides application of the Akkermansia massiliensis LTA21F2 or the microbial agent in preparation of a product for improving the immunity of an organism.

[0054] The application further provides a product for improving the immunity of an organism, which comprises the Akkermansia massiliensis LTA21F2 or the microbial agent.

[0055] The product is a medicine or a feed.

[0056] The Akkermansia massiliensis LTA21F2 provided by the application can increase the survival rate of 24-month-old naturally aging mice by 30%, and can enhance immunity and maintain normal and healthy vital signs by improving the oxidative stress level, the inflammatory level and the liver function index of the aging mice; can also play an anti-aging and life-prolonging role by enhancing the integrity of the colon barrier function and regulating intestinal flora, thereby providing a theoretical basis for product preparation and application in the anti-aging field.

[0057] In the test result data in the specific embodiments of the application, the mean value ± standard deviation (Means ± SD) is used. Statistical analysis uses one-way analysis of variance (One-way ANOVA) and the like.

[0058] Example 1

[0059] Isolation, screening and identification of Akkermansia strains

[0060] 1. Isolation and morphological identification of Akkermansia strains

[0061] 1.0 g of frozen fecal samples collected from healthy centenarians (100-109 years old) in the Changshou core area of Guangxi Zhuang Autonomous Region was weighed into a test tube containing 9.0 mL of sterile PBS buffer, and 10-fold gradient dilution was performed to obtain an appropriate dilution gradient. The modified BHI solid culture medium (containing vancomycin) was poured into a plate, and 100 μL of sample diluent was coated on the modified BHI solid culture medium plate, which was incubated at 37°C for 56 h or more under anaerobic conditions. The selected colony samples were Gram-stained and observed under a general optical microscope. The samples that were Gram-negative (pink) and short strip-shaped or oval-shaped were selected as suspected strains. Figure 1

[0062] 2. Specific primer identification

[0063] The selected suspected strains were streaked and preserved in glycerol, and specific primers for AKK bacteria were used for next-step sequencing identification. Single colonies of suspected strains were picked as templates, and then Akkermansia-specific primers were used for colony PCR amplification. The PCR amplification products were subjected to gel electrophoresis experiment. The electrophoresis results were observed. If a single and bright band appeared at 327 bp, the colony was preliminarily identified as a suspected AKK bacteria.

[0064] The single colony of the preliminarily identified AKK bacteria was inoculated into the modified BHI liquid medium, and after incubation at 37°C in an anaerobic workstation, the bacterial liquid was preserved and numbered as LTA21F2.

[0065] 3. 16S rDNA sequence determination

[0066] ​The LTA21F2 genomic DNA was extracted, and the LTA21F2 genomic DNA was used as a template for polymerase chain reaction amplification. The 16S rDNA universal primers were used for amplification, which were forward primer 27F (5'-AGAGTTTGATCCTGGCTCAG-3') and reverse primer 1492R (5'-GGCTACCTTGTTACGACTT-3'), respectively. After the amplification reaction was completed, the amplification product was detected by agarose gel electrophoresis, and a bright band was found at 1500 bp, indicating that the PCR amplification was successful. The purified PCR product was sent to Shanghai Shengong Biotechnology Co., Ltd. for sequencing, and the 16S rDNA sequence of LTA21F2 was obtained. The sequence was compared using BLAST on NCBI, and it was confirmed that the strain was Akkermansia massiliensis.

[0067] The sequence of the 16S rDNA of the AKK-LTA21F2 strain is as follows:

[0068]

[0069] The AKK-LTA21F2 strain was preserved in the Guangdong Microbial Culture Collection Center on December 4, 2022, at an address of 59, 5th Floor, Building 100, Martyrs' Road, Guangzhou, with a preservation number of GDMCC No: 63035.

[0070] Example 2

[0071] AKK-LTA21F2 Whole Genome Sequencing

[0072] 1. Basic characteristics

[0073] The genomic DNA of the strain AKK-LTA21F2 was extracted for whole genome sequencing. Figure 4 The whole genome circle map of AKK-LTA21F2 is shown, and the results show that the genome of AKK-LTA21F2 is a circular chromosome, the size of the chromosome is 3,024,590 bp, and the average GC content of the genome is 58.16%. The genome is predicted to have 2720 protein coding regions, the coding genes account for 87.60% of the total gene length, does not contain plasmids, contains 8 non-coding RNAs and 53 tRNAs and 3 5S, 16S and 23S rRNA genes.

[0074] 2. Phylogenetic tree

[0075] The present application uses knsp to classify 29 strains belonging to the species of Akkermansia family, and constructs a phylogenetic tree using NJ. As shown in Figure 3 the sequenced Akkermansia strains can be divided into 3 large branches, among which the strain AKK-LTA21F2 and Marseille-P9185 GCF are located in the same branch, and their evolutionary relationship is closest, while the evolutionary relationship with Roseibacillus persicicus and Prosthecobacter fluviatilis is farthest.

[0076] There are 18 strains in the same cluster with Akkermansia massiliensis LTA21F2, including Akkermansia massiliensis strains of the same level and Akkermansia muciniphila strains of the similar level, indicating that they have a close relationship in the evolution process. In addition, excluding the non-AKK bacteria and the strain AKK-LTA21F2, only 15 strains have collection date, country information and source information. These 15 strains are all human sources and have a wide geographical distribution, covering a total of 5 countries (9 strains in the United States, 2 strains in China, 2 strains in France, 1 strain in Japan and 1 strain in South Korea). The above results show that the evolution path and mode of Akkermansia is diverse.

[0077] 3. Gene function

[0078] 3.1 COG functional gene annotation

[0079] After sequencing, the predicted genes of AKK-LTA21F2 strain were compared with COG function database using eggNOG-mapper, and the COG categories of different genes were obtained, and COG function annotation diagram was generated using R language. AKK has 2720 CDSs, of which 1610 genes are annotated to COG function database. In addition to the genes annotated as unknown function, the number of genes in the branch of cell wall / membrane / envelope biogenesis is the most, with 204 genes, accounting for 10.78%; 174 genes are involved in amino acid transport and metabolism, accounting for 9.19%; 153 genes are involved in translation, ribosomal structure and biogenesis, accounting for 8.08%; 141 genes are involved in carbohydrate transport and metabolism, accounting for 7.45%. But some functions involve fewer genes, for example, only 18 genes are involved in cell motility, and 2 genes are involved in cytoskeleton. A considerable number of genes are annotated to amino acid or carbohydrate transport or metabolism, which lays a genetic foundation for the metabolic synthesis ability of the strain.

[0080] 3.2 KEGG functional gene annotation

[0081] Among the annotations of KEGG, the functions of genes are roughly divided into seven categories, which are Human Diseases, Metabolism, Organismal Systems, Brite Hierarchies, Cellular Processes, Environmental Information Processing and Genetic Information Processing. Among the fragments detected by AKK-LTA21F2 strain, most of the annotations are concentrated in Cellular Processes, followed by Brite Hierarchies. Among them, the distribution of Human Diseases annotation is less, a total of 91 genes are annotated, accounting for 4.10% of the total number of annotations, which are Drug resistance: antimicrobial, Cancer: overview, Infectious disease: bacterial, Endocrine and metabolic disease, Drug resistance: antineoplastic, Cancer: specific types, Neurodegenerative disease, Infectious disease: viral, Cardiovascular disease. Except for Drug resistance: antimicrobial annotation, the number of other annotations is close. In addition, the number of genes classified into metabolism is the most, which is 1059, mainly including carbohydrate metabolism, amino acid metabolism, glycan biosynthesis and metabolism, and vitamin and cofactor metabolism. The large number of genes involved in strain metabolism also makes the strain have good probiotic characteristics, and through the metabolic products to affect the immune system to play the immune regulation function.

[0082] Example 3

[0083] Gastrointestinal tolerance simulation experiment of AKK-LTA21F2 strain

[0084] Probiotics to achieve in the intestinal colonization, first to be able to tolerate low pH and various digestive enzymes to resist the attack of gastrointestinal environment, so the acid and pepsin resistance performance evaluation is an important indicator of screening of probiotics. Determination of these indicators, can determine the survival ability of the selected strains after gastrointestinal digestion. 10 mL of pre-check AKK bacteria liquid, centrifugation (4℃, 10000r / min, 8min) to collect the bacterial slurry, washed with sterile PBS twice, resuspended in an equal volume of pH 2.5 artificial gastric juice (NaCl 0.2%, pepsin 0.35%, pH = 2.5, 0.22μm sterile filter). 37℃ constant temperature anaerobic culture 3h, every 30min shake once, respectively in 0h, 3h take mixed bacteria liquid, gradient dilution to 10 -7 、10 -6 、10 -5 , each 100μL suction plate to calculate the number of viable bacteria, each group of three parallel. Then again to the sample centrifugation (4℃, 10000r / min, 8min) to collect the bacterial slurry, and the resulting bacterial slurry resuspended in an equal volume of pH = 8.0 artificial intestinal fluid (KH2PO40.68%, trypsin 1%, bile salt 0.3%, pH = 8.0, 0.22μm sterile filter), 37℃ constant temperature anaerobic culture 4h, every 30min shake once, respectively in 0h, 4h take mixed bacteria liquid, gradient dilution to 10 -4 、10 -5 、10 -6 , 100μL suction plate to calculate the number of viable bacteria, each group of three parallel. Detection of viable bacteria number of samples before and after treatment, the results are shown in Table 1.

[0085] Table 1 AKK-LTA21F2 simulated gastrointestinal fluid tolerance test results

[0086]

[0087] Example 4

[0088] Characteristic sequence of AKK-LTA21F2

[0089] Using nucmer software to compare the whole genome sequence of AKK-LTA21F2 with the whole genome sequence of 29 strains of A. massiliensis downloaded from NCBI, extract the sequence which is not compared by nucmer, and then use BLASTn to verify the uniqueness of the sequence.

[0090] Figure 5Lane A shows the gel electrophoresis results of PCR amplification using AKK genus specific primers (corresponding to capital letters) and AKK-LTA21F2 strain specific primers (corresponding to small letters), respectively. A, a are AKK-LTA21F2 strain, B, b are A. massiliensis and, C, c and D, d are A. muciniphila strains.

[0091] The results show that only AKK-LTA21F2 has a single bright band at 170bp in lane A and 194bp in lane a, and the amplification results of other strains show that only AKK genus specific band (170bp) can be amplified, and AKK-LTA21F2 strain specific band (194bp) cannot be amplified. Further, Figure 5 Lane B shows the gel electrophoresis results of PCR amplification products of AKK-LTA21F2 strain specific primers of various strains, 1 is AKK-LTA21F2 strain, 2-5 are other AKK strains (two A. massiliensis and two A. muciniphila), 6-9 are non-target Bacteroides strains, 10-13 are non-target Lactobacillus strains, 14-16 are non-target Bifidobacterium strains, and the template of the negative control group is ddH2O without genome. From Figure 5 As can be seen from Lane B, the detection results of the primer set only show that AKK-LTA21F2 strain has a specific amplification band at 194bp, and other strains have no specific band. The above results show that the sequence 2497190-2497457 is a specific molecular target of AKK-LTA21F2 strain.

[0092] The characteristic sequence of AKK-LTA21F2 is as follows:

[0093] SEQ ID NO. 2: GAATAGACCTGTAGTAGCTGAACAATCCCGTTCTCCTGTTATCTCCGAGGT GCATCAGAACAATCCAGAACAATCCCCTGTAGCGGCGCAGCGGCCATCTATAAAGGCAACTGACATCAAAGAGACGAAAATCCCGTTTACTTCATTGGTAGTAGAAGCTTTTTCTATATGTGGAAGG CTCATTATCATTCTTGCCATTGTCTTTGCCGCTATCTTTTTCTTTGCTGGTATTATGAGTAAGGATACATTTTCCTTCTCAATGTCCTT.

[0094] Example 5

[0095] Analysis of the adaptability and genetic characteristics of AKK-LTA21F2 to oxygen stress environment

[0096] After the activated AKK bacterial solution was continuously gradient diluted, it was plated on modified BHI plates. One plate was left in the anaerobic workstation, while the other plates were exposed to natural environmental oxygen in a 37°C incubator for 12h, and then returned to the anaerobic workstation for further culture. The tolerance of the strain to environmental oxygen was determined by measuring the ratio of CFU between oxygen exposure time and non-oxygen exposure. Fresh culture of AKK bacteria was transferred to modified BHI medium containing 1.5mmol / L H2O2 at an inoculation amount of 2%, and anaerobically cultured for 2h. The viable bacterial count at 0h and 2h of culture was counted respectively, and the tolerance of the strain to H2O2 was compared.

[0097] According to the functional annotation generated by eggNOG-mapper, the corresponding case of bacteria related to oxidative stress enzymes was found, such as catalase, superoxide dismutase, thioredoxin, pyridine nucleotide-disulfide oxidoreductase, and the possibility of its existence was analyzed.

[0098] 1. Air exposure and H2O2 stress test

[0099] Anaerobic bacteria, especially probiotic bacterial strains, are often subjected to oxygen stress during culture due to exposure to oxygen-containing environment. It is of great significance to analyze the adaptive potential of strains to oxygen stress environment. Therefore, oxygen exposure and H2O2 stress test was carried out, and the results showed that the bacterial solution of AKK-LTA21F2 in logarithmic growth phase exposed to natural oxygen-containing environment for 48h, after plate streaking, the strain could still grow normally. When counting by plate dilution and plating, the survival rate of the strain was 90.88%( Figure 6 A) after 12h exposure to oxygen in the same gradient counting plate. In addition, AKK-LTA21F2 remained in liquid medium containing 1.5M H2O2 for 2h, and compared with the control, the viable bacterial count not only did not decrease, but increased by 25.26%( Figure 6 B). The above results showed that AKK-LTA21F2 had very good adaptability to environmental oxygen stress.

[0100] 2. Analysis of AKK-LTA21F2 antioxidant activity genes

[0101] AKK-LTA21F2 has 13 antioxidant activity genes numbered by whole genome information analysis (Table 2). The annotated oxidoreductase-related gene cluster mainly includes katA and katE: catalase family (EC: 1.11.1.6, ko00630: glyoxylate and dicarboxylate metabolism); SOD2: iron / manganese superoxide dismutase, alpha-helical domain (EC: 1.15.1.1, ko04013: MAPK signaling pathway); cysJ: hydroxylamine reductase activity (EC: 1.8.1.2); TXN, trxA: thioredoxin-like domain (ko04621: NOD-like receptor signaling pathway); nuoE: thioredoxin-like [2Fe-2S] ferredoxin (EC: 1.6.5.3, ko00190: oxidative phosphorylation); trxB, TRR: pyridine nucleotide-disulfide oxidoreductase (EC: 1.8.1.9, selenocompound metabolism); DLD, lpd, pdhD: pyridine nucleotide-disulfide oxidoreductase, dimerization domain (EC: 1.8.1.4, glycolysis / gluconeogenesis). The above results show that AKK-LTA21F2 strain has rich oxidoreductase-related genes in vivo.

[0102] Table 2 Antioxidant activity gene system of AKK-LTA21F2

[0103]

[0104] Example 6

[0105] AKK-LTA21F2 carbon source utilization and mucin degradation-related glycosyl hydrolases

[0106] Biolog GEN III Microstation 96-well plates were used to determine the utilization of 95 carbon sources by Akkermansia (AKK-LTA21F2) under strict sterile operation conditions. The bacterial solution cultured to the end of the logarithmic growth phase was centrifuged (8000 rpm, 10 min, 4°C) and washed 2-3 times with sterile water to remove residual culture medium. Then, the turbidity was adjusted to 75±3%, and a bacterial suspension was prepared using Biolog inoculum C. The bacterial suspension was inoculated into the micro-hole recognition plate and placed in an anaerobic workstation at 37°C for 48 h. After incubation, the OD 590 value of each well was determined using a Biolog MicroStation.

[0107] According to the CAZy database annotation generated by eggNOG-mapper, the presence of enzymes related to AKK-LTA21F2 mucin degradation glycosyl hydrolase family: alpha-fucosidase (GH29, most GH95 family members), alpha-sialidase (GH33), galactosidase (GH27, GH35, GH110, partial GH2, GH95 family members), beta-acetylhexosaminidase (GH20), beta-acetyl galactosamine (GH123), alpha-N-acetylglucosaminidase (GH84, GH89) was annotated and analyzed.

[0108] 1. Carbon source utilization characteristics of AKK-LTA21F2

[0109] The results of analyzing the carbon source utilization potential of AKK-LTA21F2 strain showed that the strain had strong ability to utilize L-fuculose, L-rhamnose, D-galacturonate, alpha-ketobutyrate, alpha-ketopentanoate and 3-methyl-D-glucose. It was also found that the strain could also utilize D-fructose, 6-O-D-glucopyranosylacy-D-fructofuranose, D-galactose, ketonitrile acid and D-glycose Figure 7 ).

[0110] 2. Mucin-degrading enzymes of AKK-LTA21F2

[0111] The monosaccharide composition of mucin mainly includes galactose, sialic acid, fucose, N-acetyl galactosamine and N-acetyl glucosamine. The glycosyl hydrolase family related to mucin degradation includes alpha-fucosidase (GH29, most GH95 family members), alpha-sialidase (GH33), galactosidase (GH27, GH35, GH110, partial GH2, GH95 family members), beta-acetylhexosaminidase (GH20), beta-acetyl galactosamine (GH123), alpha-N-acetylglucosaminidase (GH84, GH89). There are four copies of GH29, two copies of GH95, two copies of GH33, eight copies of GH20 and one copy of GH84 in AKK-LTA21F2.

[0112] Example 7

[0113] Application of AKK-LTA21F2 in pilot production

[0114] AKK-LTA21F2 has been proven to be directly used in pilot fermentation production to obtain live bacterial preparation, and can also be added to food, feed and medicine in the form of freeze-dried powder to adjust the intestinal flora of humans or animals and improve the immunity of the body. The LTA21F2 bacterial preparation can also be used in a non-living form.

[0115] 1. Pilot fermentation production

[0116] As one of the preferred is to use Akkermansia muciniphila subsp. LTA21F2 for pilot scale production. The pilot production method of Akkermansia muciniphila subsp. LTA21F2 is as follows: first, according to the existing formula, 150L liquid medium is weighed and poured into a 200L fermenter, and sterilized, cooled, temperature controlled and other preparation work is carried out. Then 3L seed liquid is inoculated into 150L liquid medium at an inoculation amount of 2% (v:v), and the mixed anaerobic gas (90% N2, 5% H2 and 5% CO2) is continuously introduced for cultivation, the culture temperature is 37℃, and the OD value, pH value and viable cell count in the fermentation process are monitored. Since it dropped to 5.50 (close to the final value of about 5.30) at 18h, it is considered that the pH value drops very quickly, and it is decided to stop fermentation at 41h and count the viable cells and harvest the bacterial cells.

[0117] PW dilution liquid is used to dilute the fermentation broth at different concentrations, and the viable cell count is carried out by pouring method. The results are shown in Table 2. At 41h when the fermentation is stopped, 10 Figure 8 CFU / mL or more is obtained by PW dilution pouring method. -12 The viable cell count results of gradient are: 1.53×10 15 CFU / mL or more. In addition, after the culture solution is centrifuged by a tubular centrifuge, the yield of the bacterial slurry is 0.10%.

[0118] Since the pH value dropped very quickly during the first 150L capacity fermentation, the fermentation broth entered a high acidity environment early, which led to little change in OD value in the late fermentation, and further led to low yield of bacterial slurry, so an acid-base regulation strategy was introduced for fermentation process optimization to make AKK bacteria grow at a suitable pH to improve the yield of bacterial cells. As shown in Table 3, after the pH value was raised from 5.50 to 5.90 by adding alkali at 24h, it was found that the OD value of the second 150L pilot production increased by 28.57%, the yield of bacterial slurry was 2.5 times that of the original, and increased by 150%, indicating that the use of alkali addition strategy can effectively improve the yield of bacterial cells in the pilot production of AKK bacteria. In terms of viable cell count, the 48h fermentation broth at 10 -11 , 10 -12 and 10 -13 CFU / mL or more. 16

[0119] Table 3 Comparison of AKK-LTA21F2 strain in two 150L pilot production data

[0120]

[0121] 2, freeze-dried powder count ​

[0122] Lyophilized powder was prepared using *Ackermannii malathione* subsp. *marginata* LTA21F2. The fermentation broth of LTA21F2 cultured to the logarithmic growth phase was transferred to a tubular centrifuge and centrifuged at 50 Hz. After centrifugation of 150 L of broth, bacterial sludge was scraped from the filter membrane to obtain *Ackermannii malathione* bacterial sludge. A freeze-drying product protectant (12 g skim milk powder, 2 g sucrose, and 2 g trehalose were weighed and added to 100 mL of distilled water to prepare a mixed protectant with a weight fraction of 12% skim milk powder, 2% sucrose, and 2% trehalose) was mixed with the bacterial sludge at a mass ratio of 20:1. The mixture was then frozen at -80℃ for 4 hours, and finally freeze-dried to obtain AKK-LTA21F2 lyophilized bacterial powder.

[0123] Weigh 1g of each of the two lyophilized powders and add them to a 50mL centrifuge tube containing 9mL LPW diluent. After dissolving, simply vortex to mix, then leave at room temperature for at least 10 minutes to allow for complete dissolution. After vortexing again, record this tube as 10. -1 Gradient, successively diluted downwards to 10 -15 gradient.

[0124] like Figure 9 As shown, freeze-dried powder No. ① (first pilot production) was produced at 10... -13 10 -14 and 10 -15 Pour-over culture counting was performed at three PW dilution gradients, with the final count at 10⁻⁶. -15 The growth under these conditions yielded suitable colony counts (32 and 24), and the viable count of freeze-dried powder No. 1 was 2.8 × 10⁻⁶. 16 CFU / g.

[0125] Freeze-dried powder No. 2 (second pilot production) was produced at 10... -13 10 -14 and 10 -15 Pour-over culture was performed at three PW dilution gradients. Each gradient eventually became confluent (over 1000 colonies), making accurate counting impossible. The estimated viable count for freeze-dried powder #2 was 10-1. 18 CFU / g or higher.

[0126] In summary, the viable count of the freeze-dried powder of this strain after vacuum freeze-drying was 10. 16 CFU / g ~ 10 18 The CFU / g level was between or above, and compared with relevant reports at home and abroad, the live bacterial count of the freeze-dried Akkermansia muciniphila subsp. martensii reached the highest value reported to date.

[0127] Example 8

[0128] AKK-LTA21F2 increases mouse survival rate and regulates aging markers

[0129] Experimental method: 18-month-old natural aging male C57BL / 6J mice were randomly divided into two groups after one week of adaptive feeding, namely the aging model control group (Old, n = 20) and the AKK-LTA21F2 bacteria intervention group (Akk, n = 20). Two-month-old male mice were divided into a young control group (YC, n = 10). One week before intervention, the aging mice were treated with a 3-in-1 mixed antibiotic, including 10 g / L metronidazole, 5 g / L vancomycin, and 5 g / L neomycin, at a dose of 0.1 mL / 10 g of body weight. After antibiotic treatment, the Akk group was given 200 μL of AKK-LTA21F2 live bacteria resuspension (with a live bacteria count of about 5 x 10 9 CFU / mL) by gavage, for 6 months. The Old group and the YC group were fed a standard diet for feeding without other interventions. The blood samples of the mice were collected in sterile EP tubes and left to stand at room temperature for 2 h. Then the blood samples were centrifuged (4°C, 5000 r / min, 10 min) to obtain serum. The serum samples were used for determination of oxidative stress indicators, inflammatory factor indicators, and blood biochemical indicators.

[0130] Experimental results: From the 18th month, the present application continuously recorded the death of 20 mice until the end of the experiment to calculate the survival rate of the mice. The Old group of aging mice only had 11 left alive at the end of the experiment at 24 months, while the Akk group still had 17 out of the original 20 alive at 24 months.

[0131] Figure 10 It is shown that the supplementation of AKK-LTA21F2 can significantly prolong the life span of mice, so that the survival rate of the AKK intervention group mice is 85%, while the survival rate of the control group is only 55%, with a difference of 30% between the two, which is very significant (p < 0.05).

[0132] Further, the present application evaluated the oxidative stress, inflammatory response, and lipopolysaccharide of the mouse samples, and the aging markers. The serum oxidative stress level showed that compared with YC, the serum SOD and T-AOC of Old mice were significantly reduced by 35.98% and 37.82%, respectively, while the MDA content was significantly increased by 55.10%. Compared with Old, AKK-LTA21F2 intervention can significantly increase the SOD (43.17%) and T-AOC (49.78%) activity of aging mice, and significantly reduce the MDA content by 27.92% (p < 0.05). Figure 11(A). This indicates that the oxidative stress level in aging mice was significantly improved after intervention with AKK-LTA21F2. Furthermore, compared with YC, the serum concentrations of LPS, TNF-α, and IL-1β in aging mice were significantly increased, indicating a significantly higher level of inflammation and weakened immunity in aging mice. However, after AKK-LTA21F2 supplementation, the serum concentrations of LPS, TNF-α, and IL-1β in aging mice significantly decreased by 45.87%, 33.42%, and 32.02%, respectively, indicating a reduction in systemic inflammation and enhanced immunity in the mice. Figure 11 (B)

[0133] From the perspective of blood biochemical indicators, the AKK-LTA21F2 strain significantly reduced aspartate aminotransferase levels in aging mice. Furthermore, AKK-LTA21F2 intervention significantly increased serum total protein levels in aging mice by 14.79%, comparable to the YC group. Figure 11 (C). From the perspective of serum blood glucose levels, the naturally aging mouse group showed symptoms of hypoglycemia and a significant trend of reduced food intake. This may be due to the decline of gastrointestinal function caused by aging, and it also indicates that their body's metabolism is unable to maintain healthy vital signs. In contrast, the Akk group maintained the glucose content of the naturally aging mice at a normal level. This shows that AKK-LTA21F2 intervention is beneficial to maintaining normal healthy vital signs in mice.

[0134] Example 9

[0135] AKK-LTA21F2 improves anxiety levels in aging mice.

[0136] Experimental Methods: The open field experiment was conducted using a square black test box connected to a computer and a camera, placed in a well-lit and soundproofed room. The camera was aimed at the open field area, and the computer divided the open field area into nine equal-area square regions. Mice were placed into the open field from the edge and allowed to explore freely for 5 minutes. SuperMaze software was used to record the total distance traveled by the mice, the number of times they stood upright on their hind legs, the distance they traveled in the central area, the number of times they crossed the central area, and the time spent in the central area.

[0137] The open field test can reflect the motor ability and anxiety levels of mice. The mouse open field movement trajectory is shown below. Figure 12 As shown, mice in the Akk and YC groups were more likely to enter the central area of ​​the open field and move back and forth between different grids than mice in the Old group, while mice in the Old group only moved along the edge of the open field and rarely entered the central area. Figure 12 (A and B). Compared with the Old group, the Akk group and YC mice traveled significantly farther in open areas. Figure 12Central C). Compared with the Old group, the number of times into the center and the total walking distance of Akk group increased by 58.28% and 192.31% respectively (p<0.05), which indicated that after the intervention of AKK-LTA21F2, the aged mice not only had a bigger courage (could go to the center area), stronger physical strength (walked more), and a strong desire to explore (interlaced back and forth). Figure 12 The number of times of hind limb standing of mice was negatively correlated with their anxiety level. Compared with the Old group, the number of times of hind limb standing of Akk group and YC group increased by 210.06% and 246.15% respectively (p<0.05)

[0138] Example 10

[0139] AKK-LTA21F2 improves the learning and memory ability of aged mice

[0140] Experimental method: The water maze is used to measure the hippocampus-based spatial memory and learning ability. The water maze is composed of a 1.2-meter-diameter circular pool, which is filled with tap water with a water temperature of about 26°C. Titanium dioxide (non-toxic white dye) is added to the water to make the pool bottom color background white. A clear, round escape platform is placed 1-2 cm below the water surface. In order to survive in the water, the mouse must find the hidden escape platform. Each experiment starts with the mouse facing the pool wall, and tests the first, second, third, and fourth quadrants, respectively. Each experiment allows the mouse to enter from a different quadrant, and the time to find the hidden platform is 60 seconds. If the mouse does not find the platform, it is guided to the platform and learns for 60 seconds to familiarize itself with the location of the visual cues. If the mouse can find the platform, it is allowed to stay on the platform for 20 seconds. After 4 days of testing, the spatial exploration experiment is performed on the 5th day to test the memory and learning ability of the mouse. On the 6th day, the escape platform is removed, and the mouse is randomly placed in one quadrant and allowed to swim for 60 seconds. A camera above the pool is used to capture the swimming trajectory of the mouse. The path length, swimming speed, time spent in each quadrant, and number of times crossing the platform of the mouse are recorded using SuperMaze software.

[0141] The water maze experiment can reflect the cognitive learning and memory ability of mice, and the experimental results are shown in Figure 13 After 4 days of continuous positioning navigation adaptive training, analysis of the water maze experiment trajectory of mice on the 5th day found that the Old group had difficulty finding the platform in the water maze, while the Akk group mice could quickly reach the platform, and these trajectories were comparable to the young control group Figure 13Figure 6A. After continuous training of the water maze positioning navigation, all mice can shorten the time of escape latency. Notably, compared with the Old group, the escape latency of the Akk group and the YC group on the 5th day was significantly shortened by 76.32% and 74.82% respectively. Figure 13 Figure 6B. In the water maze exploration experiment without platform, compared with the Old group, the Akk group of mice significantly increased the target quadrant residence time and the number of crossing the platform by 56.65% and 150.00% respectively. Figure 13 Figures 6C and 6D. In particular, the overall path of the Akk group is more regular and the purpose is more clear. These trends are comparable to the YC group. The old mice supplemented with AKK bacteria are obviously goal-oriented, and all mice enter the target platform quadrant, indicating that the mice in this group can remember the location of the target platform. The results of the water maze experiment show that the intervention of AKK-LTA21F2 bacteria has the effect of improving the cognitive and memory decline of old mice.

[0142] Example 11

[0143] Effects of AKK-LTA21F2 intervention on oxidative stress and inflammatory factors in the brain tissue of old mice

[0144] Experimental method: The brain tissue was immediately frozen in liquid nitrogen after dissection and stored at -80°C. On the day of measurement, the brain tissue was taken out, accurately weighed, and then added with 4 times the volume of physiological saline according to the weight, and the brain homogenate was prepared in an ice water bath using a tissue homogenizer. The superoxide dismutase (SOD), glutathione peroxidase (GSH-Px) activity and malondialdehyde (MDA) content in the brain tissue were determined using the kit from Jiangsu Nanjing Jiancheng Biological Engineering Institute, China. The tumor necrosis factor (TNF-α), interleukin-1β (IL-1β) and C-reactive protein (CRP) in the brain tissue were determined using the enzyme-linked immunosorbent kit from Shanghai Jianglai Biological Technology Co., Ltd., China.

[0145] The results of the anti-oxidation index and inflammatory factor index in the brain tissue of the mouse samples are shown in Table 2. Figure 14 Compared with the YC group, the levels of the two positive indexes SOD and GSH-Px in the brain tissue of the Old group mice were reduced by 35.74% and 34.02% respectively, while the level of the reverse index MDA was increased by 70.06%. Compared with the Old group, the positive indexes SOD and GSH-Px in the brain tissue of the Akk group mice were increased by 42.37% and 25.26% respectively, and MDA was reduced by 37.49%, indicating that AKK-LTA21F2 can alleviate oxidative stress by increasing the level of antioxidant enzymes. Figure 14Fig. 6A). The results of the inflammatory cytokine analysis of the mouse samples showed that AKK intervention significantly reduced the content of inflammatory cytokines TNF-a (52.77%), IL-1b (51.46%) and CRP (32.62%) in the brain tissue compared with the Old group, and the concentrations of these three inflammatory cytokines in the Akk group were similar to those in the YC group Figure 14 Fig. 6B). These results showed that AKK-LTA21F2 can avoid hippocampal damage in aged mice and enhance the ability of brain tissue to resist oxidative stress and reduce inflammation.

[0146] Example 12

[0147] AKK-LTA21F2 regulates the histopathology of the colon tissue of aged mice

[0148] Experimental method: The mouse colon tissue was fixed with 4% paraformaldehyde for 24 h, embedded in paraffin, and stained with hematoxylin-eosin (H&E). AB-PAS solution set (Servicebio, Wuhan, China) was used for AB-PAS staining according to the instructions. In detail, the small intestine sections were sequentially stained with AB-PAS C, AB-PAS B and AB-PAS A, then dehydrated and sealed with neutral resin, and then observed under a microscope for image observation.

[0149] Aging usually affects the morphological structure of major tissue cells. H&E staining and AB-PAS staining were used to observe the histopathology of the colon of the experimental mice, and the aged mice showed obvious changes Figure 15 Fig. 6A and B). Compared with the Old group, the Old group samples showed a significant decrease in goblet cells, inflammatory cell infiltration, and damage to the bottom of the crypt by HE staining (black arrows), while the histological changes of the Akk group mouse samples were improved, showing more orderly arranged and more complete shaped goblet cells. In addition, the results of AB-PAS staining sections showed that there were a large number of crypts filled with mucus (blue staining) in the colon of the Akk group; however, this blue mucus material was significantly lighter in color, less in quantity and scattered in the Old group (red arrow).

[0150] Example 13

[0151] AKK-LTA21F2 regulates the intestinal flora of aged mice

[0152] Gut microbiota assay: Fecal samples were collected immediately after the probiotic intervention, rapidly frozen in liquid nitrogen, and then stored at -80°C. Total DNA was extracted from feces using the Tiangen S96 magnetic fecal DNA kit manufactured by Tiangen Biotech (Beijing) Co., Ltd. 1.8% agarose gel electrophoresis was used to determine the quality and quantity of the isolated DNA. The concentration and purity of the DNA were determined using a NanoDrop 2000 UV-Vis spectrophotometer (Thermo Scientific, Wilmington, USA). The V3-V4 region of the 16S rRNA gene was amplified by polymerase chain reaction on an Illumina Novaseq 6000 platform (2×250bp) using universal primers 338F:5′-ATCCTACGGGGGAGGCAGCA-3′ and 806R:5′-GCACACHVGGGTWTCTAAT-3′ for end-pairing. The amplified products were quantified using Qsep-400.

[0153] Experimental results are as follows Figure 16 As shown in the figure, this diagram illustrates the impact of AKK-LTA21F2 intervention on the microbial composition of naturally aging mice at the phylum, family, and genus levels. At the phylum level, the most abundant enterobacteria in each group were Bacteroidota, Firmicutes, and Proteobacteria. Figure 16 (A) Compared with the Old group, the F / B ratio in the AKK bacteria intervention group was significantly increased, while the relative abundance of Bacteroidetes was significantly reduced by 36.41%, and the abundance of Verrucous Microbes was significantly increased. At the family level, Enterobacteriaceae Muribaculaceae, Lachnospiraceae, Lactobacillaceae, Bacteroidaceae, and Prevotellaceae were identified as the dominant bacterial groups in each group. AKK bacteria effectively alleviated the age-related increase in the relative abundance of Bacteroidaceae and Prevotellaceae. Figure 16 (B). Furthermore, at the genus level, the Old group samples had the lowest proportion of the top 10 dominant bacterial genera, but the distribution pattern of enterobacteria after treatment in the AKK intervention group was similar to that in the YC group ( Figure 16 (C). In particular, after intervention with AKK-LTA21F2, the relative abundance of beneficial bacteria such as unclassified-Muribaculaceae and Akkermansia increased. The above results demonstrate that the AKK-LTA21F2 cultured in this invention can colonize naturally aging mice and rejuvenate their gut microbiota composition, thus having a certain regulatory effect on the gut microbiota of naturally aging mice.

[0154] Obviously, the above embodiments of the present application are merely exemplary but not intended to limit the embodiments of the present application. Based on the above description, other different forms of changes or variations can be made by those skilled in the art. Here, it is not necessary or possible to exhaust all the embodiments. Any modification, equivalent replacement and improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the claims of the present application.

Claims

1. A strain of Akkermansia massiliensis LTA21F2, characterized in that, The strain was preserved in Guangdong Microbial Culture Collection Center on December 4, 2022, the address is No. 59, Building 5, Guangzhou, Guangzhou, and the preservation number is GDMCC No: 63035.

2. A microbial inoculant, characterized in that, The Akkermansia massiliensis LTA21F2 of claim 1.

3. The method of claim 2, wherein the microbial inoculant is prepared by the steps of: The method comprises the following steps: The fermentation broth of Akkermansia massiliensis LTA21F2 is centrifuged to obtain a bacterial slurry. The freeze-dried product protective agent is mixed with the bacterial slurry at a mass ratio of 20:1, and freeze-dried to obtain a microbial inoculant freeze-dried powder.

4. The production method according to claim 3, characterized by, The freeze-dried product protective agent comprises skimmed milk powder, sucrose and trehalose; the mass ratio of the milk powder, sucrose and trehalose is 6:1:1; and the mass ratio of the freeze-dried product protective agent to the bacterial slurry is 20:

1.

5. The use of Akkermansia massiliensis LTA21F2 of claim 1 or the microbial inoculant of claim 2 in the preparation of a drug for preventing and treating anxiety.

6. A medicament for preventing and treating anxiety, characterized by comprising the compound of claim 1 as an active ingredient. The Akkermansia massiliensis LTA21F2 of claim 1 or the microbial inoculant of claim 2.

7. The use of Akkermansia massiliensis LTA21F2 of claim 1 or the microbial inoculant of claim 2 in the preparation of a product for improving the immunity of the body.

8. A product for improving immunity of a living body, characterized by comprising the composition according to any one of claims 1 to 7. The product comprises Akkermansia massiliensis LTA21F2 of claim 1 or the microbial inoculant of claim 2. The product is a drug or a feed.

Images