Honeysuckle flower pigment synthesis gene and application thereof in regulating and controlling content and resistance of plant flower pigment

By overexpressing the honeysuckle anthocyanin synthesis gene in plants, the problems of regulating anthocyanin content and improving stress resistance were solved, resulting in enhanced anthocyanin content and improved drought and salt resistance, providing gene resources and theoretical support for breeding highly resistant plant varieties.

CN120888563APending Publication Date: 2025-11-04INST OF TRADITIONAL CHINESE MEDICINE HENAN ACAD OF AGRI SCI
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202511271168.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-08
Publication Date
2025-11-04

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively regulate anthocyanin content in plants and improve their resistance to abiotic stresses, especially their adaptability under drought and salt stress.

Method used

We provide the honeysuckle anthocyanin synthesis gene and its recombinant vector, and use genetic transformation technology to stably overexpress it in plants, thereby increasing anthocyanin content and improving stress resistance.

Benefits of technology

It significantly enhances the anthocyanin content and drought and salt resistance of plants, providing new genetic resources and theoretical support, and making it possible to breed highly resistant plant varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120888563A_ABST
    Figure CN120888563A_ABST
Patent Text Reader

Abstract

The invention discloses a honeysuckle flower pigment synthesis gene and application thereof in regulating and controlling the content and resistance of plant anthocyanidin, and belongs to the technical field of gene engineering. The nucleotide sequence of the honeysuckle flower pigment synthesis gene is as shown in SEQ ID NO. 6. The invention provides a honeysuckle flower pigment synthesis gene. The gene has the effects of regulating and controlling the content of anthocyanidin in plants and regulating and controlling the stress resistance of the plants. The gene is introduced into a plant body by constructing an overexpression vector, so that the gene is stably overexpressed, the anthocyanidin content in the plant is remarkably increased, and the petal color and seed coat color of the plant are darkened; the resistance of the plant to drought stress and salt stress is also remarkably enhanced, so that the plant can adapt to a severe environment more easily, and a new gene resource and a theoretical support are provided for breeding of high-resistance plant varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a honeysuckle anthocyanin synthesis gene and its application in regulating anthocyanin content and resistance in plants. Background Technology

[0002] Anthocyanins are naturally occurring pigments that not only give plants different colors such as red, purple, and blue, but also play an important role in plant growth, development, and stress defense. Therefore, research on the regulation of anthocyanin synthesis has gradually attracted the attention of researchers. How to use molecular biology techniques to increase the anthocyanin content of plants and cultivate new varieties with high anthocyanin content has become a hot topic in the research community. The different colors exhibited by different plant tissues are due to the differential accumulation of anthocyanins in plant organs and tissues. Transcription factors play a crucial role in regulating the expression of structural genes in the anthocyanin synthesis pathway, ensuring that these genes are expressed appropriately and in suitable amounts in specific tissues. Related studies have shown that the bHLH transcription factor plays an important role in anthocyanin biosynthesis and regulation.

[0003] bHLH transcription factors, or basic helix-loop-helix (bHLH) proteins, are a superfamily of transcription factors widely found in plants, animals, and fungi. Members of the bHLH superfamily contain two highly conserved and functionally distinct domains: a basic region and a helix-loop-helix (HLH) region. Studies have shown that bHLH primarily regulates anthocyanin levels by modulating the expression of structural genes involved in the anthocyanin biosynthesis pathway, ultimately affecting the color of flowers, fruits, and leaves. In addition, bHLH family transcription factors also participate in plant responses to abiotic stresses, playing a crucial role in regulating plant tolerance to salt and drought stress by influencing osmotic balance.

[0004] Honeysuckle (Lonicera japonica Thunb.), also known as mandarin duck vine or golden honeysuckle, is a traditional medicinal plant. Its dried flower buds or unopened flowers are the main medicinal parts. Honeysuckle was first recorded in the *Compendium of Materia Medica*, thousands of years ago, and is one of the 110 species listed in the *Medicinal and Edible Plants* directory. Honeysuckle contains abundant volatile oils, flavonoids, organic acids, triterpenoids, and iridoids, possessing antibacterial, anti-inflammatory, antiviral, antitumor, and anti-aging effects. Honeysuckle exhibits strong adaptability, including cold resistance, heat tolerance, and drought resistance. Therefore, its stress-resistance genes have great potential for development. Identifying its functional genes that respond to abiotic stress and exploring their roles in abiotic adaptation can provide clues for improving the molecular network of plant stress resistance, elucidating the molecular mechanisms of abiotic stress, and providing breeding targets for selecting high-quality, stress-resistant new varieties. Summary of the Invention

[0005] The purpose of this invention is to provide a honeysuckle anthocyanin synthesis gene and its application in regulating anthocyanin content and resistance in plants, thereby addressing the problems existing in the prior art. This invention provides a honeysuckle anthocyanin synthesis gene that regulates anthocyanin content and stress resistance in plants. By constructing an overexpression vector and introducing this gene into plants, stable overexpression significantly enhances anthocyanin content, resulting in darker petal and seed coat colors. It also significantly enhances plant resistance to drought and salt stress, enabling plants to adapt more easily to harsh environments, providing new gene resources and theoretical support for breeding highly resistant plant varieties.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides a honeysuckle anthocyanin synthesis gene, the nucleotide sequence of which is shown in SEQ ID NO.6.

[0008] The present invention also provides a protein encoded by the above-mentioned honeysuckle anthocyanin synthesis gene, the amino acid sequence of which is shown in SEQ ID NO.7.

[0009] The present invention also provides a recombinant vector containing the above-mentioned honeysuckle pigment synthesis gene.

[0010] The present invention also provides a recombinant microorganism, wherein the recombinant microorganism contains the above-mentioned honeysuckle anthocyanin synthesis gene or the above-mentioned recombinant vector.

[0011] The present invention also provides the application of the above-mentioned honeysuckle anthocyanin synthesis gene, the above-mentioned protein, the above-mentioned recombinant vector, or the above-mentioned recombinant microorganism in regulating the anthocyanin content of plants.

[0012] The present invention also provides the application of the above-mentioned honeysuckle anthocyanin synthesis gene, the above-mentioned protein, the above-mentioned recombinant vector or the above-mentioned recombinant microorganism in regulating plant stress resistance, wherein the stress resistance includes drought resistance and salt resistance.

[0013] Optionally, the plants include honeysuckle, Arabidopsis thaliana, and tobacco.

[0014] The present invention also provides a method for regulating the anthocyanin content of plants, including the step of using genetic transformation technology to transfer the honeysuckle anthocyanin synthesis gene into the plant, so as to stably overexpress it and increase the anthocyanin content in the plant.

[0015] The nucleotide sequence of the honeysuckle anthocyanin synthesis gene is shown in SEQ ID NO.6.

[0016] The present invention also provides a method for regulating plant stress resistance, including the step of using genetic transformation technology to transfer the honeysuckle anthocyanin synthesis gene into the plant and stably overexpress it, thereby improving the plant's drought resistance and salt tolerance;

[0017] The nucleotide sequence of the honeysuckle anthocyanin synthesis gene is shown in SEQ ID NO.6.

[0018] Optionally, the plants include honeysuckle, Arabidopsis thaliana, and tobacco.

[0019] The present invention discloses the following technical effects:

[0020] This invention provides a honeysuckle anthocyanin synthesis gene, which plays a role in regulating anthocyanin content and stress resistance in plants. By constructing an overexpression vector, this gene was introduced into Arabidopsis thaliana or tobacco, achieving stable overexpression and significantly enhancing anthocyanin content, resulting in darker petal and seed coat colors. It also significantly enhanced plant resistance to drought and salt stress, making the plants more adaptable to harsh environments, providing new genetic resources and theoretical support for breeding highly resistant plant varieties. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0022] Figure 1 Results of subcellular localization analysis of honeysuckle pigment synthesis genes;

[0023] Figure 2The expression levels of structural genes in the anthocyanin synthesis pathway of Lonicera japonica and Lonicera rubra are given; where * indicates P<0.05, ** indicates P<0.01, and ns indicates P>0.05.

[0024] Figure 3 The results show the interaction analysis of the promoters of the honeysuckle anthocyanin synthesis gene and the structural gene of the anthocyanin synthesis pathway; where A is a schematic diagram of the construction of the yeast single-hybrid vector; B is the result of the yeast single-hybrid experiment; C is a schematic diagram of the construction of the dual-luciferase reporter vector; D is the result of the dual-luciferase reporter experiment; E is the LUC / REN ratio.

[0025] Figure 4 Functional complementation of the honeysuckle anthocyanin synthesis gene in the Arabidopsis thaliana tt8 mutant; where A represents the expression level of the target gene in WT, tt8, and 35S::OE / tt8; B represents the seed color of WT, tt8, and 35S::OE / tt8 Arabidopsis thaliana; C represents the anthocyanin content of WT, tt8, and 35S::OE / tt8 plants; and D represents the relative expression level of anthocyanin synthesis-related genes in WT, tt8, and 35S::OE / tt8 plants.

[0026] Figure 5 Functional analysis of the honeysuckle anthocyanin synthesis gene overexpressed in tobacco; where A represents the phenotype of WT and transgenic tobacco flowers and the expression level of the target gene; B represents the anthocyanin content in the petals of WT and transgenic tobacco; and C represents the relative expression levels of anthocyanin synthesis-related genes in the petals of WT and transgenic tobacco.

[0027] Figure 6 Overexpression of the honeysuckle anthocyanin synthesis gene enhanced the drought stress resistance of Arabidopsis plants. A represents the phenotype of WT, tt8, and 35S::OE / tt8 plants after drought stress treatment; B represents the chemical staining analysis results of WT, tt8, and 35S::OE / tt8 plants after drought stress treatment; CH represents the SOD(C), POD(D), CAT(E), MDA(F), H2O2(G), and O2(C) content of WT, tt8, and 35S::OE / tt8 plants after drought stress treatment. 2- (H) content detection results;

[0028] Figure 7 Overexpression of the honeysuckle anthocyanin synthesis gene enhanced the salt stress resistance of Arabidopsis plants. A represents the phenotype of WT, tt8, and 35S::OE / tt8 plants after salt stress treatment; B represents the chemical staining analysis results of WT, tt8, and 35S::OE / tt8 plants after salt stress treatment; CH represents the SOD(C), POD(D), CAT(E), MDA(F), H2O2(G), and O2(C) content of WT, tt8, and 35S::OE / tt8 plants after salt stress treatment. 2-(H) content detection results. Detailed Implementation

[0029] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0030] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included within the scope of this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0031] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0032] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0033] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0034] Example 1: Cloning of the honeysuckle pigment synthesis gene

[0035] Using the Unigene gene sequence obtained from the Lonicera transcriptome database constructed by the Germplasm Resources Laboratory of the Institute of Chinese Medicinal Herbs, Henan Academy of Agricultural Sciences as a reference sequence, RACE primers GSP1 / GSP2 were designed and synthesized by Henan Youkang Gene Biotechnology Co., Ltd.

[0036] GSP1: GGTGCGATAAAGACAAGAAAGACGGTGC, SEQ ID NO.1;

[0037] GSP2: GAAGTTGACTGCTCAGAGAGTGCCG, SEQ ID NO. 2.

[0038] Total RNA was extracted from Lonicera japonica (Miyinhua No. 1, from the Institute of Chinese Medicinal Herbs, Henan Academy of Agricultural Sciences) using the Beijing Huayueyang Quick RNA Isolation Kit. The RACE 5' / 3' Kit was used to construct 5' and 3' libraries via reverse transcription. Using the honeysuckle 5' and 3' RACE cDNA libraries as templates, PCR amplification was performed using universal primers UPM (Universal Primer AMix) and the designed RACE primers to obtain the 5' and 3' end sequences of the honeysuckle anthocyanin synthesis gene. The 5' and 3'-cDNA fragment sequences obtained from sequencing were then spliced ​​together to obtain the full-length cDNA sequence (SEQ ID NO. 3).

[0039] SEQ ID NO.3:

[0040]

[0041] Based on the obtained full-length cDNA sequence, its largest coding frame (CDS) was located. PCR primers CDS-F / R were designed to amplify the full-length CDS. Using cDNA reverse-transcribed from total RNA as a template, PCR amplification of the full-length CDS was performed, followed by sequencing. The full-length CDS sequence of the gene was obtained (SEQ ID NO. 6), totaling 2052 bp and encoding 683 amino acids (SEQ ID NO. 7).

[0042] CDS-F: ATGGCGAGCGCACCCC, SEQ ID NO.4;

[0043] CDS-R: CTACTGGGGTATGATTTGGTTCATTG, SEQ ID NO.5.

[0044] SEQ ID NO.6:

[0045]

[0046] SEQ ID NO.7:

[0047] MASAPPSNRLQAMLQTAVQSVQWTYSLFWQLCPQQGMLVWGDGYYNGAIKTRKTVQPVEVSTEEASLQRSQQLRELYDTLSAGETNQPARRPSAALSPEDLTESEWFYLMCVSFSFPPGVGLPGKAYAKRQHVWLAGANEVDSKLFTRAILAKSARVQTVVCIPLLDGVVELGTTERIPEDHRLIQQVKSIFADHSVTQPPKPALSEQSTSNPGKSSSDIVRFHSPSLMVDKAVAAEPPIPTNQIDKEEEEEVDDDEEDEEEDDEDDADHSDSEAETETENRGGIGGSAEPSELMQVDMSEDIRLGSPDDGSNHLDSDFHLLAVSQIGNPVNPQQRADSYGAELTHRWPILHDPLINNLLPSSSGVPQLEELTQEDTHYSHTVSTILHRQSRQSSSTPSIIYSPHSSFTTWPTTTTLHHHHTFYVDTTSQYLLKYILFSVPYLHSQISLKSRDTSSATDQAARFRKGTPQDELSANHMLAERRCREKLNERFIILRSLVPFVTKMDKASILGDTIEYVKQLRKKIQDLEARTGQLEQLDHPRTRSGGVGDPQRSGVTNMSDKRKMRIVEGSGRTKPKAVELVPVPVPVPAPPPSANVDEGGQVEVSIIECDALVELQCKYREGLLLDVMQKLRELRVEITTVQSSLNNGIFVGELRAKVKENVSGKKVSIMEVKRAMNQIIPQ*。

[0048] Subcellular Localization Analysis of Lonicera Flower Pigment Synthesis Genes in Example 2

[0049] Homologous recombination primers EGFP-F / R with restriction enzyme sites were designed. Using the honeysuckle genome as a template, the complete coding sequence without stop codons was amplified using Toyobo KOD One high-fidelity enzyme (Toyobo, Japan), and purified using the TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 (TaKaRa, Japan). The pSUPER1300-EGFP vector was linearized using HindIII and KpnI restriction endonucleases. All purified products and linearized vectors were processed using Clone Biotechnology Co., Ltd. (Nanjing). II. The One Step Cloning Kit (Vazyme, China) was used for the recombination reaction. After transformation of DH5α competent cells, single colonies were picked for PCR detection, and the positive recombinant plasmid 35S::OE-GFP was extracted. The recombinant plasmid was verified by sequencing (Henan Youkang Gene Biotechnology Co., Ltd.).

[0050] EGFP-F: CAAATCGACTCTAGAAAGCTTATGGCGAGCGCACCCC, SEQ ID NO.8;

[0051] EGFP-R: GCCCTTGCTCACCATGGTACCCTGGGGTATGATTTGGTTCATTG, SEQ ID NO. 9.

[0052] The recombinant plasmid 35S::OE-GFP and the empty vector 35S::GFP were transformed into Agrobacterium GV3101 strain, respectively, and injected into the abaxial surface of 4-week-old tobacco leaves, and cultured for 48 hours. The fluorescence signal of GFP was observed using a ZESIS 710 laser confocal microscope. The results are as follows: Figure 1 As shown, the green fluorescence of GFP on the recombinant vector is present in both the cell membrane and the cell nucleus, indicating that the gene is localized in both the nuclear and membrane regions.

[0053] Example 3: Comparison of expression levels of structural genes in the anthocyanin synthesis pathway of Lonicera japonica and Lonicera rubra and Lonicera maculata

[0054] Red and white honeysuckle is a natural mutant of honeysuckle, with purplish-red buds, leaves, and stems, and red flowers. The expression of structural genes in the anthocyanin synthesis pathway of honeysuckle (GFLJ) and red and white honeysuckle (PFLJ) during their two-white-stage inflorescences was compared.

[0055] Total RNA was extracted from the two-white-stage inflorescences of *Lonicera japonica* and *Lonicera rubra* (from the Institute of Chinese Medicinal Herbs, Henan Academy of Agricultural Sciences) using the Quick RNA Isolation Kit from Beijing Huayueyang. The total RNA was then reverse transcribed into cDNA using the PrimeScript™ RT reagent Kit with gDNAEraser (Perfect Real Time) from Takara Bio Engineering (Dalian) Co., Ltd. The expression levels of anthocyanin synthesis pathway structural genes in *Lonicera japonica* and *Lonicera rubra* flowers were analyzed using the Takara SYBR Premix Ex Taq™ II (TliRNaseHPlus) quantitative real-time assay kit from Takara Bio.

[0056] The relative gene expression level was normalized using the LjG6PD gene as an internal reference, and 2 was used as the normalization factor. -ΔΔCT The method represents the relative quantification of genes (Reference: Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(delta-delta Ct) method[J]. Methods, 2001, 25: 402-408). The results are as follows: Figure 2 As shown, the expression levels of LjCHS, LjDFR, LjANS, and LjPAL genes were significantly higher in the darker red and white honeysuckle flowers than in honeysuckle itself. The expression levels of LjF3H and LjF3'H genes also showed significant differences between the two varieties, indicating that the difference in the expression levels of anthocyanin synthesis genes may be the main reason for the color difference between the two varieties.

[0057] Example 4: Interaction analysis of promoters of honeysuckle pigment synthesis genes and anthocyanin synthesis pathway structural genes.

[0058] 1. Dual-luciferase reporter assay

[0059] According to such Figure 3 As shown in step C, homologous recombination primers P62-F / R with restriction enzyme sites were designed. Using the honeysuckle genome as a template, the complete coding sequence of the honeysuckle anthocyanin synthesis gene was amplified. The pGreenII 002962-SK vector was digested with BamH1 and EcoR1 enzymes to clone the complete coding sequence of the honeysuckle anthocyanin synthesis gene into the linearized vector to obtain the 35S::OE recombinant vector.

[0060] P62-F: GCGGCCGCTCTAGAACTAGTGGATCCATGGCGAGCGCACCCC, SEQ ID NO.10;

[0061] P62-R: GTATCGATAAGCTTGATATCGAATTCCTACTGGGGTATGATTTGGTTCATTG, SEQ ID NO.11.

[0062] The pGreen II 0800-LUC vector was digested with Xho1 and BamH1 enzymes, and the promoter sequences of LjPAL, LjC4H, Lj4CL, LjCHS, LjCHI, LjF3H, LjF3'H, LjDFR, LjANS, and LjUFGT were cloned into the linearized vector to obtain the LUC-proGene recombinant vector.

[0063] The promoter sequences mentioned above were obtained by amplification using the primers shown in Table 1.

[0064] Table 1 Primers used for promoter sequence amplification

[0065] Primer name Sequence PLjPAL-F TCTTTGGACTTTGGTTGCTGC (SEQ ID NO. 12) PLjPAL-R ATTGGCAAAGCTGAATTTCCTG (SEQ ID NO. 13) PLjC4H-F ATGTATTGTGAAAGTGTAGCGGAT (SEQ ID NO. 14) PLjC4H-R TATGTTAGCAGGAGGTTGGGAT (SEQ ID NO. 15) PLj4CL-F ATTTCTATCCACGGGTTTTTGCA (SEQ ID NO. 16) PLj4CL-R AGCTTGAGCTTGAGTTTTTTTGC (SEQ ID NO. 17) PLjCHS-F GGTGCAAGGGATTGAGTGAAATA (SEQ ID NO. 18) PLjCHS-R GTTTAAATTAAGGTAGCTGGGGGT (SEQ ID NO. 19) PLjCHI-F TGAGTTTGAGGGGTGTGTTAGA (SEQ ID NO. 20) PLjCHI-R CAAGGGGATTTTAGGAGCAAATTG (SEQ ID NO. 21) PLj_F3H-F GTATCTTCAGAGGTACCATTTAGACG (SEQ ID NO. 22) PLj_F3H-R TGTTGGAACCCTTAGTTTTCTTTTCC (SEQ ID NO. 23) PLjF3'H-F TCTCCGCCAATTTTCAATGAA (SEQ ID NO. 24) PLjF3'H-R GTGTGTTACAAGTCTTGAGAGTG (SEQ ID NO. 25) PLjDFR-F TTTTTTTCCATCTTCTCACCCAA (SEQ ID NO. 26) PLjDFR-R GGCCGGCGATACTATAAACTTTA (SEQ ID NO. 27) PLjANS-F GTAGTGGTGCTTTGGGAGTGGGGT (SEQ ID NO. 28) PLjANS-R TTGTTTGTAGGGGATTGAAGGGGG (SEQ ID NO. 29) PLjUFGT-F TATGAAGAGACATGTGGCAACTC (SEQ ID NO. 30) PLjUFGT-R ATCAGTCAAATAGCATCGCGAT (SEQ ID NO. 31)

[0066] The recombinant vector and empty vector constructed above were transformed into Agrobacterium GV3101 (pSoup) strain, respectively. After picking single colonies for detection, positive single colonies were inoculated into 10 mL of LB liquid medium, and appropriate antibiotics were added. The culture was carried out until OD200. 600 =Approximately 0.8, collect bacterial cells, suspend the cells in resuspending solution (10mM MgCl2, 10mM MES, 200μM AS), adjust the OD value to 1.0, and inject the Agrobacterium culture medium containing transcription factors and promoters in equal volumes at a 1:1 ratio into the back of tobacco leaves that are 4 weeks old. After incubation for 48-72 hours, detect luciferase activity. 1mM d-luciferin potassium salt (D8390, Solarbio) is evenly spread on the surface of the injected tobacco leaves, reacted in the dark for 5-10 minutes, and fluorescence is captured using a live in vivo imaging system (ViviLBERNEWTON 7.0). A mixture of promoter and empty vector is injected as a negative control. For quantitative analysis, a double-luciferase reagent (double-... ReporterAssay E1910, Promega, MI, USA), calculated the firefly luciferase (LUC) / kidney worm luciferase (REN) ratio. The LUC / REN values ​​for the promoter and empty vector were set to 1 as a calibration value. Results were calculated from three independent experiments, each with six replicates.

[0067] The results are as follows Figure 3As shown in Figures D and E, the fluorescence intensity and enzyme activity of the mixed bacterial culture injected with 35S::OE and LUC-proLj4CL, LUC-proLj4CHS, and LUC-proLjF3'H were significantly higher than those of the control group, indicating that this gene may induce anthocyanin synthesis by activating the promoters of Lj4CL, Lj4CHS, and LjF3'H.

[0068] 2. Yeast one-hybrid experiment

[0069] According to such Figure 3 As shown in step A, homologous recombination primers pB42AD-F / R with restriction enzyme sites were designed. Using the honeysuckle genome as a template, the coding sequence of the honeysuckle anthocyanin synthesis gene was amplified. The pB42AD vector was digested with EcoRI and XhoI to integrate the coding sequence of the honeysuckle anthocyanin synthesis gene into the pB42AD vector to generate the prey vector. The promoter sequences of LjPAL, LjC4H, Lj4CL, LjCHS, LjCHI, LjF3H, LjF3'H, LjDFR, LjANS, and LjUFGT were introduced into the pLacZi vector through KpnI and XhoI sites to generate the baid vector.

[0070] The prey and bait plasmids were mixed in equal proportions and transformed into yeast strain EGY48. Selective growth was performed by culturing on SD / -Trp / -Ura medium at 30℃ for 3-5 days. Single colonies were then selected and cultured on SD / -Trp / -Ura and SD / -Trp / -Ura / Gal / Raf medium containing X-Gal at 30℃ for 2-3 days to observe color changes (Reference: Zhu MD, Liu YQ, Jiao GA, et al. The elite eating quality alleles Wxb and ALKb are regulated by OsDOF18 and coordinately improve head rice yield. Plant Biotechnology Journal (2024) 22, pp. 1582-1595). The empty vector pB42AD and the plasmid containing the pLaczi reporter gene with the corresponding promoter were used as negative controls.

[0071] pB42AD-F: GATTATGCCTCTCCCGAATTCATGGCGAGCGCACCC, SEQ ID NO.32;

[0072] pB42AD-R:GAAGAAGTCCAAAGCTTCTCGAGCTACTGGGGTATGATTTGGTTCATT G, SEQ ID NO. 33.

[0073] The results are as follows Figure 3 As shown in Figure B, pB42AD::OE, along with proLj4CL::pLacZi, proLjCHS::pLacZi, and proLjF3'H::pLacZi, can grow normally and turn blue on SD / -Trp / -Ura / Gal / Raf medium containing X-Gal, indicating that this gene interacts with Lj4CL, Lj4CHS, and LjF3'H.

[0074] Example 5: Construction and genetic transformation of honeysuckle anthocyanin synthesis gene overexpression vector in Arabidopsis thaliana and tobacco.

[0075] Homologous recombination primers PS13-F / R with restriction enzyme sites were designed. Using the honeysuckle genome as a template, the coding sequence of the honeysuckle anthocyanin synthesis gene was amplified. The pSuper1300 vector was digested with XbaI and SalI enzymes to clone the coding sequence of the honeysuckle anthocyanin synthesis gene into the linearized vector. The recombinant vector was transformed into Agrobacterium GV3101 strain by heat shock and introduced into the Arabidopsis thaliana tt8 mutant (gift from Ning Jia, published in JiaN, Wang JJ, Liu JM et al., 2021. DcTT8, abHLH transcription factor, regulate santhocyanin biosynthesis in Dendrobium candidum. Plant Physiology and Biochemistry 162, 603-612) by floral dip (Clough & Bent, 1998). Hygromycin was used to screen for transgenic homozygous plants (Reference: Clough SJ, Bent AF. 1998. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant Journal 16: 735-743). The Agrobacterium-mediated genetic transformation of tobacco K326 was performed using the same method described in previous studies (Reference: Ning G, Xiao X, Lv H, Li X, Zuo Y, Bao M. Shortening tobacco life cycle accelerates functional gene identification in genomic research. PlantBiol. 2012; 14(6):934-43). Leaves from homozygous Arabidopsis transgenic lines and corresponding wild-type and mutant tt8, as well as petals from T1 generation plants of transgenic tobacco lines and corresponding wild-type tobacco K326 plants, were harvested for anthocyanin determination and qRT-PCR gene expression analysis.

[0076] PS13-F: ATACACCAAATCGACTCTAGTCTAGAATGGCGAGCGCACCCC, SEQ ID NO.34;

[0077] PS13-R: GGATCCACTAGTATTTAAATGTCGACCTACTGGGGTATGATTTGGTTCATT G, SEQ ID NO. 35.

[0078] Example 6: Detection of anthocyanin content in transgenic Arabidopsis plants

[0079] 1. Identification and phenotypic observation of transgenic Arabidopsis plants

[0080] RNA was extracted from wild-type (WT), mutant (tt8), and transgenic Arabidopsis lines (35S::OE / tt8#4 and #7). cDNA was synthesized via reverse transcription and used as a template to amplify the honeysuckle anthocyanin synthesis gene using primers qF / qR, following the same method as in Example 3. Results are shown below. Figure 4 The band could not be amplified in either the wild-type or the mutant, but it could be amplified in the transgenic line, indicating that the honeysuckle anthocyanin synthesis gene was successfully transferred into the Arabidopsis mutant tt8. Furthermore, the seed coat color of the transgenic line and the wild-type Arabidopsis was consistently dark brown, while the seed coat of the mutant was light yellow. Figure 4 The result of B indicates that overexpression of the honeysuckle pigment synthesis gene in the mutant tt8 restored the color of the mutant seed coat, meaning that the honeysuckle pigment synthesis gene and Arabidopsis thaliana TT8 have the same function.

[0081] qF: ACTGCAAAGAAGCCAACAGC, SEQ ID NO.36;

[0082] qR: GGAGGAAAGGAAAAGGAGACAC, SEQ ID NO. 37.

[0083] 2. Effects of transgenic technology on other genes and anthocyanin content in the Arabidopsis thaliana anthocyanin biosynthesis pathway

[0084] The methods for detecting the expression levels of related genes in the Arabidopsis anthocyanin biosynthesis pathway were the same as in Example 3. The total anthocyanin content in the leaves of wild-type (WT), mutant (tt8), and transgenic Arabidopsis line (35S::OE / tt8) was determined using a full-wavelength microplate reader. Results are shown below. Figure 4 In the C-type, the anthocyanin content in the leaves of transgenic Arabidopsis thaliana was significantly higher than that in wild-type and mutant, and the difference was statistically significant.

[0085] Furthermore, compared with wild-type and mutant, the expression levels of key genes in the anthocyanin synthesis pathway, AtDFR, AtF3'H, AtF3H, and AtANS, were significantly upregulated in the leaves of the two transgenic Arabidopsis lines. Figure 4 (D). This indicates that overexpression of the honeysuckle anthocyanin synthesis gene can induce the expression of related genes in the Arabidopsis anthocyanin biosynthesis pathway and the synthesis of anthocyanins.

[0086] Example 7: Detection of anthocyanin content in transgenic tobacco plants

[0087] 1. Identification and phenotypic observation of transgenic tobacco plants

[0088] RNA was extracted from wild-type (WT) and transgenic tobacco lines (OE1, OE3, OE6), and cDNA was synthesized by reverse transcription. Using cDNA as a template, the honeysuckle anthocyanin synthesis gene was amplified using primers qF / qR, following the same method as in Example 3. The results are shown in [Figure 3]. Figure 5 In the wild type, the band could not be amplified, while in the transgenic lines, it could, indicating that the honeysuckle anthocyanin synthesis gene was successfully transferred into tobacco. Furthermore, compared to the wild type, the transgenic lines showed a significantly deeper color in their petals. Figure 5 (B).

[0089] 2. Effects of transgenic technology on other genes in the anthocyanin synthesis pathway and anthocyanin content.

[0090] The methods for detecting the expression levels of related genes in the tobacco anthocyanin biosynthesis pathway were the same as in Example 3. The total anthocyanin content in flowers of wild-type (WT) and transgenic tobacco lines (OE1, OE3, OE6) was determined using a full-wavelength microplate reader. Results are shown below. Figure 5 In the C-type, the anthocyanin content in transgenic tobacco flowers was significantly higher than that in wild-type, and the difference was statistically significant. Furthermore, compared to wild-type, the expression levels of key genes in the anthocyanin synthesis pathway, NtDFR, NtANS, NtCHI, and NtCHS, were significantly upregulated in the tobacco flowers of the three transgenic lines, and the expression level of the GST gene NtGSTF3, which is related to anthocyanin transport, was also significantly upregulated. This indicates that overexpression of Lonicera japonica anthocyanin synthesis genes can induce the expression of related genes in the tobacco anthocyanin biosynthesis pathway and anthocyanin synthesis.

[0091] Example 8: Identification of stress resistance in transgenic plants

[0092] 1. Observation of drought and salt stress treatments and phenotypic effects in transgenic Arabidopsis thaliana

[0093] Seeds of Arabidopsis thaliana plants from complementary lines (35::OE / tt8#4 and #7), mutant tt8, and wild-type WT were sterilized and placed at 4°C for 3 days. Seeds that underwent 3 days of vernalization were planted in soil (humus:vermiculite:perlite = 1:1:1) and subjected to drought and salt treatments after 4 weeks. During the drought treatment, plants were not watered for 7 days, and then leaves were collected from the same location and flash-frozen in liquid nitrogen. For the salt treatment, plants were irrigated with a 200 mM sodium chloride solution, and samples were taken 7 days after treatment, with irrigation with sodium chloride solution 2-3 times during this period. Each treatment was performed as an independent biological replicate in triplicate.

[0094] See results Figure 6 A and Figure 7 The A mutant tt8 showed a more sensitive phenotype to both drought and salt stress than the wild type, while the complementary transgenic lines grew better than the wild type.

[0095] 2. Histochemical staining and physiological index determination

[0096] For DAB staining, mature leaves of Arabidopsis plants were completely immersed in a 0.1 mg / mL DAB solution dissolved in PBS buffer (pH 7.4) and placed in the dark at room temperature for 24 hours. The leaves were then boiled in 95% ethanol solution for 15 minutes to remove chlorophyll until the leaves turned white or pale yellow. The ethanol was replaced until the leaves were completely destained for subsequent observation. When performing NBT staining, mature leaves of Arabidopsis plants were immersed in NBT dye (50 mg NBT was dissolved in 100 mL of the above PBS buffer, and then 0.05% Tween-20 was added). After being placed in a dark environment at room temperature for 24 hours, the staining was removed using the same method as above, so that subsequent observation and photography could be carried out (Reference: Wang K, Zhong M, Wu YH, Bai ZY, Liang QY, Liu QL, Pan YZ, Zhang L, Jiang BB, Jia Y, et al. Overexpression of chrysanthemum transcription factor gene DgNAC1 improves the salinitytolerance in chrysanthemum. Plant Cell Rep. 2017:36(4):571-581). The malondialdehyde (MDA) content, proline content, peroxidase (POD) activity, catalase (CAT) activity, total superoxide dismutase (SOD) activity, and soluble sugar content were determined according to the operating procedures of the Solarbio Physiological Indicator Detection Kit (Beijing Solarbio Technology Co., Ltd.).

[0097] See results Figure 6 B and Figure 7 Under B, drought and salt stress, compared with wild-type plants, transgenic plants produced fewer brown or blue products of oxidative damage, while mutants produced more brown or blue products of oxidative damage. Regarding H2O2 and O2... 2- Quantitative analysis of the content also showed similar results. Figure 6 G and H; Figure 7 (G and H). Furthermore, the malondialdehyde (MDA) content in transgenic plants was lower than that in wild-type plants, while the MDA content in mutants was higher than that in wild-type plants. Figure 6 F and Figure 7The total superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) activities of transgenic plants were higher than those of wild-type plants, while the total superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) activities of mutants were lower than those of wild-type plants. Figure 6 C, D, E and Figure 7 (C, D, E). These results indicate that under drought and salt stress conditions, transgenic plants accumulate less reactive oxygen species (ROS) than wild-type plants and mutants, suggesting that overexpression of the honeysuckle anthocyanin synthesis gene can improve the drought and salt tolerance of Arabidopsis thaliana.

[0098] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A gene for synthesizing honeysuckle anthocyanins, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

6.

2. A protein encoded by the honeysuckle anthocyanin synthesis gene as described in claim 1, characterized in that, Its amino acid sequence is shown in SEQ ID NO.

7.

3. A recombinant vector, characterized in that, The recombinant vector contains the honeysuckle pigment synthesis gene as described in claim 1.

4. A recombinant microorganism, characterized in that, The recombinant microorganism contains the honeysuckle anthocyanin synthesis gene as described in claim 1 or the recombinant vector as described in claim 3.

5. The application of the honeysuckle anthocyanin synthesis gene of claim 1, the protein of claim 2, the recombinant vector of claim 3, or the recombinant microorganism of claim 4 in regulating the anthocyanin content of plants.

6. The application of the honeysuckle anthocyanin synthesis gene of claim 1, the protein of claim 2, the recombinant vector of claim 3, or the recombinant microorganism of claim 4 in regulating plant stress resistance, characterized in that, The stress resistance includes drought resistance and salt resistance.

7. The application according to claim 5 or 6, characterized in that, The plants mentioned include honeysuckle, Arabidopsis thaliana, and tobacco.

8. A method for regulating the anthocyanin content of plants, characterized in that, This includes the steps of using genetic transformation technology to transfer the honeysuckle anthocyanin synthesis gene into the plant, stably overexpressing it, and increasing the anthocyanin content in the plant. The nucleotide sequence of the honeysuckle anthocyanin synthesis gene is shown in SEQ ID NO.

6.

9. A method for regulating plant stress resistance, characterized in that, This includes using genetic transformation technology to transfer the honeysuckle anthocyanin synthesis gene into the plant and stably overexpress it, thereby improving the plant's drought and salt tolerance. The nucleotide sequence of the honeysuckle anthocyanin synthesis gene is shown in SEQ ID NO.

6.

10. The method according to claim 8 or 9, characterized in that, The plants mentioned include honeysuckle, Arabidopsis thaliana, and tobacco.

Citation Information

Patent Citations

  • Application of AcMYB123 and AcbHLH42 genes in regulating anthocyanin biosynthesis in kiwi pulp

    CN109679966A

  • Application of PsERF1B (Prunus salicina PsERF1B) protein and coding gene thereof in regulation and control of plant anthocyanin synthesis

    CN116410283A

  • Lonicera japonica LjAN2 gene as well as encoding protein, recombinant vector and application thereof

    CN117230080A

  • Compositions and methods for increasing plant seed number and / or yield

    WO2014150879A1