Fusarium graminearum pathogenicity inhibition method based on carbon metabolism regulation and application of fusarium graminearum pathogenicity inhibition method

By inhibiting the nucleoplasmic transport of CreA and suppressing the carbon decomposition metabolic pathway of Fusarium graminearum, and by using Pseudomonas sp. CXZ8 to inhibit Fco1 gene expression, the problem of easy interference with traditional biocontrol bacteria was solved, and highly efficient inhibition of Fusarium graminearum infection was achieved.

CN120888690APending Publication Date: 2025-11-04NORTHWEST A & F UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511090767.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-05
Publication Date
2025-11-04

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively inhibit the infection process of Fusarium graminearum. Traditional biocontrol bacteria are easily disturbed by complex microbial communities in the field and lack high efficiency and specificity.

Method used

By inhibiting the nucleoplasmic transport process of CreA, the carbon decomposition metabolic pathway of Fusarium graminearum is disrupted, and the expression of the fucosidase gene Fco1 is suppressed by Pseudomonas sp. CXZ8, thereby weakening the pathogen's ability to acquire nutrients.

Benefits of technology

It significantly reduces the ability of pathogens to degrade substances such as polysaccharides on plant surfaces, effectively inhibits the infection process of pathogens, and improves the targeting and efficiency of biological control.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120888690A_ABST
    Figure CN120888690A_ABST
Patent Text Reader

Abstract

The invention discloses a fusarium graminearum pathogenicity inhibition method based on carbon metabolism regulation and application of the fusarium graminearum pathogenicity inhibition method, and belongs to the field of agricultural disease control. The invention finds that the strain Pseudomonas sp.CXZ8 can influence the infection adaptability of fusarium graminearum through a targeted carbon catabolism repression pathway, that is, the strain Pseudomonas sp.CXZ8 can inhibit the expression of a fucosidase gene Fco1, interfere the nutrition utilization of pathogenic bacteria and prevent the pathogenic bacteria from infecting crops. Field and greenhouse inoculation tests prove that the disease index of the wheat scab can be remarkably reduced by spraying a fungicide prepared from the strain. Compared with traditional biological prevention and control, the invention provides a biological prevention and control strategy with carbon metabolism regulation as a target spot. The strategy provides possibility for accurately intervening the environmental adaptability of pathogenic bacteria and realizing prevention and control from the source, and also provides theoretical basis and technical support for green prevention and control work of wheat scab.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of agricultural disease prevention and treatment, and relates to a Fusarium graminearum pathogenicity inhibition method based on carbon metabolism regulation and application thereof. BACKGROUND

[0002] Wheat scab (Fusarium head blight) is a global disease caused by pathogenic fungi such as Fusarium graminearum. Wheat scab not only causes food yield reduction, but also accumulates a large amount of toxins such as deoxynivalenol (DON) and zearalenone (ZEA) in diseased ears. These mycotoxins can pose a serious threat to human and animal health by inhibiting eukaryotic ribosome function and mimicking endogenous estrogen, and further cause serious food safety problems. In recent years, due to the lack of wheat varieties resistant to scab, the use of chemical agents such as carbendazim and tebuconazole is still the main means for preventing and controlling wheat scab. Therefore, it is urgent to explore new prevention and control ideas.

[0003] Traditional biocontrol bacteria (such as Bacillus subtilis) mainly inhibit fungal growth by secreting metabolites, and are easily disturbed by complex microbial communities in the field, lacking efficiency and specificity in practical application. Therefore, developing precise intervention strategies based on key target points of beneficial bacteria-pathogen interaction is an important direction to break through the existing biocontrol bottlenecks.

[0004] Carbon catabolite repression (CCR) is a regulatory mechanism widely existing in microorganisms, plant pathogenic fungi and other organisms, and is also a core regulatory mechanism for Fusarium graminearum to adapt to different environments. In an environment rich in carbon sources, this pathway inhibits the metabolism of non-preferred carbon sources by specifically regulating target genes, and promotes Fusarium graminearum to preferentially use carbon sources with the highest energy acquisition rate. When entering the infection stage, the repressor factor CreA in this pathway is transferred from the nucleus to the output, releasing the expression of genes including plant cell wall degrading enzymes, and starting the alternative carbon source metabolic pathway to help successful infection of the host. Although the CCR mechanism has been deeply studied in Saccharomyces cerevisiae, research on whether CCR can be used for field disease control is still blank. In-depth analysis of the regulatory mechanism of the carbon repression pathway in the transition from the vegetative growth of Fusarium graminearum to the infection growth, identification of the key genes of the alternative carbon source metabolic pathway regulated thereby, and development of an effective strategy for inhibiting pathogen infection based thereon will provide a new idea for solving the problem of wheat scab prevention and control. SUMMARY

[0005] In view of the above problems and defects, the present application provides a fusarium graminearum pathogenicity inhibition method based on carbon metabolism regulation and application thereof, which inhibits the nucleocytoplasmic transport process of CreA, destroys the normal regulation of carbon catabolic pathway, inhibits the activation of fungal alternative carbon source metabolic pathway, significantly reduces the degradation ability of pathogenic fungi to plant surface polysaccharides and other substances, and weakens the nutrition acquisition ability, thereby effectively inhibiting the infection process of pathogenic fungi.

[0006] In the first aspect, the present application provides a fusarium graminearum pathogenicity inhibition method based on carbon metabolism regulation, which targets the carbon catabolic pathway of fusarium graminearum, interferes with the utilization ability of fusarium graminearum to carbon source during the process of infecting host plants, and reduces the pathogenicity of fusarium graminearum.

[0007] Further, in the fusarium graminearum pathogenicity inhibition method based on carbon metabolism regulation provided by the present application, the repressor in the carbon catabolic pathway is protein CreA.

[0008] The protein CreA is encoded by the nucleotide sequence shown in SEQ ID NO: 1 and has the amino acid sequence shown in SEQ ID NO: 2.

[0009] Further, in the fusarium graminearum pathogenicity inhibition method based on carbon metabolism regulation provided by the present application, the protein CreA can bind to the promoter sequence of fucosidase gene Fco1 in fusarium graminearum, thereby reducing the pathogenicity of fusarium graminearum.

[0010] Further, in the fusarium graminearum pathogenicity inhibition method based on carbon metabolism regulation provided by the present application, the expression of fucosidase gene Fco1 in fusarium graminearum is inhibited, thereby reducing the pathogenicity of fusarium graminearum.

[0011] Further, in the fusarium graminearum pathogenicity inhibition method based on carbon metabolism regulation provided by the present application, the fucosidase gene Fco1 in fusarium graminearum is knocked out, thereby reducing the pathogenicity of fusarium graminearum.

[0012] Further, in the fusarium graminearum pathogenicity inhibition method based on carbon metabolism regulation provided by the present application, the primer sequence for knocking out the fucosidase gene Fco1 in fusarium graminearum is as follows:

[0013] FCO1-1F: GGAGTTGAGATCCAGGATAGG,

[0014] FCO1-2R: TTGACCTCCACTAGCTCCAGCCAAGCCGAGATTTACTTGAGGGTGAAAAA;

[0015] FCO1-3F: CGTCCGCAATGTGTTATTAAGTCGACCTCAGATAATACACCCACCACG,

[0016] FCO1-4R: GCCCAGACTTTAGACGACAAG.

[0017] Further, the application provides a method for inhibiting the pathogenicity of Fusarium graminearum based on carbon metabolism regulation, wherein the expression of a fucosidase gene Fco1 in the Fusarium graminearum is inhibited by using Pseudomonas sp. CXZ8.

[0018] In a second aspect, the application provides an application of the method for inhibiting the pathogenicity of Fusarium graminearum based on carbon metabolism regulation in biological control of wheat scab.

[0019] Further, in the application of the method for inhibiting the pathogenicity of Fusarium graminearum based on carbon metabolism regulation in biological control of wheat scab, the Pseudomonas sp. CXZ8 is prepared into a biocontrol agent and applied to the wheat ear at the flowering stage.

[0020] Further, in the application of the method for inhibiting the pathogenicity of Fusarium graminearum based on carbon metabolism regulation in biological control of wheat scab, the concentration of the biocontrol agent is 1x10 8 CFU / mL.

[0021] Compared with the prior art, the technical scheme provided by the application has at least the following beneficial effects or advantages:

[0022] (1) The application verifies the core role of CreA nucleocytoplasmic transport in the infection conversion of Fusarium graminearum, and by inhibiting the nucleocytoplasmic transport process of CreA, the normal regulation of the carbon decomposition and metabolism pathway is destroyed, the activation of the fungal alternative carbon source metabolism pathway is inhibited, the degradation ability of the pathogenic fungus to plant surface polysaccharides and the like is significantly reduced, and the nutrition acquisition ability is weakened, thereby effectively inhibiting the infection process of the pathogenic fungus. The method described in the application is more targeted than the traditional broad-spectrum bacteriostatic strategy.

[0023] (2) The application uses Pseudomonas sp. CXZ8 to inhibit the expression of the Fco1 gene, which overcomes the defect that traditional biocontrol bacteria such as Bacillus subtilis are easily disturbed by microbial communities. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 It is a schematic diagram of the CreA inhibitor domain in the carbon metabolism repression pathway. C2H2 represents two C2H2 zinc finger DNA binding domains.

[0025] Figure 2 It is a cell localization diagram of the CreA inhibitor.

[0026] Figure 3 Figure 4 is a phylogenetic tree and a biocontrol effect verification diagram of Pseudomonas sp. CXZ8. Wherein a is a phylogenetic tree of Pseudomonas sp. CXZ8 based on 16S rRNA gene sequence; b is the result of field mixed inoculation.

[0027] Figure 4 Figure 5 is a cell localization diagram of CreA inhibitor in wheat ear crude extract.

[0028] Figure 5 Figure 6 is the expression regulation of Pseudomonas sp. CXZ8 on Fusarium graminearum genes. Wherein a is the number of differentially expressed genes of Fusarium graminearum; b is the proportion of the top 100 genes containing CreA gene binding sites before down-regulation of Fusarium graminearum genes.

[0029] Figure 6 Figure 7 is a result diagram of electrophoretic mobility shift analysis verification of CreA inhibitor and downstream gene FCO1 promoter sequence. Wherein + indicates adding the component; - indicates not adding the component.

[0030] Figure 7 Figure 8 is a DNA detection diagram and pathogenicity detection of Fusarium graminearum mutant strain with FCO1 gene knocked out. Wherein a is a DNA detection diagram; b is the pathogenicity of Fusarium graminearum mutant strain with FCO1 gene knocked out; fco1-1 and fco1-2 are Fusarium graminearum mutant strains with FCO1 gene knocked out, M is Marker; FCO1-5F / 6R, FCO1-7F / H856R, H855F / FCO1-8R, H850 / H852 respectively indicate DNA detection results of different primer sequences; PH-1 indicates inoculation of wild type Fusarium graminearum strain, and fco1 indicates inoculation of Fusarium graminearum mutant strain with FCO1 gene knocked out.

[0031] Figure 8 Figure 9 is the prevention and control effect of Pseudomonas sp. CXZ8 on wheat scab under greenhouse conditions. Wherein a is a real picture of wheat infected by scab; b is a statistical result diagram of pathogenicity; PH-1 indicates spraying Fusarium graminearum agent, and PH-1+CXZ8 indicates spraying mixture of Fusarium graminearum agent and Pseudomonas sp. CXZ8 agent.

[0032] Figure 9 Figure 10 is a Fusarium graminearum pathogenicity model regulated by Pseudomonas sp. CXZ8 based on carbon metabolism. DETAILED DESCRIPTION

[0033] The technical solutions of the present application are described below in combination with examples, but the present application is not limited to the following examples. The experimental methods and detection methods described in each example are all conventional methods unless otherwise specified; the reagents and materials described are all commercially available unless otherwise specified.

[0034] Example 1

[0035] This example provides localization analysis of F. graminearum repressor CreA in preferred or non-preferred carbon sources.

[0036] 1. Fusion of GFP with the N-terminal of CreA

[0037] A target fragment was obtained by PCR amplification using pKNTG plasmid as a vector, and then a GFP-CreA fusion expression vector was constructed by restriction enzyme digestion and ligation reaction. The recombinant plasmid was introduced into F. graminearum by protoplast-PEG transformation method. The transformants were picked to PDA medium and the transformant DNA was extracted, and PCR amplification detection was performed using pKNT-seqF and pKNT-seqR primers. If positive, it indicates that the transformant successfully fused GFP (green fluorescent protein) with the N-terminal of CreA, and the transformed bacteria were obtained. Figure 1 Figure 1 is a schematic diagram of the CreA repressor domain in the carbon metabolic repression pathway.

[0038] The protein CreA is encoded by the nucleotide sequence shown in SEQ ID NO: 1, and has an amino acid sequence as shown in SEQ ID NO: 2.

[0039]

[0040] The amino acid sequence is (SEQ ID NO: 2): MQRAQSAVDFSNLLNPTAPAEKEI EKPQQGDVEMATAAVTVIKPNGPLPGGQSSENSNELPRPYKCPLCDKAFHRLEHQTRHIRTHTGEKPHACQFPGCSKKFSRSDELTRHSRIHNNPNSRRGNKAAQAHQQQQHQMHQQGIPHHMLPDGMMAPPPAPKTIRSAPGSALASPNVSPPHSYSTFALPTSAVHYNRGGDISMLAKAATQVERETLTAPPHHHNNNRHHPYFGHGMHSSRGHLPTLSSYHMARSHSGDDDDHYSGSLRHAKRSRPNSPNSTAPSSPTFSHDSLSPTPDHTPIATPAHSPRLRPFSGYELPSLRNLSLQHNTTPALAPMEPHLEQSQFQQGAAPTAQPRPNGISLTDIISRPDGSQRKLPVPQVPKVAVQDLLSDNGFSHSGRSSGTSSLAGGDLMDRM.

[0041] 2. Detection of CreA localization under different carbon source environments

[0042] The transformed bacteria were inoculated in CMC (carbon source deficient) liquid medium, and spores were collected after 5 days and cultured in YEPD medium for 12 h to induce spore germination. The germinated mycelium was collected by filtration, washed with double distilled water to remove residual culture medium and other impurities. The mycelium was placed in an environment containing 4% glucose or without glucose, and after 30 min, the GFP signal was observed using a fluorescence microscope. The results are shown in Figure 2 As shown in the figure, in the 4% glucose environment, the CreA inhibitor is localized in the nucleus, coinciding with the DAPI nuclear marker; while in the glucose-deficient environment, the CreA inhibitor is transferred from the nucleus to the cytoplasm, producing a nuclear export phenomenon.

[0043] Table 1 Primers for constructing the CreA vector and specific primers for the FCO1 gene

[0044]

[0045] Example 2

[0046] This example provides the effect of field-isolated beneficial bacteria on the incidence of Fusarium graminearum.

[0047] 1. Collection, isolation and storage of beneficial endophytic bacteria

[0048] Wheat spikes were collected from the field and surface sterilized with sterile water and 75% ethanol (30s ethanol treatment + 3 times sterile water rinse) in sequence. The spikes were cut into 0.5cm x 0.5cm tissue blocks and immersed in sterile physiological saline, and then extracted at 25℃ with shaking at 150rpm for 12h. The extraction liquid was gradient diluted and spread on R2A agar medium, and then incubated at 25℃ for 1-2 days. Single colonies were picked and inoculated into LB liquid medium, and then incubated at 25℃ with shaking at 180rpm overnight to obtain the biocontrol bacteria. The biocontrol bacteria were added into 20% glycerol to a final concentration, and then stored at -80℃.

[0049] 2. Screening of pathogenic strain of Fusarium graminearum

[0050] Fusarium graminearum wild type strain PH-1 was inoculated into CMC medium and shaken at 25℃ and 175rpm for 5d. After filtration, the spores were suspended in sterile water, and then adjusted to 2x10 6 CFU / mL with a hemocytometer. At the same time, the biocontrol bacteria stored at -80℃ were activated, and then streaked on LB plates and incubated at 25℃ for 2d. Single colonies were picked and transferred to LB liquid medium, and then incubated at 25℃ with shaking at 175rpm for 12-16h to adjust the concentration to 2x10 8 CFU / mL to obtain the biocontrol bacteria suspension.

[0051] The biocontrol bacteria suspension was mixed with the spore solution of Fusarium graminearum wild type strain PH-1 at a volume ratio of 1:1 to obtain a mixed solution. The concentration of the biocontrol bacteria in the mixed solution was 1x10 8 CFU / mL, and the concentration of Fusarium graminearum wild type strain PH-1 was 1x10 6 During the flowering period of wheat, 10μL of the mixed solution was inoculated between the lemma and palea of the spikelet of the wheat spike, and then labeled and bagged for 24-36h. After 14 days, the candidate strain CXZ8 was screened according to the statistical incidence of disease. As shown in a of Figure 3 , the candidate strain CXZ8 belongs to the genus Pseudomonas, and is named Pseudomonas sp. CXZ8. b of Figure 3 indicates that Pseudomonas sp. CXZ8 significantly reduces the pathogenicity of Fusarium graminearum wild type strain PH-1. The preservation information of Pseudomonas sp. CXZ8 is shown in patent CN115232776A published on October 25, 2022.

[0052] Example 3

[0053] This example provides the effect of Pseudomonas sp. CXZ8 on the nuclear export of the Fusarium graminearum inhibitory factor CreA in a non-preferred carbon source environment.

[0054] 10 8Pseudomonas sp. CXZ8 was added to the YEPD germination hyphae of the transformed bacteria constructed in Example 1, and placed in a medium containing wheat ear crude extract to induce changes in CreA nuclear export. After 30 min, the CreA nuclear localization was observed and recorded using a fluorescence microscope. As shown in Figure 4 Figure 3, in a 4% glucose environment, the CreA inhibitor is stably located in the nucleus; in wheat ear crude extract, the CreA inhibitor produces nuclear export, and after mixing Pseudomonas sp. CXZ8 in the wheat ear crude extract, the nuclear export is slowed down.

[0055] Example 4

[0056] This example provides the expression of Pseudomonas sp. CXZ8 regulating the expression of Fusarium graminearum FSE genes.

[0057] Pseudomonas sp. CXZ8 was mixed with the wild-type strain of Fusarium graminearum PH-1 according to the method described in Example 2. After 3 days of infection, the wheat ear was collected and quickly frozen in liquid nitrogen, then transferred to a -80°C refrigerator for storage, and sent to a sequencing company for transcriptome sequencing of Fusarium graminearum. The transcriptome data obtained by sequencing by Beijing Novogene Biotechnology Co., Ltd. was spliced according to the genome of the wild-type strain of Fusarium graminearum PH-1, and the sequencing fragments were accurately assembled into complete transcript sequences. The edgeRun software package was used to identify differentially expressed genes, and the differentially expressed genes screened were subjected to GO (Gene ontology) functional annotation. As shown in Figure 5 Figure 4, Pseudomonas sp. CXZ8 caused 693 Fusarium graminearum genes to be down-regulated, and in addition, 90 of the top 100 down-regulated genes contained one or more CreA predicted binding sites.

[0058] Example 5

[0059] This example provides a method for EMSA to verify that the Fusarium graminearum inhibitor CreA binds to the promoter sequence of the fucosidase FCO1 gene.

[0060] The prokaryotic expression vector CreA-pcoldTF was constructed by enzyme digestion of pcoldTF vector and ligation of CreA gene, and the prokaryotic expression strain of CreA protein was obtained by transforming the prokaryotic expression vector CreA-pcoldTF into strain BL21. The seed liquid of the prokaryotic expression strain of CreA protein was inoculated into LB liquid medium at a concentration of 1% to the logarithmic growth phase, IPTG was added, and induction was performed at 16°C and 100 rpm for 16 h. The prokaryotic expression strain of CreA protein was washed with PBS and ultrasonically broken, and His-tag magnetic beads were used to purify the CreA protein. The purified CreA protein was divided and stored in a -80°C refrigerator. The FCO1 gene promoter sequence was amplified by PCR, and the amplified product was recovered to obtain a high-purity promoter sequence fragment.

[0061] The purified CreA protein was incubated with the FCO1 gene promoter sequence in vitro at 25°C for 30 min, and the empty protein and the CreA protein treated with proteinase K were set as controls. As shown in FIG. 1, the CreA inhibitor can specifically bind to the FCO1 gene promoter sequence, while the sample treated with proteinase K cannot bind, and the pColdTF empty protein cannot bind to the FCO1 gene. Figure 6

[0062] Example 6

[0063] This example provides a method for constructing a FCO1 gene knockout mutant by homologous recombination.

[0064] The knockout system with hygromycin (hph) was used for gene knockout, and primers FCO1-1F, FCO1-2R, FCO1-3F and FCO1-4R were designed to amplify the A and B fragments upstream and downstream of the FCO1 gene, and HYG-F and HT-R were used to amplify the full-length HPH fragment. Then, DNAPolymerase (Beijing Quanshi Gold Biotechnology Co., Ltd.) was used to connect the FSE1 upstream and downstream fragments and the HPH fragment into one fragment by in vitro PCR, and the primer sequences are shown in Table 1, and the PCR reaction system is shown in Table 2.

[0065] Table 2 PCR reaction system

[0066]

[0067] The PCR reaction program was as follows: 95°C pre-denaturation for 3 min, 95°C for 30 sec, 61°C for 4 min, 72°C for 2 min, 15 cycles, 72°C for 10 min, 95°C for 3 min, 95°C for 30 sec, 58°C for 40 sec, 72°C for 4 min, 35 cycles, 72°C for 10 min, and 16°C forever.

[0068] ​​The ligated fragment was transformed into wild type protoplasts of Fusarium graminearum in the same way as in Example 1 to obtain transformants, i.e. mutant strains of Fusarium graminearum with FCOl gene knocked out. The transformants were detected by using FCOl gene internal primers FCOl-5F and FCOl-6R, HPH internal primers H850 and H852, FCOl gene upstream primer FCOl-7F and HTK internal primer H856R, and HTK internal primer H855F and FCOl gene downstream primer FCOl-8R, respectively. The primer sequences are shown in Table 1. As shown in a of Table 1, the detection results of the four pairs of primers FCOl-5F / 6R, FCOl-7F / H856R, H855F / FCOl-8R and H850 / H852 were negative, positive, positive and positive, respectively, indicating that the transformants were positive transformants with FCOl successfully knocked out. Figure 7

[0069] Example 7

[0070] This example provides the pathogenicity of the mutant strain of Fusarium graminearum with FCOl gene knocked out.

[0071] In the same way as described in Example 2, the mutant strain of Fusarium graminearum with FCOl gene knocked out obtained in Example 6 was inoculated on wheat spikes at the flowering stage, and the number of diseased grains was observed and counted 14 days after inoculation. As shown in b of Table 1, compared with the wild type strain PH-1 of Fusarium graminearum, the pathogenicity of the mutant strain of Fusarium graminearum with FCOl gene knocked out was significantly reduced (p<0.05). Figure 7

[0072] Example 8

[0073] This example provides the preparation and application method of the biocontrol agent of Pseudomonas sp. CXZ8.

[0074] Pseudomonas sp. CXZ8 was cultured in LB liquid medium at 28°C with 180 rpm shaking for 12-16 h to prepare seed liquid. The seed liquid was inoculated in LB medium at an inoculation amount of 1%, and cultured at 28°C with 180 rpm shaking for 2-4 h to obtain the biocontrol agent with a concentration of 1 x 10 8 CFU / mL. The above biocontrol agent was uniformly sprayed on wheat spikes at the flowering stage, and the whole plant was bagged and kept moist for 48 h. In the same way as described in Example 2, the spore liquid of the wild type strain PH-1 of Fusarium graminearum with a concentration of 2 x 10 5 CFU / mL was prepared. 10 μL of the spore liquid was inoculated on the pretreated wheat spikes and marked. The whole plant was bagged and kept moist for 24-36 h, and the number of diseased grains was counted 14 days later. As shown in b of Table 1, compared with the wild type strain PH-1 of Fusarium graminearum, the pathogenicity of the mutant strain of Fusarium graminearum with FCOl gene knocked out was significantly reduced (p<0.05). Figure 8 ​​Compared with the wheat ear without spraying the biocontrol agent, the disease was significantly weakened after spraying the biocontrol agent (p<0.05). The results show that the biocontrol agent prepared by pre-application of Pseudomonas sp. CXZ8 has a good control effect on wheat scab. Figure 9 Based on the carbon metabolism regulation mode of Pseudomonas sp. CXZ8 to Fusarium graminearum, Pseudomonas sp. CXZ8 can inhibit the nucleocytoplasmic transport process of CreA, destroy the normal regulation of carbon catabolism pathway, inhibit the activation of fungal alternative carbon source metabolic pathway, significantly reduce the degradation ability of pathogenic fungi to plant surface polysaccharides and other substances, and weaken the nutrition acquisition ability, so as to effectively inhibit the invasion process of pathogenic fungi.

[0075] The above-described embodiments are part of the embodiments of the present application, rather than all the embodiments. The detailed description of the embodiments of the present application is not intended to limit the scope of the claimed application, but only represents selected embodiments of the application. All other embodiments obtained by related deduction and replacement of those skilled in the art under the condition of the concept of the present application, without making creative efforts, belong to the scope of protection of the present application.

Claims

1. A method for inhibiting the pathogenicity of Fusarium graminearum based on carbon metabolism regulation, characterized in that, By targeting the carbon decomposition and metabolism pathway of Fusarium graminearum, the pathogenicity of Fusarium graminearum is reduced by interfering with its ability to utilize carbon sources during infection of host plants.

2. The method for inhibiting the pathogenicity of Fusarium graminearum based on carbon metabolism regulation according to claim 1, characterized in that, The repressor in the carbon catabolism pathway is protein CreA; The protein CreA is encoded by the nucleotide sequence shown in SEQ ID NO:1 and has the amino acid sequence shown in SEQ ID NO:

2.

3. The method for inhibiting the pathogenicity of Fusarium graminearum based on carbon metabolism regulation according to claim 2, characterized in that, The protein CreA binds to the promoter sequence of the fucosidase gene Fco1 in Fusarium graminearum, reducing the pathogenicity of Fusarium graminearum.

4. The method for inhibiting the pathogenicity of Fusarium graminearum based on carbon metabolism regulation according to claim 3, characterized in that, Inhibiting the expression of the fucosidase gene Fco1 in Fusarium graminearum reduces the pathogenicity of Fusarium graminearum.

5. The method for inhibiting the pathogenicity of Fusarium graminearum based on carbon metabolism regulation according to claim 4, characterized in that, Knocking out the fucosidase gene Fco1 in Fusarium graminearum reduces the pathogenicity of Fusarium graminearum.

6. The method for inhibiting the pathogenicity of Fusarium graminearum based on carbon metabolism regulation according to claim 5, characterized in that, The primer sequence for knocking out the fucosidase gene Fco1 in Fusarium graminearum is as follows: FCO1-1F:GGAGTTGAGATCCAGGATAGG, FCO1-2R: TTGACCTCCACTAGCTCCAGCCAAGCCGAGATTTACTTGA GGGTGAAAAAA; FCO1-3F: CGTCCGCAATGTGTTATTAAGTCGACCTCAGATAATACACC CACCACG, FCO1-4R:GCCCAGACTTTAGACGACAAG.

7. The method for inhibiting the pathogenicity of Fusarium graminearum based on carbon metabolism regulation according to claim 4, characterized in that, The expression of the fucosidase gene Fco1 in Fusarium graminearum was inhibited using Pseudomonas sp. CXZ8.

8. The application of the carbon metabolism-based method for inhibiting the pathogenicity of Fusarium graminearum according to any one of claims 1 to 7 in the biological control of wheat scab.

9. The application according to claim 8, characterized in that, Pseudomonas sp. CXZ8 was formulated into a biocontrol agent and applied to wheat ears during the flowering stage.

10. The application according to claim 9, characterized in that, The effective concentration range of the biocontrol agent is 1×10⁻⁶. 7 ~1×10 8 CFU / mL.