Process for producing mycoprotein feed through multi-strain synergistic fermentation and steam explosion of corn straw

Abstract

The invention belongs to the technical field of biology, and particularly relates to a technology for producing a mycoprotein feed through multi-strain synergistic fermentation and steam explosion of corn straw. According to the method, aspergillus niger GRJC003 with the preservation number of CCTCC NO: M 2025084 and trichoderma reesei are mixed and fermented, and in combination with optimized conditions such as steam explosion pretreatment and addition of pH response type sophorolipid sustained-release particles, a remarkable effect is achieved in preparation of the mycoprotein feed from the steam-exploded corn straw. According to the process, cellulose is thoroughly hydrolyzed and the tolerance to an inhibitor is enhanced by virtue of a unique enzyme complementation, metabolism reciprocity and microenvironment regulation and control synergistic mechanism of the double strains, so that the yield of mycoprotein is increased, meanwhile, efficient utilization of carbon and nitrogen resources and stable control of the process are realized, and the process has outstanding industrial application value and sustainability.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and particularly relates to a process for producing SCP (single cell protein) feed by multi-strain synergistic fermentation of steam-exploded corn stalks. BACKGROUND

[0002] With the continuous growth of global demand for protein and the rapid development of animal husbandry, the development of new sustainable protein feed resources has become a research hotspot. Corn stalks are rich in carbohydrates such as cellulose and hemicellulose, and are an ideal and inexpensive substrate for producing SCP (single cell protein). However, the complex lignocellulose structure of corn stalks makes it difficult for microorganisms to directly and effectively degrade and utilize it, and it usually needs to be pretreated. Steam explosion, as an efficient physical and chemical pretreatment method, can effectively destroy the structure of corn stalks, but it will still produce some phenolic compounds that inhibit microbial growth. In the fermentation stage, the key to resource utilization is to use fungi to convert pretreated corn stalks into SCP. Aspergillus niger and Trichoderma reesei are classic strains for producing cellulase and are often used to degrade cellulose. However, traditional single-strain fermentation has problems such as incomplete enzyme system, incomplete substrate conversion, and low product yield. While the conventional mixed fermentation strategy often has poor results due to competition between strains or lack of effective synergy, and even results in lower yield than single-strain fermentation, making it difficult to achieve the efficiency and economy required for industrial application. Therefore, screening for strain combinations with specific synergistic functions and developing innovative processes that can strengthen their synergistic effects, alleviate the effects of inhibitors, and simultaneously optimize the enzyme hydrolysis and fermentation processes are key to breaking through the technical bottlenecks of high-value utilization of corn stalks. SUMMARY

[0003] In view of the deficiencies in the prior art, the application provides a process for producing SCP (single cell protein) feed by multi-strain synergistic fermentation of steam-exploded corn stalks.

[0004] A process for producing SCP (single cell protein) feed by multi-strain synergistic fermentation of steam-exploded corn stalks, comprising the following steps: (1) 2400-2600 parts of corn stalks with a moisture content of 25-35 wt% are crushed to a particle size of 0.1-0.5 cm, then mixed and stirred with 2-4 parts of SiO2@QPEG for 1-2 h, and then steam-exploded at 180-200℃ and 2-3 Mpa for 4-6 min, and the SiO2@QPEG is recovered by an HGMS magnetic separator to obtain steam-exploded stalks and recovered SiO2@QPEG; (2) adjusting the carbon-nitrogen ratio of the steam-exploded straw obtained in step (1) to 25: (1-2) with urea, then adding potassium dihydrogen phosphate and magnesium sulfate, sterilizing at 120-122℃ for 19-21 min, and finally adding pH-responsive sophorolipid slow-release particles to obtain a fermentation medium, inoculating the fermentation bacteria in the fermentation medium, and carrying out aerobic fermentation at 25-35℃ and a pH of 4.8-5.2 for 36-72 h, and after the fermentation is completed, drying to obtain the bacterial protein feed.

[0005] The product SiO2@QPEG in step (1) can be recycled by soaking in 0.08-0.12 mol / L ascorbic acid for 20-40 min, filtering, washing, and vacuum drying for reduction to realize reuse.

[0006] The concentration of the potassium dihydrogen phosphate in step (2) is 0.08-0.12 wt% of the steam-exploded straw, and the concentration of the magnesium sulfate is 0.03-0.07 wt% of the steam-exploded straw.

[0007] The fermentation bacteria in step (2) are obtained by mixing Aspergillus niger GRJC003 and Trichoderma reesei bacteria, the inoculation amount of Aspergillus niger GRJC003 is 0.4×10 7 -0.6×10 7 spores / g of the fermentation medium, and the inoculation amount of Trichoderma reesei bacteria is 0.4×10 7 -0.6×10 7 spores / g of the fermentation medium.

[0008] The pH of 4.8-5.2 in step (2) is adjusted by 1-2 mol / L sulfuric acid.

[0009] The preparation method of SiO2@QPEG in step (1) comprises the following steps: S1: 4-6 parts of quercetin and 7-8 parts of carboxyl-polyethylene glycol-carboxyl are dissolved in 100-200 parts of N,N-dimethylformamide, 0.1-0.3 parts of 4-dimethylaminopyridine and 2-4 parts of dicyclohexyl carbodiimide are added, and stirring is carried out at 24-26℃ under nitrogen protection for 22-26 h to obtain a reaction solution; then the reaction solution is dropped into 400-500 parts of ice ether for precipitation, centrifuged at 6000-8000 rpm for 9-11 min, the precipitate is washed with ether for 2-3 times, and vacuum dried at 30-40℃ for 24-48 h to obtain QPEG-COOH; S2 by mass parts, 5-6 parts of iron trichloride hexahydrate, 1-3 parts of dichloride iron tetrahydrate is dissolved in 90-100 parts of water, under nitrogen protection, 18-22 mL of ammonia water with a concentration of 26-30 wt% is added dropwise, stirring at 78-82℃ for 1-2h, magnetic separation and washing to neutral, to get magnetite; the above-mentioned magnetite is dispersed in 180-200 parts of ethanol aqueous solution, 1-2 parts of ammonia water with a concentration of 26-30 wt% and 2-3 parts of tetraethoxysilane are added, stirring at 24-26℃ for 5-7h, centrifugal separation and washing the precipitate 1-2 times, to get magnetic silica particles; S3 by mass parts, the magnetic silica particles obtained in step S2 are dispersed in 90-100 parts of toluene, and 1-2 parts of γ-aminopropyl triethoxysilane is added, refluxing at 78-82℃ for 10-14h, centrifugal separation and washing, to get aminated magnetic silica particles; S4 by mass parts, 1-2 parts of QPEG-COOH obtained in step S1 is dissolved in 50 parts of MES buffer, 0.1-0.2 parts of 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride and 0.07-0.08 parts of N-hydroxysuccinimide are added, stirring at 24-26℃ for 30-40min, then 1-2 parts of aminated magnetic silica particles obtained in step S3 is added, adjusting pH to 7-8 with HEPES buffer, stirring at 38-42℃ for 12-14h, separating with magnetic field, washing and drying, to get SiO2@QPEG.

[0010] The volume ratio of ethanol and water in the ethanol aqueous solution in step S2 is 4: (1-2).

[0011] The concentration of 2-N-morpholinoethanesulfonic acid in the MES buffer in step S4 is 0.1-0.2 mol / L.

[0012] The concentration of 4-hydroxyethylpiperazine ethanesulfonic acid in the HEPES buffer in step S4 is 0.1-0.2 mol / L.

[0013] The adding amount of the pH-responsive sophorolipid slow-release particles in step (2) is 0.5-1 wt% of the mass of the steam-exploded straw.

[0014] The preparation method of the pH-responsive sophorolipid slow-release particles in step (2) comprises the following steps: N1 by mass parts, 2-3 parts of sodium alginate is dissolved in 90-100 parts of water, stirring until completely dissolved, to get a sodium alginate aqueous solution; N2 by mass parts, 0.1-0.2 parts of sophorolipid is added to the sodium alginate aqueous solution obtained in step S1, stirring uniformly, to get a sophorolipid-sodium alginate aqueous solution; N3: 40-60 parts by mass of corn oil and 0.3-0.8 parts by mass of Span 80 were mixed to obtain an emulsion; the sophorolipid-sodium alginate aqueous solution obtained in step N2 and the emulsion were mixed and homogenized at a speed of 10,000-15,000 rpm for 5-10 min to obtain a sophorolipid-sodium alginate emulsion; N4: the sophorolipid-sodium alginate emulsion obtained in step N3 was added dropwise into a calcium chloride aqueous solution with a concentration of 1.8-2.2 wt% at a rate of 1-2 ml / min, and was allowed to stand for 30-40 min, and then was filtered, washed and dried to obtain the pH-responsive sophorolipid slow-release particles.

[0015] Advantages of the present application: The present application adopts Aspergillus niger GRJC003 with a preservation number of CCTCC NO: M 2025084 and Trichoderma reesei for mixed fermentation, combines with steam explosion pretreatment and addition of pH-responsive sophorolipid slow-release particles and other optimized conditions, and achieves remarkable results in the preparation of bacterial protein feed from steam-exploded corn straw. The process, through the enzyme complementation, metabolic mutualism and microenvironment regulation synergistic mechanism of the two strains, completely hydrolyzes cellulose and enhances the tolerance to inhibitors, so that the bacterial protein yield is as high as 432.6 g / kg, which is more than 100% higher than that of conventional mixed fermentation, and realizes efficient utilization of carbon and nitrogen resources and stable process control, and has outstanding industrial application value and sustainability. DETAILED DESCRIPTION

[0016] Quercetin, CAS No.: 117-39-5.

[0017] Carboxy-polyethylene glycol-carboxy, Catalog No.: YS-P6623, polyethylene glycol molecular weight 2000, Chongqing Yusi Biotechnology Co., Ltd.

[0018] 2-N-morpholinoethanesulfonic acid, CAS No.: 145224-94-8.

[0019] 4-hydroxyethylpiperazine ethanesulfonic acid, CAS No.: 7365-45-9.

[0020] Rutin, CAS No.: 153-18-4.

[0021] Dibutylhydroxytoluene, CAS No.: 128-37-0.

[0022] Sophorolipid, Catalog No.: HBWS-L429, Hubei Weideli Chemical Technology Co., Ltd.

[0023] Sodium alginate, Catalog No.: S11053, Shanghai Yuanye Biotechnology Co., Ltd.

[0024] Trichoderma reesei, preservation number: CGMCC 3.3711, purchased from China General Microbiological Culture Collection Center.

[0025] The embodiment of the present application provides an Aspergillus niger, named Aspergillus niger GRJC003, which has been preserved in China Center for Type Culture Collection on January 10, 2025, and the preservation number is CCTCC NO: M2025084, and the preservation address is Wuhan University, China.

[0026] Isolation and culture of Aspergillus niger GRJC003: the collected adult small-tail Han sheep rumen fluid is diluted at different gradients with 0.9wt% physiological saline, 10 -3 , 10 -4 , 10 -5 0.1mL of each dilution gradient is coated on PDA culture medium and placed in a 30℃ constant temperature box for culture for 3-5 days, and the colony appearance is observed. The isolated bacteria with the characteristics of Aspergillus culture are subcultured on fresh PDA culture medium to obtain pure isolated bacteria, the colony morphology is observed, and the suspected strain is picked and purified for multiple times until a pure strain is obtained. According to the result of gene sequencing, NCBI database is used for comparison.

[0027] Culture condition: the culture medium is PDA culture medium (3g / L potato powder, 20g / L glucose, 20g / L agar), the pH of the culture medium is 6.06, the culture temperature is 30℃, and the culture time is 3 days.

[0028] Identification: the pure strain is sent to GenScript Biotech (Shanghai) Co., Ltd. for gene identification, and the gene sequence of Aspergillus niger GRJC003 is as follows: CCTGCGGAAGGATCATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCATCCGTGTCTATTATACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTTTGCCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACACGAACACTGTCTGAAAGCGTGCAGTCTGAGTTGATTGAATGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATC.

[0029] Example 1

[0030] A process for producing a cell protein feedstuff by multi-strain synergistic fermentation of steam-exploded corn stalks, comprising the following steps: (1) 2500 parts of corn stalks with a moisture content of 30 wt% are ground to a particle size of 0.5 cm, then mixed and stirred with 3 parts of SiO2@QPEG for 1 h, and then steam-exploded at 190°C and 2.5 MPa for 5 min, and SiO2@QPEG is recovered by an HGMS magnetic separator, to obtain steam-exploded stalks and recovered SiO2@QPEG; (2) The carbon-nitrogen ratio of the steam-exploded stalks obtained in step (1) is adjusted to 25:1 using urea, then potassium dihydrogen phosphate and magnesium sulfate are added, and sterilized at 121°C for 20 min, and finally pH-responsive sophorolipid slow-release particles are added, to obtain a fermentation medium, and a fermentation bacterium is inoculated in the above fermentation medium, and aerobic fermentation is carried out at 30°C and 5.0 pH for 72 h, and after the fermentation is completed, drying is carried out, to obtain the cell protein feedstuff.

[0031] The product recovery SiO2@QPEG in step (1) can be reduced by soaking in 0.08-0.12 mol / L ascorbic acid for 20-40 min, filtering, washing, and vacuum drying, to realize recycling.

[0032] The concentration of potassium dihydrogen phosphate in step (2) is 0.1 wt% of the steam-exploded straw, and the concentration of magnesium sulfate is 0.05 wt% of the steam-exploded straw.

[0033] The fermentation bacteria in step (2) are obtained by mixing Aspergillus niger GRJC003 and Trichoderma reesei, the inoculation amount of Aspergillus niger GRJC003 is 0.5×10 7 spores / g of fermentation medium, and the inoculation amount of Trichoderma reesei is 0.5×10 7 spores / g of fermentation medium.

[0034] The 5.0 pH in step (2) is adjusted by 2 mol / L sulfuric acid.

[0035] The preparation method of SiO2@QPEG in step (1) comprises the following steps: S1, 5 parts of quercetin, 8 parts of carboxyl-polyethylene glycol-carboxyl are dissolved in 200 parts of N,N-dimethylformamide, 0.2 parts of 4-dimethylaminopyridine and 3 parts of dicyclohexyl carbodiimide are added, and the reaction is stirred at 25°C under nitrogen protection for 24h to obtain a reaction solution; then the reaction solution is dropped into 500 parts of ice ether for precipitation, centrifuged at 8000 rpm for 10 min, the precipitate is washed with ether for 3 times, and vacuum dried at 40°C for 24h to obtain QPEG-COOH; S2, 5.4 parts of iron trichloride hexahydrate and 2 parts of dichloride iron tetrahydrate are dissolved in 100 parts of water, 20 mL of ammonia water with a concentration of 28 wt% is added under nitrogen protection, and stirred at 80°C for 1h, then magnetically separated and washed with water until neutral to obtain magnetite; the above magnetite is dispersed in 200 parts of ethanol aqueous solution, 2 parts of ammonia water with a concentration of 28 wt% and 2.8 parts of tetraethoxysilane are added, and stirred at 25°C for 6h, then centrifuged and washed the precipitate with water for 2 times to obtain magnetic silica particles; S3, the magnetic silica particles obtained in step S2 are dispersed in 100 parts of toluene, and 1.5 parts of γ-aminopropyl triethoxysilane is added, and refluxed at 80°C for 12h, then centrifuged, washed and dried to obtain aminated magnetic silica particles; S4, 1 part of QPEG-COOH obtained in step S1 was dissolved in 50 parts of MES buffer, 0.15 parts of 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride and 0.075 parts of N-hydroxysuccinimide were added, stirred at 25℃ for 30 min, then 2 parts of amino-functionalized magnetic silica particles obtained in step S3 were added, the pH was adjusted to 7.4 with HEPES buffer, stirred at 40℃ for 12 h, separated by magnetic field, washed and dried to obtain the SiO2@QPEG.

[0036] The volume ratio of ethanol to water in the aqueous ethanol solution in step S2 is 4:1.

[0037] The concentration of 2-N-morpholinoethanesulfonic acid in the MES buffer in step S4 is 0.1 mol / L.

[0038] The concentration of 4-hydroxyethylpiperazine ethanesulfonic acid in the HEPES buffer in step S4 is 0.1 mol / L.

[0039] The addition amount of the pH-responsive sophorolipid slow-release particles in step (2) is 0.8 wt% of the mass of the steam-exploded straw.

[0040] The preparation method of the pH-responsive sophorolipid slow-release particles in step (2) comprises the following steps: N1, 2 parts of sodium alginate were dissolved in 100 parts of water to obtain a sodium alginate aqueous solution; N2, 0.1 parts of sophorolipid were added to the sodium alginate aqueous solution obtained in step N1, and stirred uniformly to obtain a sophorolipid-sodium alginate aqueous solution; N3, 50 parts of corn oil and 0.5 parts of Span 80 were mixed to obtain an emulsion; the sophorolipid-sodium alginate aqueous solution obtained in step N2 and the emulsion were mixed and homogenized at a speed of 12000 rpm for 10 min to obtain a sophorolipid-sodium alginate emulsion; N4, the sophorolipid-sodium alginate emulsion obtained in step N3 was added dropwise to a 2 wt% calcium chloride aqueous solution at a rate of 1 ml / min, and stood for 30 min, then filtered, washed and dried to obtain the pH-responsive sophorolipid slow-release particles.

[0041] Example 2

[0042] A process for producing bacterial protein feed by multi-strain synergistic fermentation of steam-exploded corn straw comprises the following steps: (1) 2500 parts of corn straw with a water content of 30 wt% were crushed to a particle size of 0.5 cm, and then steam-exploded at 190℃ and 2.5Mpa for 5 min to obtain steam-exploded straw. (2) urea is used to adjust the carbon-nitrogen ratio of the steam-exploded straw obtained in step (1) to 25:1, then potassium dihydrogen phosphate and magnesium sulfate are added, sterilized at 121℃ for 20 min, and finally pH-responsive sophorolipid slow-release particles are added to obtain a fermentation medium, in which fermentation bacteria are inoculated, and aerobic fermentation is carried out at 30℃ and 5.0 pH for 72 h, after which the fermentation is completed, and the fermentation bacteria are dried to obtain the bacterial protein feed.

[0043] The concentration of the potassium dihydrogen phosphate in step (2) is 0.1 wt% of the steam-exploded straw, and the concentration of the magnesium sulfate is 0.05 wt% of the steam-exploded straw.

[0044] The fermentation bacteria in step (2) are obtained by mixing Aspergillus niger GRJC003 and Trichoderma reesei, the inoculation amount of Aspergillus niger GRJC003 is 0.5×10 7 spores / g of the fermentation medium, and the inoculation amount of Trichoderma reesei is 0.5×10 7 spores / g of the fermentation medium.

[0045] The 5.0 pH in step (2) is adjusted by 2 mol / L sulfuric acid.

[0046] The addition amount of the pH-responsive sophorolipid slow-release particles in step (2) is 0.8 wt% of the mass of the steam-exploded straw.

[0047] The preparation method of the pH-responsive sophorolipid slow-release particles in step (2) comprises the following steps: N1 2 parts of sodium alginate are dissolved in 100 parts of water by mass fraction, and stirred until completely dissolved to obtain a sodium alginate aqueous solution; N2 0.1 parts of sophorolipid are added to the sodium alginate aqueous solution obtained in step N1 by mass fraction, and stirred uniformly to obtain a sophorolipid-sodium alginate aqueous solution; N3 50 parts of corn oil and 0.5 parts of Span80 are mixed to obtain an emulsion; the sophorolipid-sodium alginate aqueous solution obtained in step N2 and the emulsion are mixed and homogenized at a speed of 12000 rpm for 10 min to obtain a sophorolipid-sodium alginate emulsion; N4 The sophorolipid-sodium alginate emulsion obtained in step N3 is added dropwise to a 2 wt% calcium chloride aqueous solution at a rate of 1 ml / min, and left to stand for 30 min, then filtered, washed, and dried to obtain the pH-responsive sophorolipid slow-release particles.

[0048] Example 3

[0049] A process for producing a bacterial protein feed by multi-strain synergistic fermentation of steam-exploded corn straw, comprising the following steps: (1) 2500 parts of corn stalks with a moisture content of 30 wt% were crushed to a particle size of 0.5 cm, then mixed and stirred with 3 parts of SiO2@QPEG for 1 h, and then subjected to steam explosion at 190°C and 2.5 MPa for 5 min, and the SiO2@QPEG was recovered by an HGMS magnetic separator to obtain steam-exploded stalks and recovered SiO2@QPEG; (2) The carbon-nitrogen ratio of the steam-exploded stalks obtained in step (1) was adjusted to 25:1 using urea, then potassium dihydrogen phosphate and magnesium sulfate were added, and the mixture was sterilized at 121°C for 20 min to obtain a fermentation medium, and then the fermentation bacteria were inoculated into the fermentation medium, and subjected to aerobic fermentation at 30°C and 5.0 pH for 72 h, and then dried to obtain the bacterial protein feed.

[0050] The recovered SiO2@QPEG in step (1) can be reduced by soaking in 0.08-0.12 mol / L ascorbic acid for 20-40 min, filtering, washing, and vacuum drying, to realize reuse.

[0051] The concentration of potassium dihydrogen phosphate in step (2) is 0.1 wt% of the steam-exploded stalks, and the concentration of magnesium sulfate is 0.05 wt% of the steam-exploded stalks.

[0052] The fermentation bacteria in step (2) are obtained by mixing Aspergillus niger GRJC003 and Trichoderma reesei, the inoculation amount of Aspergillus niger GRJC003 is 0.5×10 7 spores / g of the fermentation medium, and the inoculation amount of Trichoderma reesei is 0.5×10 7 spores / g of the fermentation medium.

[0053] The 5.0 pH in step (2) is adjusted by 2 mol / L sulfuric acid.

[0054] The preparation method of SiO2@QPEG in step (1) comprises the following steps: S1 5 parts of quercetin and 8 parts of carboxyl-polyethylene glycol-carboxyl were dissolved in 200 parts of N,N-dimethylformamide, 0.2 parts of 4-dimethylaminopyridine and 3 parts of dicyclohexyl carbodiimide were added, and the mixture was stirred at 25°C under nitrogen protection for 24 h to obtain a reaction solution; then the reaction solution was dropped into 500 parts of ice ether for precipitation, centrifuged at 8000 rpm for 10 min, the precipitate was washed with ether for 3 times, and vacuum dried at 40°C for 24 h to obtain QPEG-COOH. S2: 5.4 parts of iron trichloride hexahydrate and 2 parts of iron dichloride tetrahydrate were dissolved in 100 parts of water, 20 mL of ammonia water with a concentration of 28 wt% was added dropwise under nitrogen protection, and stirred at 80°C for 1 h. The product was separated by magnetic separation and washed with water until neutral. The product was dispersed in 200 parts of an ethanol aqueous solution, 2 parts of ammonia water with a concentration of 28 wt% and 2.8 parts of tetraethoxysilane were added, and stirred at 25°C for 6 h. The product was separated by centrifugal separation and the precipitate was washed with water twice to obtain magnetic silica particles; S3: The magnetic silica particles obtained in step S2 were dispersed in 100 parts of toluene, and 1.5 parts of γ-aminopropyl triethoxysilane was added. The mixture was refluxed at 80°C for 12 h. The product was separated by centrifugal separation and washed to obtain aminated magnetic silica particles; S4: 1 part of QPEG-COOH obtained in step S1 was dissolved in 50 parts of MES buffer, 0.15 parts of 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride and 0.075 parts of N-hydroxysuccinimide were added, and stirred at 25°C for 30 min. Then, 2 parts of aminated magnetic silica particles obtained in step S3 were added, and the pH was adjusted to 7.4 with HEPES buffer. The mixture was stirred at 40°C for 12 h. The product was separated by magnetic field, washed and dried to obtain the SiO2@QPEG.

[0055] In step S2, the volume ratio of ethanol to water in the ethanol aqueous solution was 4:1.

[0056] In step S4, the concentration of 2-N-morpholinoethanesulfonic acid in the MES buffer was 0.1 mol / L.

[0057] In step S4, the concentration of 4-hydroxyethylpiperazine ethanesulfonic acid in the HEPES buffer was 0.1 mol / L.

[0058] Comparative Example 1

[0059] The difference from Example 1 is that the fermentation bacteria in step (2) is Aspergillus niger GRJC003, and the inoculation amount of Aspergillus niger GRJC003 is 1×10 7 spores / g of fermentation medium.

[0060] Comparative Example 2

[0061] The difference from Example 1 is that the fermentation bacteria in step (2) is Trichoderma reesei, and the inoculation amount of Trichoderma reesei is 1×10 7 spores / g of fermentation medium.

[0062] Comparative Example 3

[0063] The difference from Example 1 is that the fermentation bacteria in step (2) are obtained by mixing Aspergillus niger and Trichoderma reesei, the inoculation amount of Aspergillus niger is 0.5×10 7 spores / g of fermentation medium, and the inoculation amount of Trichoderma reesei is 0.5×10 7 spores / g of fermentation medium; the Aspergillus niger, Aspergillus niger , and the preservation number is CGMCC 3.3926, which is purchased from the China General Microbiological Culture Collection Center.

[0064] Comparative Example 4

[0065] The difference from Example 1 is that the fermentation bacteria in step (2) are obtained by mixing Aspergillus niger and Trichoderma reesei, the inoculation amount of Aspergillus niger is 0.5×10 7 spores / g of fermentation medium, and the inoculation amount of Trichoderma reesei is 0.5×10 7 spores / g of fermentation medium; the Aspergillus niger, Aspergillus niger , and the preservation number is CGMCC 3.3926, which is purchased from the China General Microbiological Culture Collection Center.

[0066] Comparative Example 5

[0067] The mycelial protein content in the mycelial protein feed obtained in Examples 1-3 and Comparative Examples 1-4 is determined by taking 1500 g of corn stalks as raw materials, and the results are shown in Table 1.

[0068] After the fermentation is completed, 3 times the mass of water of the mycelial protein feed is added, and stirring and leaching are performed for 1 h, and then the solid residue is separated from the liquid containing the mycelium by coarse filtration, and the liquid containing the mycelium is collected by a plate and frame filter, and the mycelium is washed with clean water, and after drying, the mycelial protein is obtained.

[0069] Table 1: Mycelial protein content

[0070] As can be seen from Table 1, the mycelial protein content in the mycelial protein feed obtained in Example 1 is the highest, and Example 2 lacks SiO2@QPEG in the steam explosion process. SiO2@QPEG takes magnetic silica particles as a carrier, and loads quercetin-polyethylene glycol conjugates. The magnetic silica particles realize the recyclable function of SiO2@QPEG, and improve the fermentation efficiency. PEG separates the active sites (phenolic hydroxyl groups) of quercetin from the surface of SiO2, reduces the steric hindrance effect, improves the dispersibility of the hydrophobic quercetin in the fermentation process, and further prevents the catalytic oxidation of SiO2 on quercetin at high temperature. The obtained SiO2@QPEG is applied to the preparation process of the mycelial protein feed produced by fermenting steam-exploded corn stalks, and simultaneously has the characteristics of high mycelial protein yield and recycling.

[0071] In the fermentation process of Example 3, the lack of sophorolipid slow-release particles, the metabolic acid production of Trichoderma reesei, and the gradual decrease of environmental pH caused the decomposition of sodium alginate gel in the sophorolipid slow-release particles, thereby slowly and continuously releasing sophorolipids. The released sophorolipids, through their amphiphilic structure, significantly improved the wettability of hydrophobic steam-exploded straw, making the distribution of water and mycelium more uniform. It also destroyed the hydrophobic barrier of lignocellulose, releasing the bound fermentable sugars, and improved the accessibility and saccharification efficiency of the substrate. At the same time, sophorolipids can effectively embed or adsorb fermentation inhibitors such as furfural, reducing their toxic effects on Trichoderma reesei. Under the synergistic effect of these three mechanisms, the growth environment and metabolic efficiency of Trichoderma reesei were fundamentally improved, ultimately achieving a significant increase in the yield of microbial protein.

[0072] Example 1 only uses Aspergillus niger GRJC003 fermentation, and the yield of microbial protein decreases. Example 2 only uses Trichoderma reesei fermentation, and the yield of microbial protein decreases. Aspergillus niger GRJC003 is isolated from the rumen fluid of adult small-tail Han sheep and obtained through directed domestication, has excellent cellulose and hemicellulose degradation capacity, can efficiently ferment steam-exploded straw, and produce microbial protein feed. Aspergillus niger GRJC003 strain exhibits high enzyme activity and growth rate during fermentation, which can significantly improve the yield of microbial protein. In mixed fermentation, Aspergillus niger GRJC003 and Trichoderma reesei form a "division of labor and cooperation" mode: Trichoderma reesei preferentially adheres to the straw substrate, breaks down the fiber structure through enzymatic action, and provides fermentable sugars; Aspergillus niger GRJC003 utilizes these sugars for rapid growth and protein synthesis, and may also secrete auxiliary enzymes (such as amylase or phenol-degrading enzymes) to further optimize substrate utilization.

[0073] Through the comparison of the data of Comparative Example 3 and Comparative Example 4, a key phenomenon can be further revealed: the conventional mixed fermentation of Aspergillus niger and Trichoderma reesei not only fails to achieve the expected synergistic effect, but also has a significantly lower yield than single dominant strain fermentation. This result clearly indicates that in the fermentation system of the present application (including steam explosion pretreatment, use of additives, and specific conditions), the mixing of conventional strains may result in reduced efficiency or even adverse effects due to incompatibility between strains, insufficient enzyme matching, or metabolic competition inhibition, thus lacking mutual promotion.

[0074] In contrast, Example 1 uses mixed fermentation of Aspergillus niger GRJC003 and Trichoderma reesei, achieving a high yield of 432.6g, which is much better than all the comparative examples. This huge difference highlights the unique properties of the GRJC003 strain and its specific synergistic mechanism with Trichoderma reesei. This synergy cannot be easily achieved with conventional strain combinations, as it relies on the screened and optimized genetic background of GRJC003.

Claims

1. A process for the production of cell protein feed from steam exploded corn stover by multi-strain synergistic fermentation, characterized by, Comprising the following steps: (1) according to the mass fraction, 2400-2600 parts of corn straw with water content of 25-35wt% is crushed to particle size of 0.1-0.5cm, then mixed and stirred with 2-4 parts of SiO2@QPEG for 1-2h, steam exploded at 180-200℃, 2-3Mpa for 4-6min, SiO2@QPEG is recovered by HGMS magnetic separator, and steam exploded straw and recovered SiO2@QPEG are obtained; (2) the carbon-nitrogen ratio of the steam exploded straw obtained in step (1) is adjusted to 25: (1-2) by urea, then potassium dihydrogen phosphate and magnesium sulfate are added, sterilized at 120-122℃ for 19-21min, and finally pH responsive sophorolipid slow-release particles are added to obtain a fermentation medium, and the fermentation bacteria are inoculated in the above fermentation medium, and aerobic fermentation is carried out at 25-35℃, 4.8-5.2pH for 36-72h, after fermentation, drying is carried out to obtain the bacterial protein feed; The fermentation bacteria in step (2) are obtained by mixing Aspergillus niger GRJC003 and Trichoderma reesei, the inoculation amount of Aspergillus niger GRJC003 is 0.4×10 7 -0.6×10 7 spores / g fermentation medium, and the inoculation amount of Trichoderma reesei is 0.4×10 7 -0.6×10 7 spores / g fermentation medium.

2. The process for the production of cell protein feed from steam-exploded corn stover by multi-strain synergistic fermentation as claimed in claim 1, wherein, The recovered SiO2@QPEG in step (1) can be reduced by soaking in 0.08-0.12 mol / L ascorbic acid for 20-40 min, filtering, washing, and vacuum drying, for reuse.

3. The process for the production of cell protein feed from steam-exploded corn stover by multi-strain synergistic fermentation as claimed in claim 1, wherein, In step (2), the concentration of potassium dihydrogen phosphate is 0.08-0.12wt% of the steam exploded straw, and the concentration of magnesium sulfate is 0.03-0.07wt% of the steam exploded straw.

4. The process for the production of cell protein feed from steam-exploded corn stover by multi-strain synergistic fermentation as claimed in claim 1, wherein, In step (2), the 4.8-5.2pH is adjusted by 1-2mol / L sulfuric acid.

5. The process for the production of cell protein feed from steam-exploded corn stover by multi-strain synergistic fermentation as claimed in claim 1, wherein, The preparation method of SiO2@QPEG in step (1) comprises the following steps: S1 according to the mass fraction, 4-6 parts of quercetin, 7-8 parts of carboxyl-polyethylene glycol-carboxyl are dissolved in 100-200 parts of N,N-dimethylformamide, 0.1-0.3 parts of 4-dimethylaminopyridine and 2-4 parts of dicyclohexyl carbodiimide are added, and the reaction is stirred at 24-26℃ under nitrogen protection for 22-26h to obtain a reaction solution; then the reaction solution is dropped into 400-500 parts of ice ether for precipitation, centrifuged at 6000-8000rpm for 9-11min, the precipitate is washed with ether for 2-3 times, and vacuum dried at 30-40℃ for 24-48h to obtain QPEG-COOH; S2 according to the mass fraction, 5-6 parts of iron trichloride hexahydrate and 1-3 parts of dichloride iron tetrahydrate are dissolved in 90-100 parts of water, 18-22 mL of ammonia water with a concentration of 26-30wt% is added under nitrogen protection, and stirred at 78-82℃ for 1-2h, then magnetically separated and washed with water until neutral to obtain magnetite; the above magnetite is dispersed in 180-200 parts of ethanol aqueous solution, 1-2 parts of ammonia water with a concentration of 26-30wt% and 2-3 parts of tetraethoxysilane are added, and stirred at 24-26℃ for 5-7h, then centrifuged and washed the precipitate with water for 1-2 times to obtain magnetic silica particles; S3: 1-2 parts of the magnetic silica particles obtained in step S2 were dispersed in 90-100 parts of toluene, and 1-2 parts of γ-aminopropyltriethoxysilane was added, and the mixture was refluxed at 78-82°C for 10-14 h, and then centrifuged, washed and dried to obtain aminated magnetic silica particles; S4: 1-2 parts of QPEG-COOH obtained in step S1 were dissolved in 50 parts of MES buffer, 0.1-0.2 parts of 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride and 0.07-0.08 parts of N-hydroxysuccinimide were added, and the mixture was stirred at 24-26°C for 30-40 min, then 1-2 parts of the aminated magnetic silica particles obtained in step S3 were added, and the pH was adjusted to 7-8 with HEPES buffer, and the mixture was stirred at 38-42°C for 12-14 h, and then separated by magnetic field, washed and dried to obtain the SiO2@QPEG.

6. The process for the production of cell protein feed from steam-exploded corn stover by multi-strain synergistic fermentation as claimed in claim 5, wherein, In the aqueous ethanol solution of step S2, the volume ratio of ethanol to water was 4: (1-2).

7. The process as claimed in claim 1, wherein the multi-strain synergistic fermentation of steam-exploded corn stover for production of cell protein feed is characterized by, The addition amount of the pH-responsive sophorolipid slow-release particles in step (2) was 0.5-1 wt% of the mass of the steam-exploded straw. ​ 8. The process for the production of cell protein feed from steam-exploded corn stover by multi-strain synergistic fermentation as claimed in claim 1, wherein, The preparation method of the pH-responsive sophorolipid slow-release particles in step (2) comprises the following steps: N1: 2-3 parts of sodium alginate were dissolved in 90-100 parts of water, and the mixture was stirred until completely dissolved to obtain a sodium alginate aqueous solution; N2: 0.1-0.2 parts of sophorolipid were added to the sodium alginate aqueous solution obtained in step S1, and the mixture was stirred to obtain a sophorolipid-sodium alginate aqueous solution; N3: 40-60 parts of corn oil and 0.3-0.8 parts of Span 80 were mixed to obtain an emulsion; the sophorolipid-sodium alginate aqueous solution obtained in step N2 and the emulsion were mixed and homogenized at a speed of 10000-15000 rpm for 5-10 min to obtain a sophorolipid-sodium alginate emulsion; N4: The sophorolipid-sodium alginate emulsion obtained in step N3 was added dropwise into a 1.8-2.2 wt% calcium chloride aqueous solution at a rate of 1-2 ml / min, and the mixture was allowed to stand for 30-40 min, and then filtered, washed and dried to obtain the pH-responsive sophorolipid slow-release particles.

Images