Aspergillus nomiae for preventing and controlling spodoptera frugiperda

Abstract

The invention belongs to the field of microorganisms, and particularly discloses Aspergillus nomiae for preventing and controlling spodoptera frugiperda. The technical problem to be solved by the invention is how to prevent noctuid insects from harming plants. The invention provides aspergillus for preventing and treating noctuid insects from harming plants, the aspergillus is Aspergillus nomiae WNAN1, and the preservation number of the aspergillus nomiae is CGMCC (China General Microbiological Culture Collection Center) No.41741. The invention further provides a preparation method of the aspergillus nomiae. Experiments prove that the aspergillus has a relatively high fatality rate on third-instar larvae of the spodoptera frugiperda, and can be used for preventing and controlling the spodoptera frugiperda.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of microorganisms, and particularly relates to a strain of Aspergillus for preventing and treating Spodoptera frugiperda Aspergillus nomiae . BACKGROUND

[0002] Spodoptera frugiperda Spodoptera frugiperda (J. E. Smith) is an important agricultural pest originally distributed in the tropical and subtropical regions of the Americas, which can harm more than 350 crops such as corn, wheat, rice, soybeans, sorghum, etc. As an alien invasive species, since its invasion into China at the end of 2018, it has caused significant harm to China's food production safety and has been listed in the "List of Class I Crop Diseases and Pests".

[0003] Hainan Province has a high temperature and high humidity climate, which is very suitable for the growth and reproduction of Spodoptera frugiperda. According to biological and climatic speculation, Hainan Province is expected to have 9-10 generations per year, becoming a truly "year-round breeding area". Hainan Province is also an important base for corn southward migration, and the local areas (Sanya, Ledong, Dongfang, etc.) also have the habit of planting fresh corn all year round. Spodoptera frugiperda is particularly fond of corn and can harm corn at various stages such as the seedling stage, ear stage, and mature stage. In just a few years since Spodoptera frugiperda invaded Hainan, it has risen to become the main pest of field corn, resulting in a significant increase in the number of chemical pesticide applications per corn growth period, from 4.27-5.47 times in 2019 to 7.73-8.77 times. The misuse of chemical pesticides to control Spodoptera frugiperda also threatens local pollinating insects such as bees, so the situation of Spodoptera frugiperda prevention and control in Hainan Province is particularly severe, and it is urgent to develop more green and sustainable control techniques to persistently control Spodoptera frugiperda damage.

[0004] Insect pathogenic fungi are a class of insect pathogenic microorganisms derived from soil. Due to their obvious advantages such as multiple species, strong virulence, easy scale production, and environmental friendliness, they are widely used in the field of biological control. The most widely studied insect pathogenic fungi currently include Metarhizium anisopliae and Beauveria bassiana. These fungi have a wide host range and are mainly registered for use in the control of harmful arthropods, especially important agricultural pests in the order Lepidoptera, including Spodoptera frugiperda, Plutella xylostella, and Spodoptera exigua. Since Spodoptera frugiperda invaded China, the exploitation and utilization of fungal biological control resources have become a research hotspot. Although the original habitat of Spodoptera frugiperda in the Americas has reported B. bassiana and M. anisopliae strains with high insecticidal and ovicidal activity against Spodoptera frugiperda, research in China has shown that the two existing fungi have no ovicidal effect. Therefore, it is necessary to develop and utilize more efficient Spodoptera frugiperda biocontrol fungal strains. SUMMARY

[0005] The technical problem solved by the present application is how to prevent and control the harm of noctuidae insects (spodoptera frugiperda) to plants. Aspergillus nomiae The aspergillus is nomuraea rileyi (WN_AN1) and is preserved in the China General Microbiological Culture Collection Center (CGMCC, located at No. 1, Huayuancun, Beijing, China), with a preservation number of CGMCC No. 41741.

[0006] The present application also provides a composition containing the aspergillus.

[0007] The culture can be a substance obtained by culturing the aspergillus in a microbial culture medium.

[0008] The composition includes spores, mycelia of the aspergillus, plant tissues infected by the aspergillus, and / or culture of the substrate for culturing the aspergillus.

[0009] The active ingredients of the composition can also contain other biological components or non-biological components, and other active ingredients of the composition can be determined by those skilled in the art according to the effect of the composition.

[0010] The composition can also be a microbial agent.

[0011] The microbial agent can be a microbial agent.

[0012] The microbial agent refers to a live microbial preparation obtained by processing the fermentation broth or solid fermentation product of the target microorganism after expansion using a carrier as an adsorbent.

[0013] The microbial agent can be in various dosage forms, including but not limited to liquid, emulsion, suspension, powder, granule, wettable powder, or water dispersible granule.

[0014] The microbial agent can also include a carrier as needed.

[0015] The composition can be any of the following: A1) a composition with biocontrol effect; A2) a composition for preventing and controlling noctuidae insects; A3) a composition for preventing and controlling spodoptera frugiperda.

[0016] The Spodoptera frugiperda can be a Spodoptera frugiperda larva.

[0017] The application also provides a method for preparing the composition, which comprises the step of taking the Aspergillus as a composition component.

[0018] The application also provides the use of the Aspergillus or the composition in the preparation of a product.

[0019] The product has at least one of the following properties: B1) has a biocontrol effect; B2) controls noctuidae insects; B3) controls Spodoptera frugiperda.

[0020] The application also provides a method for controlling Spodoptera frugiperda from damaging plants, which comprises contacting a biocontrol product with the plants to control Spodoptera frugiperda, wherein the biocontrol product is the Aspergillus or the composition.

[0021] In the method, the contacting of the biocontrol product with the plants can be spraying the biocontrol product onto the plants (such as the leaves).

[0022] The biocontrol product can be a suspension of the Aspergillus and an aqueous solution containing a suspending agent. The suspending agent is Tween-80 or other non-ionic surfactants, preferably Tween-80, and the concentration is 0.05% (V / V).

[0023] Further, the concentration of the Aspergillus in the suspension can be 1.0×10 4 - 1.0×10 8 / mL.

[0024] Further, the concentration of the spore suspension can be 1.0×10 8 / mL.

[0025] In the above, the plants can be any of the following: C1) angiosperms; C2) monocotyledon plants; C3) plants of the order Poales; C4) plants of the family Poaceae; C5) plants of the genus Zea; and C6) corn.

[0026] The application has the following beneficial effects: the application screens a new Aspergillus strain Aspergillus nomiae which has high pathogenicity to Spodoptera frugiperda, and provides a new choice for the biological control of Spodoptera frugiperda.

[0027] Compared with the prior art, the application uses an Aspergillus strain isolated from soil Aspergillus nomiae to biologically control Spodoptera frugiperda, and the strain has obvious control effect on the 3rd instar larvae of Spodoptera frugiperda, and has good application prospect.

[0028] Deposit Description Strain Name: Aspergillus nomius Latin Name: Aspergillus nomiae Strain Number: WN_AN1 Deposit Agency: China General Microbiological Culture Collection Center Abbreviation of Deposit Agency: CGMCC Address: No. 1, Yihuangyuan, Beichen West Road, Beijing Date of Deposit: December 31, 2024 Registration Number of the Collection Center: CGMCC NO. 41741 BRIEF DESCRIPTION OF DRAWINGS Figure 1 Figure 1 is a colony picture of Aspergillus nomius WN_AN1 grown on PDAY medium for 5 days.

[0029] Figure 2 Figure 2 is a survival curve of Spodoptera exigua 3rd instar larvae after being infected by Aspergillus nomius WN_AN1 spore suspension in different ways, A is leaf dipping method, B is insect dipping method, C is feeding method, blue solid line is the control group, and red solid line is the Aspergillus nomius WN_AN1 infection group.

[0030] Figure 3 Figure 3 is a picture of Spodoptera exigua larvae after being infected by Aspergillus nomius WN_AN1 and covered by yellow mycelium for 1-3 days.

[0031] Figure 4 Figure 4 is a survival curve of Spodoptera exigua 3rd instar larvae after being infected by Aspergillus nomius WN_AN1 spore suspension in different concentrations (leaf dipping method). DETAILED DESCRIPTION

[0032] The present application will be further described in conjunction with specific embodiments. The examples given are only to illustrate the present application, and are not intended to limit the scope of the present application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the present application.

[0033] In the following examples, the experimental methods are conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial channels, unless otherwise specified.

[0034] In the following examples, the survival analysis tool in the GraphPad Prism 8 statistical software is used to process the data and draw graphs, and P<0.05 (*) indicates a significant difference.

[0035] Example 1, isolation and identification of strains 1.1 Soil sample collection: The collection site is a corn field in Wanning City, Hainan Province (N18.713598°, E110.173617°), with a soil depth of 5-10 cm and a weight of about 200g.

[0036] 1.2 Isolation and identification of biocontrol fungi in soil: 1 g of soil sample passed through a 40 mesh sieve was added to 10 mL of sterilized Tween water with a concentration of 0.5%, and vortexed and shaken, then left to stand for 15 minutes. The supernatant was then transferred to a PDAY medium containing streptomycin with a concentration of 50 μg / mL and plated, and incubated at 28±2°C for 3-5 days. Single colonies were selected and transferred to a PDAY medium containing streptomycin and incubated for 3-5 days. Then they were transferred to a PDAY medium without streptomycin and incubated for 3-5 days, and pure single colonies were observed. The colonies were yellow-green in color, with good mycelial growth. After 5 days of culture, the conidia were observed on the surface of the mycelium under a microscope. The morphology was similar to that of Aspergillus, with long and slender mycelium, and many round spores distributed in and around the mycelium. See Figure 1 .

[0037] The preparation method of PDAY medium is as follows: 200 g of peeled potatoes were added to 800 mL of distilled water, boiled and filtered to obtain juice in a 1 L beaker. Then 5 g of yeast extract, 20 g of sucrose and 15 g of agar powder were added to the 1 L beaker and stirred evenly. Distilled water was added to make up to 1 L, and sterilized at 121°C for 15 min under high pressure.

[0038] 1.3 Molecular identification of strains: CTAB method was used to extract the genomic DNA of single strains, and the ITS4 (5'-TCCTCCGCTTATTGATATGC-3') / ITS5 (5'-GGAAGTAAAAGTCGTAACAAGG) primer pair was used for amplification and sequencing, and the BLAST tool on the NCBI website was used for sequence alignment. The sequence was 100% identical to OP905648.1 Aspergillus nomiae , so the isolated strain was identified as Aspergillus Aspergillus nomiae , named Aspergillus WN_AN1.

[0039] The amplification product is SEQ ID NO: 1 (580 bp) in the sequence table, as follows: 5'-TTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCGCAAGGCCGCCGGGGGGCATCCGCCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGAACGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCCCCTGCGGGGGGGGACGGGCCCTAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAAACAACCATTCTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA-3'.

[0040] Example 2, pathogenicity test of Aspergillus WN_AN1 to Spodoptera exigua 2.1 Test materials Test strain: Aspergillus WN_AN1 isolated and identified in Example 1 above.

[0041] Test insects: Spodoptera exigua 3rd instar larvae were collected from the wild in Sanya City and were bred in the laboratory for several generations before being used for the pathogenicity test.

[0042] 2.2 Preparation of the bacterial agent: First, a 0.05% Tween-80 solution was prepared with distilled water, and after sterilization, a sterilized Tween water was obtained for standby use. Aspergillus WN_AN1 was cultured in PDAY medium at 28±2°C for 5-7 days, and the conidia of Aspergillus WN_AN1 were scraped with a sterile medicine spoon and placed into a glass tube containing 5 mL of the above sterilized Tween water and glass beads to obtain a conidial suspension, which was vortexed for 2 minutes and the number of conidia was counted under a microscope. The conidial suspension was diluted with the above sterilized Tween water to adjust the conidial concentration to 1.0 x 10 8cells / mL (abbreviated as 1.0×10⁻⁶) 8 Inoculant or 1.0×10 8 A spore suspension of 1 spores / mL was prepared and diluted sequentially to obtain spore concentrations of 1.0 × 10⁻⁶ spores / mL. 7 cells / mL (abbreviated as 1.0×10⁻⁶) 7 Inoculant or 1.0×10 7 A fungal agent (spore suspension at 1.0 × 10⁻⁶ cells / mL), 1.0 × 10⁻⁶ 6 cells / mL (abbreviated as 1.0×10⁻⁶) 6 Inoculant or 1.0×10 6 (spore suspension of 1.0 × 10⁶ cells / mL) 5 cells / mL (abbreviated as 1.0×10⁻⁶) 5 Inoculant or 1.0×10 5 A fungal agent (spore suspension at 1.0 × 10⁻⁶ cells / mL), 1.0 × 10⁻⁶ 4 cells / mL (abbreviated as 1.0×10⁻⁶) 4 Inoculant or 1.0×10 4 (Spore suspension of spores / mL).

[0043] 2.3 Determination of pathogenicity of strains: 2.3.1 Leaf dipping method: The experiment included 6 treatments, with 1.0 × 10⁻⁶ treatments. 4 Inoculum group, 1.0×10 5 Inoculum group, 1.0×10 6 Inoculum group, 1.0×10 7 Inoculum group, 1.0×10 8 Microbial agent group. Each treatment was set up with 3 replicates, and each replicate contained 20 test insects.

[0044] 2.3.1.11.0×10 4 Inoculum group: The experiment was repeated 3 times, and the experimental method for each repetition was as follows: Fresh corn leaves with a diameter of 1.5 cm were cut and soaked in 1.0 × 10⁻⁶ microbial solution obtained in 2.2. 4 The bacteria were incubated in the inoculum for 1 minute, then allowed to dry. The bacteria were then fed to selected third-instar fall armyworm larvae of uniform size in a 12-well culture plate. Each larva was fed two corn leaves. After 24 hours, the feed was replaced with artificial feed. The number of dead larvae in each treatment group was counted every 24 hours for survival analysis.

[0045] 1.0×10 5 Inoculum group: The experiment was repeated 3 times, and the experimental method for each repetition was as follows: Fresh corn leaves with a diameter of 1.5 cm were cut and soaked in 1.0 × 10⁻⁶ microbial solution obtained in 2.2. 5The larvae were fed with the fungus for 1 min, and then the larvae were fed with 2 pieces of corn leaves per larva in a 12-well plate. The corn leaves were replaced with artificial diet after 24 h, and the number of dead larvae was counted every 24 h to analyze the survival rate.

[0046] 1.0 x 10 6 The experimental method was as follows: fresh corn leaves with a diameter of 1.5 cm were cut, and the leaves were soaked in 1.0 x 10 6 The larvae were fed with the fungus for 1 min, and then the larvae were fed with 2 pieces of corn leaves per larva in a 12-well plate. The corn leaves were replaced with artificial diet after 24 h, and the number of dead larvae was counted every 24 h to analyze the survival rate.

[0047] 1.0 x 10 7 The experimental method was as follows: fresh corn leaves with a diameter of 1.5 cm were cut, and the leaves were soaked in 1.0 x 10 7 The larvae were fed with the fungus for 1 min, and then the larvae were fed with 2 pieces of corn leaves per larva in a 12-well plate. The corn leaves were replaced with artificial diet after 24 h, and the number of dead larvae was counted every 24 h to analyze the survival rate.

[0048] 1.0 x 10 8 The experimental method was as follows: fresh corn leaves with a diameter of 1.5 cm were cut, and the leaves were soaked in 1.0 x 10 8 The larvae were fed with the fungus for 1 min, and then the larvae were fed with 2 pieces of corn leaves per larva in a 12-well plate. The corn leaves were replaced with artificial diet after 24 h, and the number of dead larvae was counted every 24 h to analyze the survival rate.

[0049] 2.3.1.2 Control group (CK): 1.0 x 10 4 The fungus was replaced with sterilized Tween water, and the other operations were the same as in 2.3.1.1.

[0050] 2.3.2 Insect immersion method: 3rd instar Helicoverpa armigera larvae were immersed in a 1.0 x 10 8 The fungus was replaced with sterilized Tween water, and the other operations were the same as in 2.3.1.1.

[0051] 2.3.3 Feed Soaking Method: Soak 0.5cm × 0.5cm artificial feed blocks in 1.0 × 10... 8 The spores were added to a spore suspension of 1 spore / mL for 1 minute (the control group was 0.5% sterile Tween water without fungal spores), and then allowed to dry. The spores were then fed to selected 3rd instar fall armyworm larvae of uniform size. After 24 hours, the larvae were replaced with artificial feed and fed again. The number of dead larvae in the treatment group was counted every 24 hours for survival analysis.

[0052] Using leaf soaking, insect soaking, and feed soaking methods, at a concentration of 1.0 × 10⁻⁶... 8 The survival rate of fall armyworm larvae was determined using a spore suspension at a concentration of 1 spores / mL. The results showed that only the leaf immersion method (…) Figure 2 In the case of (A) immersion method, the survival rate of 3rd instar larvae of the fall armyworm was significantly lower than that of the control. Figure 2 (B) and soaking feed method ( Figure 2 There was no significant difference between the control group (C) and the treatment group. Furthermore, using the leaf-immersion method, the phenotypic changes of fall armyworm larvae infected and killed by Aspergillus WN_AN1 were observed 1-3 days later, showing a change from sparse mycelia on day 1 (…). Figure 3 (A), by the 3rd day it was completely covered by yellow mycelium ( Figure 3 (B) The leaf soaking method is the most effective method.

[0053] The leaf dipping method was used to determine the concentration of spore suspensions at different concentrations (1.0 × 10⁻⁶). 4 1.0×10 5 1.0×10 6 1.0×10 7 1.0×10 8 The survival rate of 3rd instar larvae of the fall armyworm (number per mL) was found to be: at 1.0 × 10⁻⁶ larvae / mL. 7 cells / mL and 1.0×10 8 At a concentration of 1.0 × 10⁶ cells / mL, the survival rate was significantly different from that of the control group, and this difference was even more pronounced at a concentration of 1.0 × 10⁶ cells / mL. 8 When the number of larvae is 1 / mL, the survival rate of 3rd instar larvae of the fall armyworm drops to below 15%. Figure 4 ).

[0054] The application has been described in detail. For those skilled in the art, the application can be implemented in a wider range under the same parameters, concentrations and conditions without departing from the spirit and scope of the application and without unnecessary experiments. Although the application gives a special example, it should be understood that the application can be further improved. In summary, according to the principle of the application, the application intends to include any change, use or improvement of the application, including the change made by the conventional technology known in the art, which is out of the range disclosed in the application.

Claims

1. An Aspergillus characterized in that, The Aspergillus is Nomuraea rileyi (ATCC 4810) Aspergillus nomiae ) WN_AN1, which is preserved in the China General Microbiological Culture Collection Center (CGMCC, located at No. 1, Yihuang 3rd, Beichen West Road, Chaoyang District, Beijing), and the preservation number is CGMCC No. 41741.

2. Composition, characterized in that, The composition contains the Aspergillus of claim 1.

3. The composition of claim 2, wherein: The composition is a culture, which is a substance obtained by culturing the Aspergillus in a microbial culture medium.

4. The composition of claim 2, wherein: The composition is a microbial inoculant.

5. The composition according to any one of claims 2-4, characterized in that, The composition is any one of the following: A1) a composition having a biocontrol effect; A2) a composition for controlling noctuidae insects; A3) a composition for controlling Spodoptera frugiperda.

6. Process for the preparation of a composition, characterized in that, The composition is the composition of any one of claims 2 to 5, and the method comprises the step of using the Aspergillus of claim 1 as a component of the composition.

7. Use of the Aspergillus of claim 1 or the composition of claims 2 to 5 in the manufacture of a product.

8. The product of claim 7, wherein, The product has at least one of the following properties: B1) having a biocontrol effect; B2) controlling noctuidae insects; B3) controlling Spodoptera frugiperda.

9. A method of controlling Spodoptera frugiperda damage to a plant, characterized by: The method comprises contacting a biocontrol product with a plant to control Spodoptera frugiperda, the biocontrol product being the Aspergillus of claim 1 or the composition of claims 2 to 5.

10. The composition of claim 5 or the product of claim 8 or the method of claim 9, wherein, The plant is any one of the following: C1) an angiosperm plant; C2) a monocotyledon plant; C3) a plant of the order Poales; C4) a plant of the family Poaceae; C5) a plant of the genus Zea; C6) corn.

Images