Double-stranded RNA (Ribonucleic Acid) aiming at hemiptera insects as well as pesticide composition and application thereof

Abstract

The invention discloses a double-stranded RNA (Ribonucleic Acid) aiming at hemiptera insects as well as a pesticide composition and application of the double-stranded RNA. The dsRNA provided by the invention is used as a biopesticide, has the characteristics of high efficiency, specificity, fast degradation and no residue, realizes the prevention and control of brown planthopper through an RNAi mechanism, and is beneficial to reducing the use of chemical pesticides. The invention provides a brand new brown planthopper target gene as a target of RNA interference. The survival rate result shows that the genes play an important role in the survival process of the brown planthopper, are effective targets for preventing and treating the brown planthopper by using a gene silencing means, and have a wide application prospect. Correspondingly, the invention provides a plurality of dsRNA sequences aiming at the targets, and part of the sequences show unprecedented brown planthopper control efficiency.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological pesticides, and particularly relates to double-stranded RNA for hemipteran insects and a pesticide composition and use thereof. BACKGROUND

[0002] The brown planthopper (BPH, Nilaparvata lugens) belongs to the order Hemiptera and the family Delphacidae in the phylum Arthropoda, and is a monophagous pest that only inhabits and breeds on rice. By sucking the phloem sap of rice, the BPH causes the growth and development of rice to be restricted and the yield of rice to be reduced. Its long-distance migration habit makes the damage range wide and increases the difficulty of prevention and control.

[0003] The damage of the BPH includes two aspects of direct and indirect. The direct damage is that the BPH uses the piercing-sucking mouthpart to suck the juice of rice, consumes water and nutrients, and can cause the rice to be withered and even to be prostrate, resulting in a significant reduction in yield. The indirect damage is that the feeding and oviposition of the BPH leave wounds on the stems and leaves of rice, increase the risk of water loss and pathogen invasion; at the same time, the honeydew produced by the BPH is easy to breed mold, further aggravating the disease.

[0004] In agricultural production, the BPH damage is often dealt with by applying chemical pesticides such as organophosphorus pesticides, carbamate pesticides, nicotine pesticides, pymetrozine, and buprofezin. Reasonable pesticide application can effectively control the number of pests and reduce the damage. However, the use of chemical pesticides can cause soil and environmental pollution, kill other species in the ecological chain, and have residues in rice, endangering the ecology and human health. At the same time, the use of chemical pesticides can increase the resistance of the BPH, forcing people to use higher doses of pesticides, forming a vicious cycle. Therefore, it is urgent to develop a new type of green and safe and efficient control means.

[0005] RNA interference (RNAi) is a gene silencing technology mediated by double-stranded RNA (dsRNA). After the exogenous dsRNA enters the host cell, it is cut into small fragments of RNA (siRNA) by endonuclease Dicer. These siRNAs are dissociated into sense and antisense strands under the action of RNA helicase, and the antisense siRNA combines with enzymes to form an RNA-induced silencing complex (RISC). After the RISC combines with the mRNA homologously, the mRNA is cut, and the transcription level of the gene is reduced. RNAi technology exists universally in most eukaryotes, has high specificity and high efficiency, and has become an important means for studying gene function and preventing and controlling crop diseases and pests.

[0006] Multiple studies have shown that RNAi can play an important role in the control of the brown planthopper, i.e., by silencing specific genes through dsRNA, the brown planthopper can develop abnormally, its reproductive capacity can decrease, and it can even die. Green agriculture is a new concept of agricultural development proposed in recent years, which aims to increase farmers' income while protecting the ecological environment and maintaining human health. Nucleic acid interferon utilizes the principle of RNAi to design dsRNA targeting specific genes of pathogenic organisms (insects or microorganisms), silences the expression of target genes, and thus inhibits or eliminates pathogenic organisms. Due to its high efficiency, high specificity and no pesticide residues, it has great potential in replacing traditional chemical pesticides and achieving green agriculture. However, there is still an unmet need for RNAi solutions against the brown planthopper that have better control effects. SUMMARY

[0007] The present application provides dsRNA sequences targeting multiple brown planthopper genes, which can effectively knock down the expression of target genes and significantly reduce the survival rate of the brown planthopper when the dsRNA fragments enter the body of the brown planthopper. Given the advantages of safety and efficiency of RNA pesticides, the use of dsRNA of the present application to target potential targets of the brown planthopper can achieve the goal of green and efficient pest control.

[0008] In one aspect, the present application provides a double-stranded RNA against a hemipteran insect, the double-stranded RNA against the hemipteran insect comprising a sense strand and an antisense strand, wherein the sense strand has a nucleotide sequence as set forth in SEQ ID NO: 1, and the antisense strand has a nucleotide sequence as set forth in SEQ ID NO: 2.

[0009] In another aspect, the present application provides a double-stranded RNA against a hemipteran insect, the double-stranded RNA against the hemipteran insect comprising a sense strand and an antisense strand, wherein:

[0010] the sense strand has a nucleotide sequence as set forth in SEQ ID NO: 3, and the antisense strand has a nucleotide sequence as set forth in SEQ ID NO: 4; the sense strand has a nucleotide sequence as set forth in SEQ ID NO: 5, and the antisense strand has a nucleotide sequence as set forth in SEQ ID NO: 6; the sense strand has a nucleotide sequence as set forth in SEQ ID NO: 7, and the antisense strand has a nucleotide sequence as set forth in SEQ ID NO: 8; the sense strand has a nucleotide sequence as set forth in SEQ ID NO: 9, and the antisense strand has a nucleotide sequence as set forth in SEQ ID NO: 10; the sense strand has a nucleotide sequence as set forth in SEQ ID NO: 11, and the antisense strand has a nucleotide sequence as set forth in SEQ ID NO: 12; or the sense strand has a nucleotide sequence as set forth in SEQ ID NO: 13, and the antisense strand has a nucleotide sequence as set forth in SEQ ID NO: 14.

[0011] In another aspect, the present application provides a double-stranded RNA against a hemipteran insect, comprising a sense strand and an antisense strand, wherein the sense strand has a nucleotide sequence as set forth in SEQ ID NO: 3, and the antisense strand has a nucleotide sequence as set forth in SEQ ID NO: 4.

[0012] In another aspect, the present application provides a double-stranded RNA against a hemipteran insect, comprising a sense strand and an antisense strand, wherein the sense strand has a nucleotide sequence as set forth in SEQ ID NO: 5, and the antisense strand has a nucleotide sequence as set forth in SEQ ID NO: 6.

[0013] In another aspect, the present application provides a double-stranded RNA against a hemipteran insect, comprising a sense strand and an antisense strand, wherein the sense strand has a nucleotide sequence as set forth in SEQ ID NO: 7, and the antisense strand has a nucleotide sequence as set forth in SEQ ID NO: 8.

[0014] In another aspect, the present application provides a double-stranded RNA against a hemipteran insect, comprising a sense strand and an antisense strand, wherein the sense strand has a nucleotide sequence as set forth in SEQ ID NO: 9, and the antisense strand has a nucleotide sequence as set forth in SEQ ID NO: 10.

[0015] In another aspect, the present application provides a double-stranded RNA against a hemipteran insect, comprising a sense strand and an antisense strand, wherein the sense strand has a nucleotide sequence as set forth in SEQ ID NO: 11, and the antisense strand has a nucleotide sequence as set forth in SEQ ID NO: 12.

[0016] In another aspect, the present application provides a double-stranded RNA against a hemipteran insect, comprising a sense strand and an antisense strand, wherein the sense strand has a nucleotide sequence as set forth in SEQ ID NO: 13, and the antisense strand has a nucleotide sequence as set forth in SEQ ID NO: 14.

[0017] In another aspect, the present application provides an expression vector, characterized in that the expression vector comprises the sense strand or the antisense strand of the double-stranded RNA against a hemipteran insect as described in any of the embodiments herein.

[0018] In another aspect, the present application provides a host cell, characterized in that the host cell comprises the sense strand or the antisense strand of the double-stranded RNA against the hemipteran insect or the expression vector as described in any of the embodiments herein.

[0019] In another aspect, the present application provides a method for preparing the double-stranded RNA against the hemipteran insect as described in any of the embodiments herein, comprising expressing using the expression vector or the host cell as described in any of the embodiments herein.

[0020] In one or more embodiments, the method comprises the following steps:

[0021] S1: extracting RNA of the brown planthopper;

[0022] S2: reverse transcribing to obtain cDNA using the RNA of the brown planthopper as a template;

[0023] S3: amplifying the target sequence by PCR using the cDNA as a template;

[0024] S4: cloning the target sequence into a plasmid to obtain a recombinant plasmid vector;

[0025] S5: transforming the recombinant plasmid vector into a competent cell, and taking the competent cell transformed with the recombinant plasmid vector as a host cell;

[0026] S6: culturing the host cell, inducing the host cell to express the double-stranded RNA against the hemipteran insect using an inducing agent, and obtaining a fermentation broth;

[0027] S7: purifying the double-stranded RNA against the hemipteran insect in the fermentation broth.

[0028] Preferably, in step S1, the extraction method is the Trizol method.

[0029] Preferably, in step S3, the target sequence is selected from any one of SEQ ID NOs: 15-28.

[0030] Preferably, in step S4, the plasmid is a pET-30a plasmid.

[0031] Preferably, in step S4, the cloning step comprises:

[0032] S4-1: treating the plasmid with a specific endonuclease, and purifying to obtain a linearized plasmid by agarose gel electrophoresis;

[0033] S4-2: connecting the product amplified by PCR in S3 with the linearized plasmid using a DNA ligase to obtain a recombinant plasmid vector.

[0034] More preferably, in step S4-1, the specific endonuclease is EcoRI endonuclease.

[0035] More preferably, in step S4-1, the recombinant plasmid vector comprises two or more promoters.

[0036] Preferably, in step S5, the competent cell is HT115(DE3).

[0037] Preferably, in step S6, the inducing agent is IPTG.

[0038] In one or more embodiments, in step S7, the purifying step comprises:

[0039] S7-1: fermentation broth pretreatment;

[0040] S7-2: positive pressure-bell type double filtration;

[0041] S7-3: ethanol gradient precipitation.

[0042] Preferably, step S7-1 comprises the following steps:

[0043] S7-1-1: cell wall breaking;

[0044] S7-1-2: water bath;

[0045] S7-1-3: ultrasonic treatment;

[0046] S7-1-4: after adjusting the pH of the liquid obtained in S7-1-3 to 7.9-8.1 using buffer A, centrifugation is performed to obtain supernatant A; wherein the buffer A is an aqueous solution comprising 0.15M sodium bicarbonate, 0.014M sodium tetraborate and 0.48M sodium chloride, and the pH value is 8.4-8.6;

[0047] S7-1-5: after adjusting the pH of the supernatant A to 5.9-6.1 using buffer B, centrifugation is performed to obtain supernatant B; wherein the buffer B is an aqueous solution comprising 0.15M citric acid, 0.18M hydrochloric acid, 0.22M tris-hydroxymethyl aminomethane and 0.62M sodium chloride, and the pH value is 4.4-4.6.

[0048] More preferably, in step S7-1-2, the temperature of the water bath is 45-55°C.

[0049] More preferably, in step S7-1-3, the ultrasonic treatment time is 25-35 minutes.

[0050] More preferably, in step S7-1-4, the centrifugation is performed at 12000-14000 rpm, 9-11°C for 18-22 minutes.

[0051] More preferably, in step S7-1-5, the centrifugation is performed at 14000-16000 rpm, 4-6°C for 18-22 minutes.

[0052] Preferably, step S7-2 comprises filtering the liquid obtained in step S7-1 using a positive pressure-bell type double filter device to obtain a filtrate.

[0053] More preferably, the pore size of the filter column used in the filtering process is 0.22 μm, the material of the filter core is cellulose, and the pressure of the filtering process is 0.09-0.11 MPa.

[0054] Preferably, step S7-3 comprises the following steps:

[0055] S7-3-1: precipitating the filtrate obtained in step S7-2 using 27-33% (v / v) ethanol, and centrifuging to obtain a supernatant C;

[0056] S7-3-2: after the supernatant C is left to stand overnight at 9-11°C, anhydrous ethanol is added to the supernatant C under low-speed stirring until the final concentration of ethanol reaches 65-75% (v / v);

[0057] S7-3-3: centrifuging the liquid obtained in step S7-3-2 to collect the purified dsRNA.

[0058] More preferably, in step S7-3-3, the centrifugation is performed at 14000-16000 rpm, 3-5°C for 35-45 minutes.

[0059] In another aspect, the present application provides a pesticide composition comprising an effective amount of the double-stranded RNA against hemipteran insects as described in any of the embodiments herein, and a pharmaceutically acceptable carrier, solvent or excipient.

[0060] In one or more embodiments, the carrier is a chitosan nanoparticle.

[0061] In another aspect, the present application provides a method of preparing the pesticide composition as described in any of the embodiments herein, the method comprising adding the double-stranded RNA against hemipteran insects as described in any of the embodiments herein and a pharmaceutically acceptable carrier to a solvent.

[0062] In one or more embodiments, the method comprises the following steps:

[0063] S1: dissolving chitosan in an acetic acid buffer to obtain a chitosan acetic acid solution; and dissolving dsRNA in a sodium sulfate solution to obtain a dsRNA sodium sulfate solution;

[0064] S2: slowly drop the dsRNA sodium sulfate solution into the chitosan acetic acid solution, mix well, incubate, vortex after incubation, to obtain the chitosan nanoparticle preparation of dsRNA.

[0065] Preferably, in step S1, the pH of the acetic acid buffer is 4.4-4.6.

[0066] Preferably, in step S1, the concentration of chitosan in the chitosan acetic acid solution is 0.02% (w / v).

[0067] Preferably, in step S1, the concentration of sodium sulfate in the sodium sulfate solution is 45-55 mM.

[0068] Preferably, in step S1, the concentration of dsRNA in the dsRNA sodium sulfate solution is 10-5000 mg / L. More preferably, in step S1, the concentration of dsRNA in the dsRNA sodium sulfate solution is 1000-3000 mg / L. Further preferably, in step S1, the concentration of dsRNA in the dsRNA sodium sulfate solution is 2000 mg / L.

[0069] Preferably, in step S2, the volume ratio of the dsRNA sodium sulfate solution and the chitosan acetic acid solution for mixing is 1:3-3:1. More preferably, in step S2, the volume ratio of the dsRNA sodium sulfate solution and the chitosan acetic acid solution for mixing is 1:1.

[0070] Preferably, in step S2, the temperature of the incubation is 50-60°C; more preferably, in step S2, the temperature of the incubation is 55°C.

[0071] Preferably, in step S2, the time of the incubation is 30-90 seconds; more preferably, in step S2, the time of the incubation is 60 seconds.

[0072] Preferably, in step S2, the time of the vortex is 5-60 seconds; more preferably, in step S2, the time of the vortex is 30 seconds.

[0073] Preferably, in step S2, the concentration of dsRNA in the chitosan nanoparticle preparation of dsRNA is 10-3000 mg / L. More preferably, in step S2, the concentration of dsRNA in the chitosan nanoparticle preparation of dsRNA is 100-2000 mg / L. Further preferably, in step S2, the concentration of dsRNA in the chitosan nanoparticle preparation of dsRNA is 1000 mg / L.

[0074] In another aspect, the present application provides use of the double-stranded RNA against the hemipteran insect as described in any embodiment herein in the preparation of a pesticide for controlling the hemipteran insect.

[0075] In another aspect, the present application provides use of the pesticide composition as described in any embodiment herein in the preparation of a pesticide for controlling the hemipteran insect.

[0076] In another aspect, the present application provides use of the double-stranded RNA against the hemipteran insect as described in any embodiment herein in the control of the hemipteran insect.

[0077] In another aspect, the present application provides use of the pesticide composition as described in any embodiment herein in the control of the hemipteran insect.

[0078] In another aspect, the present application provides a method for controlling the hemipteran insect, comprising administering the double-stranded RNA against the hemipteran insect as described in any embodiment herein.

[0079] In another aspect, the present application provides a method for controlling the hemipteran insect, comprising administering the pesticide composition as described in any embodiment herein.

[0080] Preferably, the hemipteran insect is a Delphacidae insect. Preferably, the hemipteran insect is preferably selected from one or more of the group consisting of the Brown planthopper, the White-backed planthopper, the Small brown planthopper, the Green peach aphid, and the Cotton aphid. More preferably, the Delphacidae insect is the Brown planthopper.

[0081] The present application has at least one of the following advantages:

[0082] 1. Compared with traditional chemical pesticides, the dsRNA provided by the present application has the characteristics of high efficiency, specificity, fast degradation and no residue as a biological pesticide, and achieves the control of the Brown planthopper through the mechanism of RNAi, which helps to reduce the use of chemical pesticides.

[0083] 2. The present application provides novel target genes of the Brown planthopper as targets for RNA interference. As can be seen from the survival rate results, these genes play an important role in the survival process of the Brown planthopper, and are effective targets for controlling the Brown planthopper by gene silencing, which has broad application prospects. Accordingly, the present application provides a plurality of dsRNA sequences targeting these targets, some of which exhibit unprecedented efficiency in controlling the Brown planthopper.

[0084] 3. The present application uses Escherichia coli fermentation to produce dsRNA, and obtains high-purity dsRNA through positive pressure-bell type double filtration and alcohol gradient precipitation. This method is low in cost, simple in operation, and can realize large-scale production, breaking the limitations of traditional production methods, and providing a feasible solution for industrialized production of dsRNA.

[0085] 4. The present application provides a nanoparticle carrier, which can quickly penetrate the body wall of pests, efficiently enter the living cells, and achieve high dsRNA delivery efficiency and gene interference effect. BRIEF DESCRIPTION OF DRAWINGS

[0086] Figure 1 is the plasmid map of pET30a-GFP.

[0087] Figure 2 is the liquid chromatogram analysis spectrum of the product obtained by ethanol gradient precipitation.

[0088] Figure 3 is the survival rate of the brown planthopper after 3 days and 5 days of microinjection of dsRNA targeting each target. Among them, Figure 3 A in is the survival rate of the brown planthopper after 3 days of microinjection of dsRNA targeting each target; Figure 3 B in is the survival rate of the brown planthopper after 5 days of microinjection of dsRNA targeting each target.

[0089] Figure 4 is the relative expression level determination result of the mRNA level of 7 target genes after 1 day of microinjection of dsRNA targeting each target.

[0090] Figure 5 is the indoor bioassay treatment schematic diagram.

[0091] Figure 6 is the mRNA expression level determination result of the target gene of the brown planthopper after 3 days of seedling immersion method treatment in the indoor bioassay.

[0092] Figure 7 is the survival rate determination result of the brown planthopper after 5 days of seedling immersion method treatment in the indoor bioassay.

[0093] Figure 8 is the survival rate determination result of the brown planthopper after seedling immersion method treatment of rice seedlings with dsRNA preparation and liquid acrinathrin, respectively, in the indoor bioassay. DETAILED DESCRIPTION

[0094] Example 1: Target function and sequence design

[0095] The sequence conservative region was analyzed by using the conservative domain database (https: / / www.ncbi.nlm.nih.gov / cdd / ?term=) of the National Center for Biotechnology Information (NCBI), and the BLOCK-iT RNAi design tool was combined online to design the RNAi molecule. TMRNAi Designer (https: / / rnaidesigner.thermofisher.com / rnaiexpress / ) was used to design the corresponding target RNA sequences for 7 genes of Nilaparvata lugens.

[0096] No. Target protein name Gene length / bp Function Target 1 dsRNase 1275 Catalyze the degradation of ribonucleic acid (RNA) Target 2 V-type proton ATPase subunit B1 1503 V-ATPase subunit, involved in hydrolyzing ATP for energy Target 3 V-type proton ATPase subunit d3 806 V-ATPase subunit, as a proton entry channel Target 4 V-type proton ATPase subunit E2 774 V-ATPase subunit, involved in hydrolyzing ATP for energy Target 5 Troponin T 2026 Troponin subunit, regulates striated muscle contraction Target 6 Troponin C 1149 Troponin subunit, regulates striated muscle contraction Target 7 Troponin I 2180 Troponin subunit, regulates striated muscle contraction

[0097] dsRNA targeting Target 1:

[0098] Sense strand (SEQ ID NO: 1)

[0099] ACGAGGGGCAAAUGAAUCACAUCCAGAUAGGGUUCCAAGUCAAACAGAAUUUCAUCAGUUUGAUUGAUAUUUGUUUCGAUGAAACCGUAUUGACGGCUAAUUACUCGCUGUAUCAAGCCAGCUACAGAAUCGCUGGUAGGCAAGUCGGAUUUCCCAGGAUGAAUUUCAUCGCCGGAAAAUUCUACGGCGACAUUGAAAUUUGGAACUAUACUCGAGAAAGAAACAACGAGAAACGUUAGCCAAGAUUCUGGGAUCGGAAAAUUUAGCUAGUACUUACAUUAAAGAUGACAAAAACUACUAUCUAGCAAGAGGACAUUUAACAGCCAAAGCUGACUUUGUCUAUGGAGCUGAACAGAUGGCUACAUUCUACUACAUCAAUGUGGCGCCUCAAUGGCAAAUCAUCAACGCUGGAAAUUGGGCUGCACUUGAAGAUAAUGUUCGCAACUACAUCAUCAACAAUAAACUGGAAGUUCUCAUCUACACCAUCCCUCACGGUGUAGCCGUAUUACCUGAUGCAGAUGGAAUCUACCAGCCUCUCUAC

[0100] Antisense strand (SEQ ID NO: 2)

[0101] GUAGAGAGGCUGGUAGAUUCCAUCUGCAUCAGGUAAUACGGCUACACCGUGAGGGAUGGUGUAGAUGAGAACUUCCAGUUUAUUGUUGAUGAUGUAGUUGCGAACAUUAUCUUCAAGUGCAGCCCAAUUUCCAGCGUUGAUGAUUUGCCAUUGAGGCGCCACAUUGAUGUAGUAGAAUGUAGCCAUCUGUUCAGCUCCAUAGACAAAGUCAGCUUUGGCUGUUAAAUGUCCUCUUGCUAGAUAGUAGUUUUUGUCAUCUUUAAUGUAAGUACUAGCUAAAUUUUCCGAUCCCAGAAUCUUGGCUAACGUUUCUCGUUGUUUCUUUCUCGAGUAUAGUUUCCAAAUUUCAAUGUCGCCGUAGAAUUUUCCGGCGAUGAAAUUCAUCCUGGGAAAUCCGACUUGCCUACCAGCGAUUCUGUAGCUGGCUUGAUACAGCGAGUAAUUAGCCGUCAAUACGGUUUCAUCGAAACAAAUAUCAAUCAAACUGAUGAAAUUCUGUUUGACUUGGAACCCUAUCUGGAUGUGAUUCAUUUGCCCCUCGU

[0102] dsRNA targeting target 2:

[0103] Sense strand (SEQ ID NO: 3)

[0104] UCAAGCUGCCAAGGAGCAUGUAUUGGCAGUUUCAAGGGAUUUCAUUUCACAGCCAAGAUUGACAUAUAAAACUGUUUGUGGUGUCAACGGCCCUUUGGUGAUCUUGGAUGAGGUCAAAUUCCCCAAGUUUGCUGAAAUUGUUCAGCUCAAACUUGCUGAUGGAACUGUUCGUUCCGGUCAAGUAUUGGAAGUCAGCGGCACUAAGGCUGUUGUACAGGUCUUCGAAGGAACUUCCGGAAUUGAUGCGAAAAACACUCUGUGUGAGUUCACCGGUGAUAUCCUUCGGACGCCAGUAUCAGAAGAUAUGCUUGGUCGUGUAUUCAACGGAAGUGGUAAGCCCAUCGACAAAGGACCUCCCAUUCUUGCCGAGGAUUAUCUCGACAUUCAAGGUCAACCCAUCAAUCCUUGGUCGCGUAUCUAUCCCGAGGAAAUGAUCCAGACUGGAAUUUCAGCCAUCGACGUCAUGAACUCGAUUGCUCGUGGCCAGAAAAUUCCCAUCUUUUCAGCUGCCGGUCUACCUCACAACGAAAUUGCUGCUCAAAUCUGUAGACAGGCUGGUCUUGUCAAACUGCCAGGAAAGUCAGUUCUCGAU

[0105] sense sequence (SEQ ID NO: 3)

[0106] AUCGAGAACUGACUUUCCUGGCAGUUUGACAAGACCAGCCUGUCUACAGAUUUGAGCAGCAAUUUCGUUGUGAGGUAGACCGGCAGCUGAAAAGAUGGGAAUUUUCUGGCCACGAGCAAUCGAGUUCAUGACGUCGAUGGCUGAAAUUCCAGUCUGGAUCAUUUCCUCGGGAUAGAUACGCGACCAAGGAUUGAUGGGUUGACCUUGAAUGUCGAGAUAAUCCUCGGCAAGAAUGGGAGGUCCUUUGUCGAUGGGCUUACCACUUCCGUUGAAUACACGACCAAGCAUAUCUUCUGAUACUGGCGUCCGAAGGAUAUCACCGGUGAACUCACACAGAGUGUUUUUCGCAUCAAUUCCGGAAGUUCCUUCGAAGACCUGUACAACAGCCUUAGUGCCGCUGACUUCCAAUACUUGACCGGAACGAACAGUUCCAUCAGCAAGUUUGAGCUGAACAAUUUCAGCAAACUUGGGGAAUUUGACCUCAUCCAAGAUCACCAAAGGGCCGUUGACACCACAAACAGUUUUAUAUGUCAAUCUUGGCUGUGAAAUGAAAUCCCUUGAAACUGCCAAUACAUGCUCCUUGGCAGCUUGA

[0107] dsRNA targeting target 3:

[0108] Sense strand (SEQ ID NO: 5)

[0109] AAGCCCCUCUCAGAGUUCCUCGACUUUGUGCGCUAUGCCUACAUGAUCGACAACACCAUUCUGCUAAUGACAGGCACUCUCCAUCAGCGACCUGUUGACGAGGUGGCAGCCCGUUGUCACCCGCUCGGCCGCUUCCAGCAAUGGAGGCAGUACACGUGGCGUUGACUCCUCGCGAGCUCUACAACGCGGUGAUUGUGGACACGCCCCUCGCACCCUUCUUCCUCGACUGCAUCAAUGAGCACAGUCUCAACGAGGUCAAUGUCGAACUUAUACGCAACAUGCUCUACAAGGCAUAUUUGGAGAGCUUCGACAAGUUCUGCAAGAAUCUGGGUGGCAUCACAGCUGAGACGAUGUCUGAGAUACUAGCGUUCGAGUGUGACAGACGUGCCUUCAUGAUCACCAUCAACUCGUUCCGCACCGAACUGACCAAGAGUGAGCGCGCCAGUCUGUUCCCACGCUGCGGCCUGCUGCAUCCCACCGGACUGGCUGCUCUGGCUGCGGCUGACAACUAUGAACAGGUGACCUUCAUCAG

[0110] sense sequence (SEQ ID NO: 5): 5'-cgcaccaucaucaguucucgacuuugugcgcuau gccuacaugaucgacaacaccauucugcuauaacuucgacagucucuccaucagcguccuguugacgaggu ggcagcccguu guccgcucggccgcuccagcauggaggcaguacacguggcguu guccucgcgagcuca caacgcggugaauuggacacgc cccucgcacccuucuu ccucgacugcaucaauggagcacagucuc aacgagucaauggcgaacuuauacgcaacaugcucuacaaggcauauuuggagagcuucgacaaggu cuucgaaauucuggguggcaucacagcugagacgaugucugagauacuagcguucgagugugacagacg ugccuucaugaucaccaucaacucguuccgcaccgaacugaccaagagugagcgcgccagucuguuccc acgcugcggccugcugcaucccaccggaugggcugcuugcuuucgucgucgucgacuauuaacauga caagguucaucaucag

[0111] CUGAUGAAGGUCACCUGUUCAUAGUUGUCAGCCGCAGCCAGAGCAGCCAGUCCGGUGGGAUGCAGCAGGCCGCAGCGUGGGAACAGACUGGCGCGCUCACUCUUGGUCAGUUCGGUGCGGAACGAGUUGAUGGUGAUCAUGAAGGCACGUCUGUCACACUCGAACGCUAGUAUCUCAGACAUCGUCUCAGCUGUGAUGCCACCCAGAUUCUUGCAGAACUUGUCGAAGCUCUCCAAAUAUGCCUUGUAGAGCAUGUUGCGUAUAAGUUCGACAUUGACCUCGUUGAGACUGUGCUCAUUGAUGCAGUCGAGGAAGAAGGGUGCGAGGGGCGUGUCCACAAUCACCGCGUUGUAGAGCUCGCGAGGAGUCAACGCCACGUGUACUGCCUCCAUUGCUGGAAGCGGCCGAGCGGGUGACAACGGGCUGCCACCUCGUCAACAGGUCGCUGAUGGAGAGUGCCUGUCAUUAGCAGAAUGGUGUUGUCGAUCAUGUAGGCAUAGCGCACAAAGUCGAGGAACUCUGAGAGGGGCUU

[0112] dsRNA targeting target 4:

[0113] Sense strand (SEQ ID NO: 7)

[0114] AAAACUGCCGAGAAAAACGUCACCCAAUUGGAAUCAAUCAUUAUAACAAAAGCGAAAAUGGUGGUGCAAACGGCGAGACAAAAUUUCAUAUCUGAAGUGACUACUGAUAUCCACCAAAGCUUGGAAAACUGUGUAACUGAAGAUGGCUAUGCCAGCGUUCUAAAGAGUCUCAUAAUUCAAGCUCUUUGCAUGUUGCAAGAGGCAGACGUGAUAGUGCAAGUGAGAGAGCAGGACAGAGAUAUCGUAAAAUCAGCCACCAAUGAAAUGAUGGACAGGUACAAGUCUAUCACCGGACAGGACUGCAACAUCACUUUGUCCAAAAAGAAUUUGCCCGGGAAAAGUAUUGGAGGCACUGUUGUCUACAACAAACGCUGUACACUAAAGGUAGACAACACACUUUACGACAGGUUGAGAAUAGUUCUGGAACAAUCGUUGCCAAUGUUCAGGGAGUUAUUAUUCAACGA

[0115] Antisense strand (SEQ ID NO: 8)

[0116] UCGUUGAAUAAUAACUCCCUGAACAUUGGCAACGAUUGUUCCAGAACUAUUCUCAACCUGUCGUAAAGUGUGUUGUCUACCUUUAGUGUACAGCGUUUGUUGUAGACAACAGUGCCUCCAAUACUUUUCCCGGGCAAAUUCUUUUUGGACAAAGUGAUGUUGCAGUCCUGUCCGGUGAUAGACUUGUACCUGUCCAUCAUUUCAUUGGUGGCUGAUUUUACGAUAUCUCUGUCCUGCUCUCUCACUUGCACUAUCACGUCUGCCUCUUGCAACAUGCAAAGAGCUUGAAUUAUGAGACUCUUUAGAACGCUGGCAUAGCCAUCUUCAGUUACACAGUUUUCCAAGCUUUGGUGGAUAUCAGUAGUCACUUCAGAUAUGAAAUUUUGUCUCGCCGUUUGCACCACCAUUUUCGCUUUUGUUAUAAUGAUUGAUUCCAAUUGGGUGACGUUUUUCUCGGCAGUUUU

[0117] dsRNA targeting target 5:

[0118] Sense (SEQ ID NO: 9)

[0119] AAUGAUCCUGAAUUUGUCAAGCGCCAAGAAGCCAAGUCAUCGGCUCUUGACGAACAGCUGAAAGAGUACAUCGCCGAAUGGCGCAAACAGAGGUCAAAGGAGGAGGAUGAUCUCAAAAAGCUCAAGGAGAAACAGGCCAAGCGCAAGGUCAUGCGAGCGGAAGAAGAAAAGAAAAUGGCGGAACGCAAGAAGCAAGAGGAGGAGCGCAGAGUGAAGGAGAUCGAAGAGAAGAAACAGAGAGACAUGGAAGAGAAAAGAAAGCGCUUGGAAGAGGCCGAGAAGAAGAGACAGACAAUGAUGGCGGCUCUCAAGGACCAGAGCAAAUCGAAAGGACCCAACUUCACCGUAAACAAGAAAACAGACUUGAACAUGACCUCAGCUCAAAUGGAAAGGAACAAGACUAAGGAGCAGCUGGAGGAGGAGAAGAAGAUCUCUCUGUCGUUCCGCAUCAAGCCGUUGGCCAUCGAGAACAUGAGCAUCAACGCACUGCGCGCCAAGGCCCAGGAACUGUGGGACUGCAUCGUCAAGCUCGAAACUGAGAAGUACGAUCUGGAGGAACGCCAGAA

[0120] Antisense (SEQ ID NO: 10)

[0121] UUCUGGCGUUCCUCCAGAUCGUACUUCUCAGUUUCGAGCUUGACGAUGCAGUCCCACAGUUCCUGGGCCUUGGCGCGCAGUGCGUUGAUGCUCAUGUUCUCGAUGGCCAACGGCUUGAUGCGGAACGACAGAGAGAUCUUCUUCUCCUCCUCCAGCUGCUCCUUAGUCUUGUUCCUUUCCAUUUGAGCUGAGGUCAUGUUCAAGUCUGUUUUCUUGUUUACGGUGAAGUUGGGUCCUUUCGAUUUGCUCUGGUCCUUGAGAGCCGCCAUCAUUGUCUGUCUCUUCUUCUCGGCCUCUUCCAAGCGCUUUCUUUUCUCUUCCAUGUCUCUCUGUUUCUUCUCUUCGAUCUCCUUCACUCUGCGCUCCUCCUCUUGCUUCUUGCGUUCCGCCAUUUUCUUUUCUUCUUCCGCUCGCAUGACCUUGCGCUUGGCCUGUUUCUCCUUGAGCUUUUUGAGAUCAUCCUCCUCCUUUGACCUCUGUUUGCGCCAUUCGGCGAUGUACUCUUUCAGCUGUUCGUCAAGAGCCGAUGACUUGGCUUCUUGGCGCUUGACAAAUUCAGGAUCAUU

[0122] dsRNAs targeting target 6:

[0123] Sense (SEQ ID NO: 11)

[0124] AUUGAGACAACAAAAAUCAGUAUAAUGUUGAACACCAUGGGACAGAUAUUCGAUGAAGAAGAAUUGAACGCUUUGAUCAGAGAAAAUGAUCCAGACAAAUCCGGUAGACUGAACUUUGAUGGAUUUUGCCGCAUUGCAACACAUUUCCUAGAAGAAGAUGAUGCUGAAGCUAUGCAAGAAGAAUUGAAAGAAGCCUUCAGAUUGUAUGACAAAGAAGGUAACGGUUACAUCACAACGGGAACGCUGAGGGAAAUCUUGGCCGCUCUGGAUGAUAAACUGAAUAAUGAUGAUUUAGAUGGUAUCAUUGCUGAGAUCGACACUGACGGAUCAGGCACAGUCGACUUUGAUGAAUUCAUGGAGAUGAUGACAGGAGAAUAAAUGACCUGAAACGCUAUGGAGGCAAUGCCAUAUCUAUCCCUUCCAAAAAAUCCUUCAUUAAUGCAAGAUAUAAUCUUCUUCUAUCUGAUCGAGUCUGAGGCUGGAAAACUUGUGAUUC

[0125] sense sequence (SEQ ID NO: 11)

[0126] GAAUCACAAGUUUUCCAGCCUCAGACUCGAUCAGAUAGAAGAAGAUUAUAUCUUGCAUUAAUGAAGGAUUUUUUGGAAGGGAUAGAUAUGGCAUUGCCUCCAUAGCGUUUCAGGUCAUUUAUUCUCCUGUCAUCAUCUCCAUGAAUUCAUCAAAGUCGACUGUGCCUGAUCCGUCAGUGUCGAUCUCAGCAAUGAUACCAUCUAAAUCAUCAUUAUUCAGUUUAUCAUCCAGAGCGGCCAAGAUUUCCCUCAGCGUUCCCGUUGUGAUGUAACCGUUACCUUCUUUGUCAUACAAUCUGAAGGCUUCUUUCAAUUCUUCUUGCAUAGCUUCAGCAUCAUCUUCUUCUAGGAAAUGUGUUGCAAUGCGGCAAAAUCCAUCAAAGUUCAGUCUACCGGAUUUGUCUGGAUCAUUUUCUCUGAUCAAAGCGUUCAAUUCUUCUUCAUCGAAUAUCUGUCCCAUGGUGUUCAACAUUAUACUGAUUUUUGUUGUCUCAAU

[0127] dsRNA targeting target 7:

[0128] Sense (SEQ ID NO: 13)

[0129] AGAAGAAGCUCAGGUUGUUGCUGAGGAAAAAGGCUGCUGAGGAAUUGAAGAAGGAACAGGAGAGGAAAGCCGCGGAAAGGAGAAGGAUCAUCGAGGAGAGGUGUGGCAAGGCUGUUGAUCUCGAUGACGGAAGUGAAGAGAAAGUCAAGGCAACUUUAAAAACCUAUCACGACAGAAUUGGAAAAUUGGAGGAUGAAAAAUUUGACCUGGAAUAUAUUGUAAAAAAGAAAGACUUCGAGAUCGCUGACCUCAACAGCCAGGUGAAUGACCUCCGUGGUAAAUUUGUCAAGCCAACCUUGAAAAAAGUCUCCAAAUAUGAGAACAAAUUCGCCAAGCUCCAGAAGAAAGCAGCUGAAUUCAAUUUCAGAAAUCAGCUCAAAGUUGUCAAGAAGAAGGAAUUCACCUUGGAAGAAGAAGACAAGGAGAAAAAGGGAAUCGUCGAUUGGUCAAAGAAGGACGAGAAGAAGGACGGCGGAGAUGGAACACCAGCUGAAGCGACAGAAGGGGCACCCGACGACGGGGACCUGCUGGACGACG

[0130] sense sequence (SEQ ID NO: 13)

[0131] CGUCGUCCAGCAGGUCCCCGUCGUCGGGUGCCCCUUCUGUCGCUUCAGCUGGUGUUCCAUCUCCGCCGUCCUUCUUCUCGUCCUUCUUUGACCAAUCGACGAUUCCCUUUUUCUCCUUGUCUUCUUCUUCCAAGGUGAAUUCCUUCUUCUUGACAACUUUGAGCUGAUUUCUGAAAUUGAAUUCAGCUGCUUUCUUCUGGAGCUUGGCGAAUUUGUUCUCAUAUUUGGAGACUUUUUUCAAGGUUGGCUUGACAAAUUUACCACGGAGGUCAUUCACCUGGCUGUUGAGGUCAGCGAUCUCGAAGUCUUUCUUUUUUACAAUAUAUUCCAGGUCAAAUUUUUCAUCCUCCAAUUUUCCAAUUCUGUCGUGAUAGGUUUUUAAAGUUGCCUUGACUUUCUCUUCACUUCCGUCAUCGAGAUCAACAGCCUUGCCACACCUCUCCUCGAUGAUCCUUCUCCUUUCCGCGGCUUUCCUCUCCUGUUCCUUCUUCAAUUCCUCAGCAGCCUUUUUCCUCAGCAACAACCUGAGCUUCUUCU

[0132] Example 2: Construction of recombinant dsRNA expression strain

[0133] To prepare dsRNA for target validation, a recombinant strain for fermentation production was first constructed. Five 3rd instar nymphs of the brown planthopper were collected as samples, and total RNA of the brown planthopper was extracted using the Trizol method. The synthesized cDNA was used as a template for reverse transcription. The synthesized cDNA was used as a template, and the target fragments shown in Table 3 were amplified by polymerase chain reaction (PCR) technology according to the reaction system and reaction conditions in Table 1 and Table 2; for each target, only the corresponding target fragment of one of the sense strand or the antisense strand was amplified. Subsequently, the PCR products were separated by 1.2% agarose gel electrophoresis. The target band was cut and recovered using a gel recovery kit, and further purified to obtain high-purity desired products.

[0134] Table 1: PCR system

[0135] Component Volume 2x Mix 25 μL 10 μM forward primer 1 μL 10 μM reverse primer 1 μL Brown planthopper cDNA 2 μL ddH2O Supplemented to a total volume of 50 μL

[0136] Table 2: PCR amplification program

[0137] Step Temperature Time / cycle Step 1 95℃ 3 min Step 2 95℃ 15s Step 3 56℃ 30s Step 4 72℃ 30s Step 5 Go to Step 2 34 cycles Step 6 72℃ 5 min

[0138] Table 3: Target fragments corresponding to target RNA

[0139]

[0140]

[0141] The pET-30a plasmid used in this embodiment is commercially available.

[0142] The pET-30a plasmid was subjected to enzyme digestion with EcoRI endonuclease, and the reaction was carried out at 37°C for 1 hour according to the reaction system shown in Table 4. After the enzyme digestion reaction was completed, the enzyme digestion products were separated by agarose gel electrophoresis, and then the purified linearized plasmid was obtained by gel recovery and purification.

[0143] Table 4: Enzyme digestion system

[0144] Component Volume 10x buffer 2 μL Plasmid 1 μg EcoRI 1 μL ddH2O Supplemented to a total volume of 20 μL

[0145] The recovered and purified PCR product and the enzyme-digested pET-30a plasmid were mixed according to the ligation reaction system shown in Table 5. The PCR product and the linearized plasmid were allowed to form a series of recombinant plasmids pET-30a-Target 1 to pET-30a-Target 7 through base complementary pairing under the action of DNA ligase at 16°C for 1 hour. After the ligation reaction was completed, the ligation product was transformed into HT115(DE3) competent cells by heat shock method; the HT115(DE3) is an HT115 RNase III deficient E. coli strain with DE3 strain characteristics; the HT115(DE3) competent cells are commercially available.

[0146] The pET-30a-GFP recombinant plasmid used as a control was constructed in the same way and transformed into HT115(DE3) competent cells. The plasmid map of pET-30a-GFP is shown in Figure 1 The transformed cells were uniformly spread on plates containing kanamycin and incubated in a 37°C constant temperature incubator for 12-14 hours.

[0147] Table 5: Ligation system

[0148] Component Volume 5x CEII buffer 4 μL Exnase II 2 μL EcoRI-digested pET-30a plasmid 100 ng PCR product 20 ng ddH2O Supplemented to a total volume of 20 μL

[0149] After the culture was completed, single colonies were selected from the plates and amplified according to the colony PCR amplification system shown in Table 6. Positive clones successfully transformed with the target fragments corresponding to the targets shown in Table 3 were screened and subjected to sequencing analysis; specifically, since the double T7 promoter in the pET-30a plasmid was retained in the recombinant plasmid (for reference Figure 1), and two T7 promoters are respectively located at both ends of the target fragment, and the expression directions are opposite, so the positive clone colony of the target fragment with one of the sense strand or antisense strand can express the double-stranded RNA of the corresponding target. For the positive clone with correct sequencing results, add glycerol as a protective agent with a final concentration of 25% to make a glycerol bacteria, and store it in a -80°C ultra-low temperature refrigerator for subsequent experimental research and application.

[0150] Table 6: Colony PCR system

[0151] Component Volume 2x Taq Mix 7.5 μL 10 μM forward primer 0.3 μL 10 μM reverse primer 0.3 μL Monoclonal colony Trace amount ddH2O Supplemented to a total volume of 15 μL

[0152] Example 3: Purification of dsRNA in fermentation product of strain

[0153] The recombinant bacteria were cultured with LB medium, and when the OD600 value of the culture solution approached 0.4, 0.5 mM IPTG was added to induce the expression of dsRNA, and the bacteria were collected after 14 hours of continuous culture at 37°C. Then, the fermentation product was extracted and purified, and the purification process mainly included the pretreatment of fermentation broth, positive pressure-bell type double filtration, and alcohol gradient precipitation, and the specific operation process was as follows:

[0154] Pretreatment of fermentation broth: first, the dsRNA fermentation broth obtained after breaking the wall of the recombinant E. coli expressing the target fragment dsRNA was pretreated by 50°C water bath and ultrasonic for 30 minutes. Then, the pH value of the fermentation broth was adjusted to 8 using buffer A, and the supernatant A was collected by using a tube centrifuge at 13000 rpm and 10°C for 20 minutes. Then, the pH value of the supernatant A was adjusted to 6 using buffer B, and the supernatant B was collected by centrifugation at 15000 rpm and 5°C for 20 minutes.

[0155] Among them, the specific composition of buffer A is: 0.15 M sodium bicarbonate, 0.014 M sodium tetraborate and 0.48 M sodium chloride, and the pH value is 8.5; the specific composition of buffer B is: 0.15 M citric acid, 0.18 M hydrochloric acid, 0.22 M tris-hydroxymethyl aminomethane and 0.62 M sodium chloride, and the pH value is 4.5.

[0156] Positive pressure-bell type double filtration: then, the supernatant B was filtered using a positive pressure-bell type double filtration device, the pore size of the filter column used was 0.22 μm, the cellulose filter core was used, and the pressure was kept stable at 0.1 Mpa.

[0157] Ethanol gradient precipitation: The liquid after the bell jar filtration was precipitated with ethanol at a final concentration of 30% (v / v) at 10000 rpm, 4°C for 20 minutes using a tube centrifuge to collect the supernatant C. The supernatant C was left to stand overnight at 10°C, and after a gelatinous substance was formed on the surface, low-speed stirring was performed at 1000 rpm while adding anhydrous ethanol gradually to reach a final concentration of 70% (v / v) of ethanol. Finally, the solid was collected by centrifugation at 15000 rpm, 4°C for 40 minutes using a tube centrifuge. The results of the liquid chromatography analysis of the solid are shown in Figure 2 , which indicate that RNA with high purity was obtained.

[0158] Through the above steps, the efficient purification of each target dsRNA was successfully achieved, providing high-quality and high-purity samples for further in-depth research.

[0159] Example 4: Effect verification of each target dsRNA

[0160] The dsRNAs targeting all targets in Example 1 and the GFP dsRNA were prepared according to the methods of Examples 2 and 3, and the GFP dsRNA was used as a control sequence; each dsRNA was dissolved in ultrapure water to a final concentration of 500 ng / μL. The brown planthopper nymphs at the third instar stage were selected as the experimental objects, and about 25 ng of dsRNA was introduced into the brown planthopper body by microinjection. The specific injection site was the area between the bases of the second pair of legs of the brown planthopper. In order to exclude the interference of mechanical damage on the subsequent experimental results, after completing all injection operations, the brown planthoppers were left to stand for 3 hours, and then the surviving brown planthoppers were transferred to glass test tubes and fed on rice seedlings as food sources. During the feeding process, the survival of the brown planthoppers was counted at certain time intervals, and the counting results are shown in Figure 3 . On the 3rd day after injection, the injection survival rates of the 7 targets were distributed between 10.2% and 53.7%, which were significantly lower than the survival rate of the control group (89.4%, see Figure 3 , A). On the 5th day after injection, the survival rate of the control group was 68.6%, while the survival rates of the 7 targets were all lower than 26.3%, among which the survival rate of target 7 was lower than 10%, and the survival rates of target 3 and target 6 brown planthoppers dropped to 0, i.e., the control effect reached 100% (see Figure 3 , B). Figure 3 The results were obtained by using student-t test to analyze whether there was a significant difference between the control group and each treatment group, * represents p<0.05, ** represents p<0.01, *** represents p<0.001, and **** represents p<0.0001.

[0161] Example 5: Effect of each target dsRNA on the expression level of the target

[0162] Twenty-four hours after microinjection treatment, brown planthopper samples were collected from both the experimental and control groups to detect changes in the expression level of the target gene within the planthoppers. To ensure the reliability and statistical significance of the experimental data, three biological replicates were set up for each group, with five brown planthopper nymphs collected from each replicate.

[0163] Total RNA was extracted from brown planthopper samples using the Trizol method. Reverse transcription was performed using the reaction systems shown in Table 7, prepared according to the HiScript III All-in-one RTSuperMix Perfect for qPCR kit (Vazyme). The specific reaction conditions were: incubation at 50°C for 15 minutes, followed by immediate incubation at 85°C for 5 seconds to complete cDNA synthesis. The synthesized cDNA was diluted 6-fold for quantitative polymerase chain reaction (qPCR). The qPCR reaction system and parameter settings are shown in Tables 8 and 9.

[0164] Table 7: Reverse Transcription System

[0165]

[0166]

[0167] Table 8: qPCR reaction system

[0168] Component Volume 2x qPCR Mix 10 μL 10 μM forward primer 0.4 μL 10 μM reverse primer 0.4 μL 6-fold diluted cDNA 1 μL ddH2O Supplemented to 20 μL

[0169] Table 9: qPCR reaction conditions

[0170]

[0171] Quantitative PCR data showed that ( Figure 4 One day after microinjection, the relative expression levels of mRNA for the seven targets were significantly reduced, ranging from 16.0% to 72.1%. The knockdown effects on targets 3 and 6 were the most significant, with their relative gene expression levels decreasing to 16.0% and 19.7%, respectively. Overall, the knockdown effect of the targets showed a similar trend to the survival rate after microinjection, demonstrating that dsRNA can successfully enter the brown planthopper and induce gene knockdown through RNA interference, thereby producing a control effect. Figure 4 The results were obtained by using the Student-t test to analyze whether there were significant differences between the target control group and the treatment group. * represents p<0.05, ** represents p<0.01, *** represents p<0.001, and **** represents p<0.0001.

[0172] Based on the combined results of microinjection and gene knockdown experiments, the seven target fragments effectively caused the death of nymphs through RNA interference, demonstrating a good control effect on brown planthopper nymphs. This indicates that these genes play a key role in the survival of brown planthopper nymphs and have significant potential and application value in brown planthopper control strategies.

[0173] Example 6: Preparation of dsRNA nanoparticle formulation

[0174] To reduce the degradation of dsRNA by complex field environments, this invention uses chitosan nanomaterials to encapsulate dsRNA, thereby preparing dsRNA nanoparticle formulations for RNA interference. The specific operation steps are as follows:

[0175] First, a 0.1M sodium acetate buffer solution was prepared, and the pH was adjusted to 4.5 with acetic acid to obtain an acetate-sodium acetate buffer solution. Chitosan was dissolved in the acetate-sodium acetate buffer solution to prepare a 0.02% (w / v) chitosan-acetic acid solution. Next, dsRNA was dissolved in a 50mM Na₂SO₄ solution to obtain a dsRNA sodium sulfate solution with a concentration of 2000 mg / L. Subsequently, the dsRNA sodium sulfate solution was slowly added dropwise to the above chitosan-acetic acid solution at a volume ratio of 1:1. After thorough mixing, the mixture was incubated at 55°C for 60 seconds. After incubation, the mixture was rapidly vortexed for 30 seconds to generate a chitosan nanoparticle formulation of dsRNA, with a final dsRNA content of 1000 mg / L.

[0176] Example 7: Indoor Life Test

[0177] The seedlings were treated using the seedling immersion method. The treatment groups were soaked in dsRNA solutions (targeting targets 3 and 6, respectively), with one group soaked in a solution containing naked dsRNA and the other in a dsRNA-containing nanoparticle formulation. The dsRNA content in both groups was 1000 mg / L. The control group was treated with water instead of the dsRNA solution. Specific groupings are shown in Table 10.

[0178] Table 10: Indoor Student Test Grouping

[0179] Group Soaking liquid dsRNA concentration Naked dsRNA Naked dsRNA solution 1000 mg / L dsRNA preparation dsRNA nano-preparation 1000 mg / L Control Water /

[0180] Fresh rice seedlings were selected, washed with clean water and dried, and the whole rice seedlings were immersed in the soaking liquid for 4 seconds and then taken out and naturally dried in a cool and ventilated place. Then, the roots of the rice seedlings were wrapped with wet cotton, and three rice seedlings were placed in each glass test tube. Fifteen healthy and active three-instar brown planthopper nymphs were selected and placed in the test tube, and the opening was sealed with a cotton ball. The test tube was placed on a plant culture shelf at 25±2°C under 12-hour light and dark alternation. As shown in Figure 5 , each treatment was set with 4 replicates, and the survival rate of the brown planthopper was investigated and counted after 5 days. The calculation formula of the survival rate is: survival rate (%) = (survival number / total number) x 100%.

[0181] After 3 days of treatment, the brown planthopper samples of the treatment group and the control group were collected, and the expression level of the target gene was detected. The quantitative PCR results are shown in Figure 6 . Compared with the control group, the mRNA expression level of each gene in the naked dsRNA treatment group decreased by 15.8%-31.9%, and the mRNA expression level of each gene in the dsRNA preparation group decreased by 54.5%-79.3%, which was significantly different from the control group and the naked dsRNA group. The results fully show that the nanoparticle preparation carrier prepared by chitosan can greatly enhance the silencing effect of dsRNA on the target gene and more effectively inhibit the expression of the target gene. Figure 6 The results in Table 6 were obtained by ANOVA for significant difference analysis of each group, wherein the same letter indicates that there is no significant difference between groups, and different letters indicate that there is a significant difference between groups (P<0.05).

[0182] After 5 days of treatment, the survival rate of the brown planthopper in each group was determined, and the results are shown in Figure 7 . The survival rate of the brown planthopper in the control group was between 82.7% and 86.4%. In comparison, the survival rate of the brown planthopper in the naked dsRNA group decreased, while the survival rate of the brown planthopper in the dsRNA preparation group significantly decreased. Among them, the survival rate of the brown planthopper treated with the nanoparticle preparation of target 6 was 11.6%, and the control effect of target 3 was better, and the survival rate of the brown planthopper was only 7.2%. Figure 7 The results in Table 7 were obtained by ANOVA for significant difference analysis of each group, wherein the same letter indicates that there is no significant difference between groups, and different letters indicate that there is a significant difference between groups (P<0.01).

[0183] Example 8: Comparison of the effects of dsRNA preparation and conventional chemical pesticides

[0184] To comprehensively evaluate the control effect of the dsRNA preparation, the control effect of the conventional chemical pesticide acetamiprid and the dsRNA preparation targeting the target 3 on the brown planthopper was compared in the embodiment. An acetamiprid solution with a concentration of 50 mg / L was prepared, and a dsRNA preparation with a concentration of 500 mg / L was prepared according to the method of embodiment 7, and the seedling dipping method of embodiment 7 was used to treat the brown planthopper nymphs to determine the survival rate.

[0185] As shown in Figure 8 the survival rate of the brown planthopper in the acetamiprid treatment group and the dsRNA preparation treatment group was reduced to only 9.3% and 16.3%, respectively, which was significantly lower than that of the control group (P < 0.01), but the survival rate difference between the acetamiprid treatment group and the dsRNA preparation treatment group was not significant (P > 0.05). Figure 8 The results in Table 1 were obtained by ANOVA for significant difference analysis of each group, wherein the same letter indicates that the difference between groups is not significant, and different letters indicate that the difference between groups is significant (P < 0.01). The above results show that the control effect of the dsRNA preparation on the brown planthopper is comparable to that of the conventional chemical pesticide acetamiprid, although the dsRNA preparation has the significant advantage of being green and pollution-free compared to traditional chemical pesticides such as acetamiprid. It can be seen that RNA biological control of the brown planthopper is a highly efficient and potentially effective control method in the field of agricultural pest control in the future.

[0186] The present application has at least one of the following beneficial effects:

[0187] 1. Compared with traditional chemical pesticides, the dsRNA provided by the present application as a biological pesticide has the characteristics of high efficiency, specificity, fast degradation and no residue, and achieves the prevention and control of the brown planthopper through the mechanism of RNAi, which helps to reduce the use of chemical pesticides, improve the quality of agricultural products, meet the needs of consumers for green and pollution-free food, and open up a new path for the sustainable development of agriculture.

[0188] 2. The present application provides a new brown planthopper target gene as a target for RNA interference. As can be seen from the survival rate, these genes play an important role in the survival process of the brown planthopper and are effective targets for the prevention and control of the brown planthopper using gene silencing methods, which have broad application prospects. Accordingly, the present application provides a plurality of dsRNA sequences targeting these targets, some of which exhibit unprecedented control efficiency of the brown planthopper. These dsRNAs can accurately interfere with the key genes of the brown planthopper, thereby effectively inhibiting its reproduction and survival and reducing damage to crops; compared with the dsRNA of the prior art, the dsRNA sequence provided by the present application has better control effect, which is conducive to reducing the amount of dsRNA used, thereby reducing the control cost and creating favorable conditions for the popularization and application of nucleic acid pesticides.

[0189] 3. At present, most of the researches use in vitro transcription kit method to synthesize a small amount of dsRNA, and the present application uses Escherichia coli fermentation to produce dsRNA, and high-purity dsRNA is obtained through positive pressure-bell type double filtration and alcohol gradient precipitation. The method is low in cost, simple in operation, can realize large-scale production, breaks the limitation of traditional production mode, and provides a feasible scheme for industrialized production of dsRNA.

[0190] 4. The present application uses a kind of nanoparticle carrier, which can quickly penetrate the body wall of pests, efficiently enter the living cells, realize higher dsRNA delivery efficiency and gene interference effect. This kind of nanoparticle carrier provides new technical reserves for RNA preparation research and development and pest control.

Claims

1. A double-stranded RNA against a hemipteran insect, characterized in that, The double-stranded RNA against the hemipteran insect comprises a sense strand and an antisense strand, wherein: the sense strand has a nucleotide sequence as shown in SEQ ID NO: 9, and the antisense strand has a nucleotide sequence as shown in SEQ ID NO: 10; the sense strand has a nucleotide sequence as shown in SEQ ID NO: 11, and the antisense strand has a nucleotide sequence as shown in SEQ ID NO: 12; or the sense strand has a nucleotide sequence as shown in SEQ ID NO: 13, and the antisense strand has a nucleotide sequence as shown in SEQ ID NO:

14.

2. An expression vector, characterized by, The expression vector comprises the sense strand or the antisense strand of the double-stranded RNA against the hemipteran insect according to claim 1.

3. A host cell, characterized in that, The host cell comprises the sense strand or the antisense strand of the double-stranded RNA against the hemipteran insect according to claim 1, or the expression vector according to claim 2.

4. A method for preparing the double-stranded RNA against the hemipteran insect according to claim 1, comprising expression using the expression vector according to claim 2, or expression using the host cell according to claim 3.

5. The method of claim 4, wherein, The method comprises the following steps: S1: extracting RNA from the brown planthopper; S2: reverse transcribing cDNA using the RNA from the brown planthopper as a template; S3: amplifying the target sequence by PCR using the cDNA as a template; S4: cloning the target sequence into a plasmid to obtain a recombinant plasmid vector; S5: transforming the recombinant plasmid vector into competent cells, and taking the competent cells transformed with the recombinant plasmid vector as host cells; S6: culturing the host cells, inducing the host cells to express the double-stranded RNA against the hemipteran insect using an inducing agent, and obtaining a fermentation broth; S7: purifying the double-stranded RNA against the hemipteran insect in the fermentation broth.

6. The method of claim 5, wherein, In step S7, the purifying step comprises: S7-1: fermentation broth pretreatment; S7-2: positive pressure-bell jar double filtration; S7-3: ethanol gradient precipitation.

7. A pesticidal composition, characterized by, The pesticide composition comprises an effective amount of the double-stranded RNA against the hemipteran insect according to claim 1, and a pharmaceutically acceptable carrier.

8. The pesticidal composition according to claim 7, wherein The carrier is a chitosan nanoparticle.

9. A process for the preparation of a pesticidal composition as claimed in claim 7 or 8, characterized in that, The method comprises adding the double-stranded RNA against the hemipteran insect according to claim 1 and a pharmaceutically acceptable carrier to a solvent.

10. The method of claim 9, wherein, The method comprises the following steps: S1: dissolving chitosan in an acetic acid buffer to obtain a chitosan acetic acid solution, and dissolving dsRNA in a sodium sulfate solution to obtain a dsRNA sodium sulfate solution; S2: slowly adding the dsRNA sodium sulfate solution to the chitosan acetic acid solution, thoroughly mixing, incubating, vortexing after incubation, and obtaining a chitosan nanoparticle preparation of dsRNA.

11. Use of the double-stranded RNA against the hemipteran insect according to claim 1 in the control of the brown planthopper.

12. Use of the pesticide composition according to claim 7 or 8 in the control of the brown planthopper.

Images