SiRNA (small interfering Ribonucleic Acid) for targeting INHBE gene expression as well as conjugate and application of siRNA

Abstract

The invention provides siRNA (small interfering Ribonucleic Acid) for targeting INHBE gene expression as well as a conjugate and application of the siRNA. The invention belongs to the technical field of biological medicine. Specifically, the invention provides a siRNA (small interfering Ribonucleic Acid) for inhibiting expression of an statin subunit beta E (INHBE) gene and a conjugate thereof, and the siRNA comprises a positive-sense strand and an antisense strand. The antisense strand comprises at least 17 contiguous nucleotides which are different from the nucleotide sequences as shown in SEQ ID NO: 299 to SEQ ID NO: 595, SEQ ID NO: 751 to SEQ ID NO: 904 and SEQ ID NO: 909 to SEQ ID NO: 911 by not more than 4 nucleotides, and the length of the antisense strand is 17 to 30 nucleotides; the length of the positive-sense strand is 17-30 nucleotides, and the positive-sense strand is at least partially complementary to the antisense strand. The siRNA, the siRNA conjugate and the pharmaceutical composition provided by the invention have good stability, excellent INHBE gene inhibition activity, and satisfactory cytotoxicity and immunostimulation.

Description

Technical Field

[0001] This invention relates to an siRNA that inhibits the expression of the inhibin subunit βE (INHBE) gene, its conjugates, pharmaceutical compositions, and their use in the treatment of metabolic and / or cardiovascular diseases. Background Technology

[0002] Inhibin subunite βE (INHBE) is composed of INHBE The gene encodes a member of the transforming growth factor β (TGF-β) superprotein family. The proprotein, translated from the gene expression, undergoes proteolytic processing to produce the inhibin βE subunit. INHBE is closely related to lipid metabolism regulation. INHBE protein expression exhibits high tissue specificity; after expression in liver tissue, it is secreted into the bloodstream, where it binds to activin receptor-like kinase 7 (ALK7) on adipocytes, activating transcription factors Smad2 / 3 and initiating the expression of a series of genes, promoting lipid storage and accumulation.

[0003] Increasing evidence suggests that the biological function and high expression of INHBE play a driving role in diseases such as obesity, type 2 diabetes mellitus (T2DM), insulin resistance, and lipid metabolism disorders. A study that included exon sequences from 360,000 individuals and identified genetic variants associated with lower levels of abdominal obesity (Nat Commun 2022; 13, 4319) showed that loss-of-function mutations in INHBE were associated with improved fat distribution, manifested as a lower body mass index corrected for waist-to-hip ratio (WHRadjBMI). Elevated levels of 3-hydroxybutyrate and ketone bodies in the blood of individuals with loss-of-function mutations in INHBE indicated increased lipidolysis. Loss-of-function mutations in INHBE were associated with a reduced risk of T2DM and coronary heart disease (CHD), suggesting that INHBE inactivation contributes to improved glucose and lipid metabolism. Another study examining liver biopsy samples from humans with varying degrees of insulin resistance found that liver expression levels of INHBE mRNA were positively correlated with human insulin resistance and body mass index (PLos One 2018; 13(3): e0194798). Obese individuals have three times the blood INHBE protein level compared to normal individuals. Higher INHBE expression levels are also associated with elevated liver triglyceride levels. Furthermore, animal studies have shown that, compared to wild-type mice, systemic INHBE knockout mice are resistant to high-fat diet (HFD)-induced weight gain, exhibit significantly increased blood levels of the lipolysis product β-hydroxybutyrate, and show increased levels of lipidolysis-related genes (including...) in visceral adipose tissue. Atgl, Cgi-58) expression level. Reducing the expression of INHBE by siRNA can also reduce HFD-induced body weight in mice and increase muscle volume ratio, while food intake does not change. Therefore, INHBE is a potential therapeutic target for obesity and complications of metabolic disorders such as T2DM, CHD and chronic diseases.

[0004] A statistical study covering 158 million Chinese adult subjects showed that according to the body mass index (BMI) classification standard, the overweight population (BMI = 24-28) accounted for about 34.8%, and the obese population (BMI ≥ 28) accounted for about 14.1% (Diabetes Obes Metab. 2023; 25(11):3390-3399). Compared with normal BMI population, the prevalence of metabolic complications in overweight / obese people is higher, and common complications include fatty liver, prediabetes, dyslipidemia and hypertension; body fat levels, especially visceral fat levels, are positively correlated with the risk of T2DM, coronary artery disease (CAD), etc. In the elderly population, overweight and obesity also increase the risk of age-related diseases. Clinical recommendations for the treatment of obesity include changing unhealthy lifestyles, drug therapy, and bariatric surgery. In recent years, new approved incretin-based T2DM and obesity treatment drugs such as semaglutide have shown clear weight loss and glucose-lowering efficacy, and can also bring multiple metabolic-related clinical benefits such as liver fat reduction and liver steatosis improvement, and have become increasingly essential drugs for the treatment of obesity and T2DM and other metabolic diseases. However, it also has the disadvantages of causing significant muscle mass loss during weight loss, limiting central dopamine secretion levels, causing gastrointestinal adverse reactions, and even increasing the risk of intestinal obstruction, and there have been reports of weight rebound after drug discontinuation, which forms new unmet clinical needs in the field of obesity and related metabolic complications treatment. Developing new weight loss drugs that can maintain muscle mass during rapid weight loss, prevent muscle loss, maintain food intake to support the body's nutrition, and achieve long-term sustained weight loss and prevent rebound will be the key to future clinical management of obesity and related metabolic complications.

[0005] The present application provides a small interfering RNA (siRNA) preparation targeting INHBE, which can specifically bind to the mRNA of INHBE, destroy the normal translation template function of INHBE mRNA, and thus prevent the translation of INHBE protein, inhibit the secretion of INHBE protein from the liver and its regulatory effect on lipid metabolism in adipose tissue, and then achieve the purpose of treating obesity and related metabolic complications by increasing lipid decomposition.

[0006] Compared with traditional drugs, the stability of siRNA is poor, and the systemic administration has the disadvantage of being easily degraded by nucleases; in addition, it is also necessary to try to further improve the activity while avoiding the side effects of off-target effects, immune stimulation, cytotoxicity, etc. Therefore, it is an urgent problem to be solved to develop more candidate siRNAs which are stable in blood, have good biological activity, low cytotoxicity and can long-term inhibit the expression of INHBE gene; at the same time, it is necessary and realistic to develop weight loss drugs with high efficiency and long-term effect using the above-mentioned candidate siRNAs which can inhibit the expression of INHBE gene. SUMMARY

[0007] The present application provides a kind of siRNA for inhibiting the expression of INHBE gene, the siRNA includes sense strand and antisense strand;Wherein, the antisense strand includes at least 17 continuous nucleotides of the nucleotide sequence shown in any one of SEQ ID NO: 299~SEQ ID NO:595, SEQ ID NO: 751~SEQ ID NO: 904, SEQ ID NO: 909~SEQ ID NO: 911, difference is not more than 4 nucleotides, the antisense strand length is 17~30 nucleotides;The sense strand length is 17~30 nucleotides, and is complementary with antisense strand at least partially.

[0008] The at least partial complementarity means that the two sequences can be completely complementary, or not more than 5, 4, 3 or 2 mismatched base pairs in total, while retaining the ability to hybridize under the relevant conditions.

[0009] In some embodiments of the application, the antisense strand differs by no more than 4 nucleotides from any of the nucleotide sequences set forth in SEQ ID NO: 299~SEQ ID NO: 595, SEQ ID NO: 751~SEQ ID NO: 904, SEQ ID NO: 909~SEQ ID NO: 911; in some embodiments of the application, the antisense strand differs by no more than 3 nucleotides from any of the nucleotide sequences set forth in SEQ ID NO: 299~SEQ ID NO: 595, SEQ ID NO: 751~SEQ ID NO: 904, SEQ ID NO: 909~SEQ ID NO: 911; in some embodiments of the application, the antisense strand differs by no more than 2 nucleotides from any of the nucleotide sequences set forth in SEQ ID NO: 299~SEQ ID NO: 595, SEQ ID NO: 751~SEQ ID NO: 904, SEQ ID NO: 909~SEQ ID NO: 911; in some embodiments of the application, the antisense strand differs by no more than 1 nucleotide from any of the nucleotide sequences set forth in SEQ ID NO: 299~SEQ ID NO: 595; in some embodiments of the application, the antisense strand is any of the nucleotide sequences set forth in SEQ ID NO: 299~SEQ ID NO: 595, SEQ ID NO: 751~SEQ ID NO: 904, SEQ ID NO: 909~SEQ ID NO: 911.

[0010] In some embodiments of the application, the sense strand has no more than 3 nucleotide mismatches with the antisense strand; in some embodiments of the application, the sense strand has no more than 2 nucleotide mismatches with the antisense strand; in some embodiments of the application, the sense strand has no more than 1 nucleotide mismatch with the antisense strand; in some embodiments of the application, the sense strand is completely complementary to the antisense strand.

[0011] Preferably, the sense strand has at least 15, 16, 17, 18, 19, 20, or 21 nucleotides of complementarity with the antisense strand.

[0012] In some embodiments of the application, the antisense strand is 19~27 nucleotides in length; the sense strand is 19~25 nucleotides in length.

[0013] In some embodiments of the application, the antisense strand is 19~23 nucleotides in length; the sense strand is 19~21 nucleotides in length.

[0014] In some embodiments of the application, the antisense strand is 23 nucleotides in length and the sense strand is 21 nucleotides in length. In some embodiments of the application, the antisense strand is 22 nucleotides in length and the sense strand is 20 nucleotides in length. In some embodiments of the application, the antisense strand is 21 nucleotides in length and the sense strand is 21 nucleotides in length. In some embodiments of the application, the antisense strand is 21 nucleotides in length and the sense strand is 19 nucleotides in length. In some embodiments of the application, the antisense strand is 19 nucleotides in length and the sense strand is 19 nucleotides in length.

[0015] In some embodiments of the application, the siRNA comprises one or more single-stranded nucleotide overhangs. For example, 1, 2, 3, or 4 nucleotide overhangs. In some embodiments of the application, the overhangs can be on the sense strand, the antisense strand, or any combination thereof. In some embodiments of the application, the overhangs are present on the 5' end, the 3' end, or both ends of the antisense strand or the sense strand of the siRNA.

[0016] In some embodiments of the application, the antisense strand of the siRNA has a 2 nucleotide overhang at the 3' end.

[0017] In some embodiments of the application, the siRNA has blunt ends. In some embodiments of the application, the siRNA has at least one blunt end, at the 5' end of the antisense strand (or the 3' end of the sense strand).

[0018] In some embodiments of the application, the siRNA has two blunt ends.

[0019] In some embodiments of the application, the nucleotide sequence (5'→3') of the siRNA is selected from the group consisting of duplex 1 through duplex 297: Table 1. Sense and antisense sequences of unmodified siRNA duplexes

[0020] In some embodiments of the present application, the siRNA comprises at least one modified nucleotide.

[0021] In some embodiments of the present application, all of the nucleotides in the sense strand and / or the antisense strand of the siRNA are modified nucleotides or nucleotide analogs.

[0022] In some embodiments of the present application, the modified nucleotide is selected from the group consisting of 2'-methoxy nucleotide, 2'-fluoro nucleotide, 2'-deoxy nucleotide, 2',3'-seco nucleotide analog, 2'-fluoro arabinonucleotide, 2'-methoxyethyl nucleotide, 2'-amino modified nucleotide, 2'-alkyl modified nucleotide, 3'-methoxy nucleotide, 2'-allyl modified nucleotide, nucleotide comprising phosphorothioate group, nucleotide comprising methylphosphonate group, nucleotide comprising 5'-phosphate, nucleotide comprising 5'-phosphate mimic, glycol modified nucleotide, abasic nucleotide, morpholino nucleotide, threose nucleotide, locked nucleotide, unlocked nucleotide, glycerol nucleotide, or base modified nucleotide.

[0023] In some embodiments of the present application, the antisense strand of the siRNA is 23 nucleotides in length, wherein the 2nd, 6th, 14th, and 16th positions from the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; and the sense strand of the siRNA is 21 nucleotides in length, wherein the 7th, 9th, 10th, and 11th positions from the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0024] In some embodiments of the present application, the antisense strand of the siRNA is 23 nucleotides in length, wherein the 2nd, 6th, 8th, 9th, 14th, and 16th positions from the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; and the sense strand of the siRNA is 21 nucleotides in length, wherein the 7th, 9th, 10th, and 11th positions from the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0025] In some embodiments of the present application, the antisense strand of the siRNA is 23 nucleotides in length, wherein the 2nd, 6th, 14th, and 16th positions from the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; and the sense strand of the siRNA is 21 nucleotides in length, wherein the 9th, 10th, and 11th positions from the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0026] In some embodiments of the invention, the antisense strand of the siRNA is 23 nucleotides in length, wherein the 2nd, 6th, 8th, 9th, 10th, 14th, 16th positions from the 5' end of the antisense strand are 2'-fluoro nucleotides and the remaining positions are 2'-methoxy nucleotides; and the sense strand of the siRNA is 21 nucleotides in length, wherein the 7th, 9th, 10th, 11th positions from the 5' end of the sense strand are 2'-fluoro nucleotides and the remaining positions are 2'-methoxy nucleotides.

[0027] In some embodiments of the invention, the antisense strand of the siRNA is 23 nucleotides in length, wherein the 2nd, 6th, 8th, 9th, 10th, 14th, 16th positions from the 5' end of the antisense strand are 2'-fluoro nucleotides and the remaining positions are 2'-methoxy nucleotides; and the sense strand of the siRNA is 21 nucleotides in length, wherein the 7th, 9th, 10th, 11th, 15th positions from the 5' end of the sense strand are 2'-fluoro nucleotides and the remaining positions are 2'-methoxy nucleotides.

[0028] In some embodiments of the invention, the antisense strand of the siRNA is 23 nucleotides in length, wherein the 2nd, 6th, 8th, 9th, 10th, 14th, 16th positions from the 5' end of the antisense strand are 2'-fluoro nucleotides and the remaining positions are 2'-methoxy nucleotides; and the sense strand of the siRNA is 21 nucleotides in length, wherein the 7th, 9th, 10th, 11th, 15th positions from the 5' end of the sense strand are 2'-fluoro nucleotides and the remaining positions are 2'-methoxy nucleotides.

[0029] In some embodiments of the invention, the antisense strand of the siRNA is 23 nucleotides in length, wherein the 2nd, 6th, 8th, 9th, 10th, 14th, 16th positions from the 5' end of the antisense strand are 2'-fluoro nucleotides and the remaining positions are 2'-methoxy nucleotides; and the sense strand of the siRNA is 21 nucleotides in length, wherein the 7th, 9th, 10th, 11th, 15th positions from the 5' end of the sense strand are 2'-fluoro nucleotides and the remaining positions are 2'-methoxy nucleotides.

[0030] In some embodiments of the invention, the antisense strand of the siRNA is 23 nucleotides in length, wherein the 2nd, 6th, 8th, 9th, 10th, 14th, 16th positions from the 5' end of the antisense strand are 2'-fluoro nucleotides and the remaining positions are 2'-methoxy nucleotides; and the sense strand of the siRNA is 21 nucleotides in length, wherein the 7th, 9th, 10th, 11th, 15th positions from the 5' end of the sense strand are 2'-fluoro nucleotides and the remaining positions are 2'-methoxy nucleotides.

[0031] In some embodiments of the application, the antisense strand of the siRNA is 23 nucleotides in length, wherein the 2nd, 4th, 5th, 6th, 8th, 10th, 14th, 16th, 18th, 20th, 22nd position from the 5' end of the antisense strand is a 2'-fluoro nucleotide and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 21 nucleotides in length, wherein the 2nd position from the 5' end of the sense strand is a 2'-fluoro nucleotide and the remaining positions are 2'-methoxy nucleotides.

[0032] In some embodiments of the application, the antisense strand of the siRNA is 23 nucleotides in length, wherein the 2nd, 4th, 6th, 7th, 8th, 10th, 14th, 16th, 18th, 20th, 22nd position from the 5' end of the antisense strand is a 2'-fluoro nucleotide and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 21 nucleotides in length, wherein the 2nd position from the 5' end of the sense strand is a 2'-fluoro nucleotide and the remaining positions are 2'-methoxy nucleotides.

[0033] In some embodiments of the application, the antisense strand of the siRNA is 23 nucleotides in length, wherein the 2nd, 4th, 6th, 8th, 10th, 14th, 16th, 18th, 20th, 22nd position from the 5' end of the antisense strand is a 2'-fluoro nucleotide and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 21 nucleotides in length, wherein the 2nd position from the 5' end of the sense strand is a 2'-fluoro nucleotide and the remaining positions are 2'-methoxy nucleotides.

[0034] In some embodiments of the application, the antisense strand of the siRNA is 23 nucleotides in length, wherein the 2nd, 4th, 6th, 8th, 10th, 14th, 16th, 18th, 20th, 22nd position from the 5' end of the antisense strand is a 2'-fluoro nucleotide and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 21 nucleotides in length, wherein the 2nd position from the 5' end of the sense strand is a 2'-fluoro nucleotide and the remaining positions are 2'-methoxy nucleotides.

[0035] In some embodiments of the application, the antisense strand of the siRNA is 23 nucleotides in length, wherein the 2nd, 4th, 6th, 8th, 10th, 14th, 16th, 18th, 20th, 22nd position from the 5' end of the antisense strand is a 2'-fluoro nucleotide and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 21 nucleotides in length, wherein the 2nd position from the 5' end of the sense strand is a 2'-fluoro nucleotide and the remaining positions are 2'-methoxy nucleotides.

[0036] In some embodiments of the application, the antisense strand of the siRNA is 23 nucleotides in length, wherein the 2nd, 5th, 7th, 12thpositions from the 5' end of the antisense strand are 2'-deoxynucleotides, the 6th, 8th, 9th, 10th, 14th, 16thpositions are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides. In some embodiments of the application, the sense strand of the siRNA is 21 nucleotides in length, wherein the 7th, 9th, 10th, 11thpositions from the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0037] In some embodiments of the application, the antisense strand of the siRNA is 23 nucleotides in length, wherein the 2nd, 5th, 8th, 12th, 14th, 16thpositions from the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides. In some embodiments of the application, the sense strand of the siRNA is 21 nucleotides in length, wherein the 9th, 10th, 11thpositions from the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0038] In some embodiments of the application, the antisense strand of the siRNA is 23 nucleotides in length, wherein the 2nd, 5th, 7th, 12th, 14th, 16thpositions from the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides. In some embodiments of the application, the sense strand of the siRNA is 21 nucleotides in length, wherein the 9th, 10th, 11thpositions from the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0039] In some embodiments of the application, the antisense strand of the siRNA is 23 nucleotides in length, wherein the 2nd, 5th, 8th, 12th, 14th, 16thpositions from the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides. In some embodiments of the application, the sense strand of the siRNA is 21 nucleotides in length, wherein the 7th, 9th, 10th, 11thpositions from the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0040] In some embodiments of the application, the antisense strand of the siRNA is 23 nucleotides in length, wherein the 2nd, 5th, 7th, 12th, 14th, 16thpositions from the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides. In some embodiments of the application, the sense strand of the siRNA is 21 nucleotides in length, wherein the 7th, 9th, 10th, 11thpositions from the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0041] In some embodiments of the application, the antisense strand of the siRNA is 23 nucleotides in length, wherein the 2nd, 5th, 12th, 14th, 16th positions from the 5' end of the antisense strand are 2'-fluoro nucleotides and the remaining positions are 2'-methoxy nucleotides. In some embodiments of the application, the sense strand of the siRNA is 21 nucleotides in length, wherein the 9th, 10th, 11th positions from the 5' end of the sense strand are 2'-fluoro nucleotides and the remaining positions are 2'-methoxy nucleotides.

[0042] In some embodiments of the application, the antisense strand of the siRNA is 23 nucleotides in length, wherein the 2nd, 5th, 12th, 14th, 16th positions from the 5' end of the antisense strand are 2'-fluoro nucleotides and the remaining positions are 2'-methoxy nucleotides. In some embodiments of the application, the sense strand of the siRNA is 21 nucleotides in length, wherein the 7th, 9th, 10th, 11th positions from the 5' end of the sense strand are 2'-fluoro nucleotides and the remaining positions are 2'-methoxy nucleotides.

[0043] In some embodiments of the application, the antisense strand of the siRNA is 23 nucleotides in length, wherein the 2nd, 7th, 12th, 14th, 16th positions from the 5' end of the antisense strand are 2'-fluoro nucleotides and the remaining positions are 2'-methoxy nucleotides. In some embodiments of the application, the sense strand of the siRNA is 21 nucleotides in length, wherein the 9th, 10th, 11th positions from the 5' end of the sense strand are 2'-fluoro nucleotides and the remaining positions are 2'-methoxy nucleotides.

[0044] In some embodiments of the application, the antisense strand of the siRNA is 23 nucleotides in length, wherein the 2nd, 7th, 12th, 14th, 16th positions from the 5' end of the antisense strand are 2'-fluoro nucleotides and the remaining positions are 2'-methoxy nucleotides. In some embodiments of the application, the sense strand of the siRNA is 21 nucleotides in length, wherein the 7th, 9th, 10th, 11th positions from the 5' end of the sense strand are 2'-fluoro nucleotides and the remaining positions are 2'-methoxy nucleotides.

[0045] In some embodiments of the application, the antisense strand of the siRNA is 23 nucleotides in length, wherein the 2nd, 12th, 14th, 16th positions from the 5' end of the antisense strand are 2'-fluoro nucleotides, the 5th, 7th positions are 2'-deoxy nucleotides and the remaining positions are 2'-methoxy nucleotides. In some embodiments of the application, the sense strand of the siRNA is 21 nucleotides in length, wherein the 7th, 9th, 10th, 11th positions from the 5' end of the sense strand are 2'-fluoro nucleotides and the remaining positions are 2'-methoxy nucleotides.

[0046] In some embodiments of the application, the antisense strand of the siRNA is 23 nucleotides in length, wherein the 2nd, 14th, 16th positions from the 5' end of the antisense strand are 2'-fluoro nucleotides, the 5th, 7th positions are 2'-deoxy nucleotides, and the remaining positions are 2'-methoxy nucleotides. In some embodiments of the application, the sense strand of the siRNA is 21 nucleotides in length, wherein the 7th, 9th, 10th, 11th positions from the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0047] In some embodiments of the application, the antisense strand of the siRNA is 21 nucleotides in length, wherein the 2nd, 6th, 14th, 16th positions from the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; and the sense strand of the siRNA is 21 nucleotides in length, wherein the 5th, 7th, 9th positions from the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0048] In some embodiments of the application, the antisense strand of the siRNA is 21 nucleotides in length, wherein the 2nd, 6th, 14th, 16th positions from the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; and the sense strand of the siRNA is 21 nucleotides in length, wherein the 7th, 9th, 10th, 11th positions from the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0049] In some embodiments of the application, the antisense strand of the siRNA is 21 nucleotides in length, wherein the 2nd, 4th, 6th, 8th, 10th, 12th, 14th, 16th, 18th, 20th positions from the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; and the sense strand of the siRNA is 21 nucleotides in length, wherein the 9th, 10th, 11th positions from the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0050] In some embodiments of the application, the antisense strand of the siRNA is 21 nucleotides in length, wherein the 2nd, 4th, 6th, 8th, 10th, 12th, 14th, 16th, 18th, 20th positions from the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; and the sense strand of the siRNA is 21 nucleotides in length, wherein the 1st, 3rd, 5th, 7th, 9th, 11th, 13th, 15th, 17th, 19th, 21st positions from the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0051] In some embodiments of the present application, the antisense strand of the siRNA is 21 nucleotides in length, wherein the 2nd, 6th, 14th, 16th positions from the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 19 nucleotides in length, wherein the 7th, 8th, 9th positions from the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0052] In some embodiments of the present application, the antisense strand of the siRNA is 19 nucleotides in length, wherein the 2nd, 4th, 6th, 8th, 10th, 12th, 14th, 16th, 18th positions from the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 19 nucleotides in length, wherein the 7th, 8th, 9th positions from the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0053] In some embodiments of the present application, the antisense strand of the siRNA is 23 nucleotides in length, wherein the 14th position from the 5' end of the antisense strand is a 2'-fluoro nucleotide, the 2nd, 5th, 7th positions are 2'-deoxy nucleotides, the 12th position is a threose nucleotide, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 21 nucleotides in length, wherein the 9th, 10th, 11th positions from the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0054] In some embodiments of the present application, the antisense strand of the siRNA is 23 nucleotides in length, wherein the 2nd, 6th, 14th, 16th positions from the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 21 nucleotides in length, wherein the 9th, 10th, 11th positions from the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0055] In some embodiments of the present application, the antisense strand of the siRNA is 23 nucleotides in length, wherein the 2nd, 6th, 14th, 16th positions from the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 21 nucleotides in length, wherein the 9th, 10th, 11th positions from the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0056] In some embodiments of the present application, the antisense strand of the siRNA is 23 nucleotides in length, wherein the 2nd, 6th, 14th, 16th from the 5' end of the antisense strand are 2'-fluoro nucleotides, the 23rd is a threose nucleotide, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 21 nucleotides in length, wherein the 9th, 10th, 11th from the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0057] In some embodiments of the present application, the antisense strand of the siRNA is 22 nucleotides in length, wherein the 2nd, 6th, 14th, 16th from the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 20 nucleotides in length, wherein the 8th, 9th, 10th from the 5' end of the sense strand are 2'-fluoro nucleotides, the 1st is a threose nucleotide, and the remaining positions are 2'-methoxy nucleotides.

[0058] In some embodiments of the present application, the antisense strand of the siRNA is 22 nucleotides in length, wherein the 2nd, 6th, 14th, 16th from the 5' end of the antisense strand are 2'-fluoro nucleotides, the 21st is a threose nucleotide, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 20 nucleotides in length, wherein the 8th, 9th, 10th from the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0059] In some embodiments of the present application, the antisense strand of the siRNA is 22 nucleotides in length, wherein the 2nd, 6th, 14th, 16th from the 5' end of the antisense strand are 2'-fluoro nucleotides, the 22nd is a threose nucleotide, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 20 nucleotides in length, wherein the 8th, 9th, 10th from the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0060] In some embodiments of the present application, the antisense strand of the siRNA is 22 nucleotides in length, wherein the 2nd, 6th, 14th, 16th from the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 20 nucleotides in length, wherein the 8th, 9th, 10th from the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0061] In some embodiments of the present application, the antisense strand of the siRNA is 22 nucleotides in length, wherein the 2nd, 6th, 14th, 16th from the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 20 nucleotides in length, wherein the 6th, 8th, 9th, 10th from the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0062] In some embodiments of the present application, the antisense strand of the siRNA is 22 nucleotides in length, wherein the 2nd, 6th, 14th, 16th from the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 20 nucleotides in length, wherein the 8th, 9th, 10th from the 5' end of the sense strand are 2'-fluoro nucleotides, the 6th is a 2'-deoxy nucleotide, and the remaining positions are 2'-methoxy nucleotides.

[0063] In some embodiments of the present application, the antisense strand of the siRNA is 22 nucleotides in length, wherein the 2nd, 6th, 8th, 9th, 14th, 16th from the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 20 nucleotides in length, wherein the 6th, 8th, 9th, 10th from the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0064] In some embodiments of the present application, the antisense strand of the siRNA is 21 nucleotides in length, wherein the 2nd, 6th, 14th, 16th from the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 19 nucleotides in length, wherein the 7th, 8th, 9th from the 5' end of the sense strand are 2'-fluoro nucleotides, the 1st is a threose nucleotide, and the remaining positions are 2'-methoxy nucleotides.

[0065] In some embodiments of the present application, the antisense strand of the siRNA is 21 nucleotides in length, wherein the 2nd, 6th, 14th, 16th from the 5' end of the antisense strand are 2'-fluoro nucleotides, the 20th is a threose nucleotide, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 19 nucleotides in length, wherein the 7th, 8th, 9th from the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0066] In some embodiments of the present application, the antisense strand of the siRNA is 21 nucleotides in length, wherein the 2nd, 6th, 14th, 16thfrom the 5' end of the antisense strand are 2'-fluoro nucleotides, the 21stis a threose nucleotide, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 19 nucleotides in length, wherein the 7th, 8th, 9thfrom the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0067] In some embodiments of the present application, the antisense strand of the siRNA is 21 nucleotides in length, wherein the 2nd, 6th, 12th, 14th, 16thfrom the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 19 nucleotides in length, wherein the 7th, 8th, 9thfrom the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0068] In some embodiments of the present application, the antisense strand of the siRNA is 21 nucleotides in length, wherein the 2nd, 5th, 12th, 14th, 16thfrom the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 19 nucleotides in length, wherein the 7th, 8th, 9thfrom the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0069] In some embodiments of the present application, the antisense strand of the siRNA is 21 nucleotides in length, wherein the 2nd, 7th, 12th, 14th, 16thfrom the 5' end of the antisense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 19 nucleotides in length, wherein the 7th, 8th, 9thfrom the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0070] In some embodiments of the present application, the antisense strand of the siRNA is 21 nucleotides in length, wherein the 2nd, 12th, 14th, 16thfrom the 5' end of the antisense strand are 2'-fluoro nucleotides, the 5this a 2'-deoxy nucleotide, and the remaining positions are 2'-methoxy nucleotides; the sense strand of the siRNA is 19 nucleotides in length, wherein the 7th, 8th, 9thfrom the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0071] In some embodiments of the present application, the antisense strand of the siRNA is 21 nucleotides in length, wherein the 2nd, 12th, 14th, 16th from the 5' end of the antisense strand are 2'-fluoro nucleotides, the 5th is a 2'-deoxy nucleotide, and the remaining positions are 2'-methoxy nucleotides; and the sense strand of the siRNA is 19 nucleotides in length, wherein the 7th, 8th, 9th from the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0072] In some embodiments of the present application, the antisense strand of the siRNA is 21 nucleotides in length, wherein the 2nd, 12th, 14th, 16th from the 5' end of the antisense strand are 2'-fluoro nucleotides, the 5th is a 2'-deoxy nucleotide, and the remaining positions are 2'-methoxy nucleotides; and the sense strand of the siRNA is 19 nucleotides in length, wherein the 7th, 9th, 11th from the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0073] In some embodiments of the present application, the antisense strand of the siRNA is 21 nucleotides in length, wherein the 2nd, 12th, 14th, 16th from the 5' end of the antisense strand are 2'-fluoro nucleotides, the 7th is a 2'-deoxy nucleotide, and the remaining positions are 2'-methoxy nucleotides; and the sense strand of the siRNA is 19 nucleotides in length, wherein the 7th, 9th, 11th from the 5' end of the sense strand are 2'-fluoro nucleotides, and the remaining positions are 2'-methoxy nucleotides.

[0074] In some embodiments of the present application, the modified nucleotide is a nucleotide in which the phosphate group is modified to a phosphorothioate group. That is, the non-bridge oxygen atom in the phosphodiester bond is replaced with a sulfur atom, so that the phosphodiester bond is replaced with a phosphorothioate diester bond.

[0075] In some embodiments of the present application, the 5' end and the 3' end of the sense strand independently comprise 0, 1 or 2 phosphorothioate group linkages, respectively; and / or the 5' end and the 3' end of the antisense strand independently comprise 1 or 2 phosphorothioate group linkages, respectively.

[0076] In some embodiments of the application, at least one of the linkages between the nucleotides at positions 1 and 2, between the nucleotides at positions 2 and 3, between the nucleotides at positions 1 and 2, between the nucleotides at positions 2 and 3, between the nucleotides at positions 1 and 2, between the nucleotides at positions 2 and 3, between the nucleotides at positions 1 and 2, and between the nucleotides at positions 2 and 3 of the 5' end of the sense strand, of the 3' end of the sense strand, of the 5' end of the antisense strand, and of the 3' end of the antisense strand is a phosphorothioate linkage; preferably, at least four of the linkages are phosphorothioate linkages; in some embodiments of the application, at least six of the linkages are phosphorothioate linkages; in some embodiments of the application, all eight of the linkages are phosphorothioate linkages.

[0077] In some embodiments of the application, the linkages between the nucleotides at positions 1 and 2, and between the nucleotides at positions 2 and 3 of the 5' end of the sense strand are phosphorothioate linkages.

[0078] In some embodiments of the application, the linkages between the nucleotides at positions 1 and 2, and between the nucleotides at positions 2 and 3 of the 5' end of the sense strand are phosphorothioate linkages, and the linkages between the nucleotides at positions 1 and 2, and between the nucleotides at positions 2 and 3 of the 3' end of the sense strand are phosphorothioate linkages.

[0079] In some embodiments of the application, the linkages between the nucleotides at positions 1 and 2, and between the nucleotides at positions 2 and 3 of the 5' end of the sense strand are phosphorothioate linkages, and the linkages between the nucleotides at positions 1 and 2, and between the nucleotides at positions 2 and 3 of the 3' end of the sense strand are phosphorothioate linkages.

[0080] In some embodiments of the application, all of the linkages between the nucleotides at positions 1 and 2, between the nucleotides at positions 2 and 3 of the 5' end of the sense strand, between the nucleotides at positions 1 and 2, between the nucleotides at positions 2 and 3 of the 3' end of the sense strand, between the nucleotides at positions 1 and 2, between the nucleotides at positions 2 and 3 of the 5' end of the antisense strand, and between the nucleotides at positions 1 and 2, between the nucleotides at positions 2 and 3 of the 3' end of the antisense strand are phosphorothioate linkages.

[0081] In some embodiments of the application, the sense strand can include one or more capping residues or moieties, referred to as "capping residues." A "capping residue" is a non-nucleotide compound or other moiety that can be incorporated into one or more termini of a nucleotide sequence of an siRNA. In some embodiments of the application, a capping residue is present at the 5' terminus, the 3' terminus, or both the 5' terminus and the 3' terminus of the sense strand.

[0082] In some embodiments of the application, an inverted abasic residue (invAb) is added as a capping residue. See F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16. In some embodiments of the application, the 5' end and / or the 3' end of the sense strand can comprise more than one inverted abasic deoxyribonucleoside moiety as a capping residue.

[0083] In some embodiments of the application, one or more inverted abasic residues (invAb) are added to the 3' end of the sense strand. In some embodiments of the application, one or more inverted abasic residues (invAb) are added to the 5' end of the sense strand. In some embodiments of the application, one or more inverted abasic residues can be inserted between the targeting ligand and the nucleotide sequence of the sense strand of the siRNA. In some embodiments of the application, one or more inverted abasic residues are included at or near one or more ends of the sense strand of the siRNA.

[0084] In some embodiments of the application, one or more inverted abasic residues (invAb) are added to the 5' end of the sense strand. In some embodiments of the application, one or more inverted abasic residues can be inserted between the targeting ligand and the nucleotide sequence of the sense strand of the siRNA.

[0085] The inverted abasic residue can be linked to the nucleic acid via a phosphodiester linkage, a phosphorothioate linkage, etc.

[0086] In some embodiments of the application, the first nucleotide at the 5' end of the antisense strand is selected from the following structures:

[0087] wherein Base is a base A, U, G, C, T or other modified base.

[0088] In some embodiments of the application, the first nucleotide at the 5' end of the antisense strand is an (E)-vinylphosphonate modified nucleotide.

[0089] In some embodiments of the application, the siRNA comprises at least one base-modified nucleotide.

[0090] In some embodiments of the application, the base of the base-modified nucleotide is selected from the following structures:

[0091] In some embodiments of the application, the base-modified nucleotide can be at the 5th, 6th, 7th, 8th position of the antisense strand of the siRNA.

[0092] In some embodiments of the application, the base-modified nucleotide can be located at a single-stranded nucleotide overhang in the siRNA.

[0093] Preferably, the siRNA antisense strand contains a 2-nucleotide overhang, and the base-modified nucleotide is the first nucleotide of the siRNA antisense strand overhang.

[0094] Preferably, the siRNA antisense strand contains a 2-nucleotide overhang, and the base-modified nucleotide is the second nucleotide of the siRNA antisense strand overhang.

[0095] For the modified siRNA duplexes listed in the following table, the sense strand of each modified siRNA duplex corresponds to one of SEQ ID NO: 2 to SEQ ID NO: 298, SEQ ID NO: 596 to SEQ ID NO 750, SEQ ID NO: 906 to SEQ ID NO 908, before modification, and the antisense strand corresponds to one of SEQ ID NO: 299 to SEQ ID NO: 595, SEQ ID NO: 751 to SEQ ID NO: 905, SEQ ID NO: 909 to SEQ ID NO: 911, before modification.

[0096] As used herein, "modified siRNA duplex" refers to a siRNA duplex comprising modifications. It is specifically noted that the numbering X in "modified siRNA duplex X" and "unmodified siRNA duplex X" do not necessarily correspond. Accordingly, and unless otherwise specified, the modified siRNA duplexes provided herein are selected from, for example, modified siRNA duplex 1 to modified siRNA duplex 297 provided in Table 2, and the unmodified siRNA duplexes of the application are selected from, for example, duplex 1 to duplex 297 and duplex 298 to duplex 455 provided in Table 1.

[0097] In some embodiments of the application, the nucleotide sequence (5'→3') of the modified siRNA is selected from the group consisting of modified duplex 1 to modified duplex 297 in Table 2: Table 2, sense strand sequence and antisense strand sequence of modified siRNA duplex

[0098] The present application also provides siRNA conjugates obtained by conjugating the above-mentioned siRNA with a conjugating molecule.

[0099] In the present application, unless otherwise specified, "conjugation" refers to the connection between two or more chemical moieties through covalent linkage; "conjugate" refers to a compound formed by covalent linkage between chemical moieties; and "siRNA conjugate" refers to a compound formed by covalent linkage of one or more chemical moieties to siRNA. It is noted here that each chemical moiety can be directly linked to siRNA or linked to siRNA through a linker.

[0100] In the present application, unless otherwise specified, the "-" in "linker-targeting ligand" refers to the covalent linkage between the linker and the targeting ligand.

[0101] In some embodiments of the present application, the targeting ligand is linked to siRNA through a linker to form a conjugating molecule.

[0102] In some embodiments of the present application, the targeting ligand is linked to siRNA through a linker to form a conjugating molecule, which is independently or simultaneously linked to the 3' end or 5' end of the sense strand of siRNA.

[0103] In some embodiments of the present application, the siRNA of the present application can be conjugated with a pharmaceutically acceptable conjugating molecule to obtain siRNA conjugates. In some embodiments of the present application, the siRNA is covalently conjugated to the conjugating molecule. To reduce the possible impact of conjugation on the activity of siRNA, the conjugation site of siRNA and the conjugating molecule can be at the 3' end or 5' end of the sense strand of siRNA, or at the 5' end of the antisense strand. In some embodiments, the conjugation site of siRNA and the conjugating molecule can also be in the internal sequence of siRNA.

[0104] The pharmaceutically acceptable targeting ligand can be a targeting ligand conventionally used in the field of siRNA administration, such as, but not limited to, one or more of the following targeting ligands or derivatives thereof: a lipophilic molecule, such as cholesterol, bile acid, a vitamin (e.g., vitamin E), a lipid molecule of different chain length; a polymer, such as polyethylene glycol; a polypeptide, such as a transmembrane peptide; an aptamer; an antibody; a quantum dot; a saccharide, such as lactose, poly-lactose, mannose, galactose, N-acetylgalactosamine (GalNAc); folate; or a receptor ligand expressed by hepatocytes, such as an asialoglycoprotein, an asialoglycan residue, a lipoprotein (e.g., high-density lipoprotein, low-density lipoprotein, etc.), a glucagon, a neurotransmitter (e.g., adrenaline), a growth factor, a transferrin, etc.

[0105] In some embodiments of the present application, the targeting ligand is N-acetylgalactosamine.

[0106] In some embodiments of the present application, the targeting ligand is directly linked to the 3' end of the sense strand of the siRNA.

[0107] In some embodiments of the present application, the targeting ligand is directly linked to the 5' end of the sense strand of the siRNA.

[0108] In some embodiments of the present application, the targeting ligand is linked to the 3' end of the sense strand of the siRNA via a linker.

[0109] In some embodiments of the present application, the targeting ligand is linked to the 5' end of the sense strand of the siRNA via a linker.

[0110] In some embodiments of the present application, the targeting ligand is N-acetylgalactosamine, which is linked to the 3' end of the sense strand of the siRNA via a linker.

[0111] In some embodiments of the present application, the targeting ligand is GalNAc(L96), which has the following structure:

[0112] In some embodiments of the present application, GalNAc(L96) is linked to the 3' end of the sense strand of the siRNA.

[0113] In some embodiments of the present application, GalNAc(L96) is linked to the 5' end of the sense strand of the siRNA.

[0114] In some embodiments of the present application, GalNAc(L96) is linked to the 3' end of the sense strand of the siRNA via an inverted abasic residue (invAb).

[0115] In some embodiments of the application, GalNAc(L96) is attached to the inverted abasic residue (invAb) at the 5' end of the sense strand of the siRNA.

[0116] In some embodiments of the application, the targeting ligand is Ser(GN), having the following structure:

[0117] In some embodiments of the application, Ser(GN) is attached to the 3' end of the sense strand of the siRNA. In some embodiments of the application, Ser(GN) is attached to the 5' end of the sense strand of the siRNA.

[0118] In some embodiments of the application, Ser(GN) is attached to both the 3' end and the 5' end of the sense strand of the siRNA.

[0119] In some embodiments of the application, the GalNAc targeting ligand LP-GalNAc structure (attached at the 5'-end of the sense strand) is as follows:

[0120] In some embodiments of the application, the GalNAc targeting ligand structure XY-GalNAc (attached at the 3-’end of the sense strand) is as follows: or

[0121] In some embodiments of the application, other GalNAc targeting ligand structures used (attached at the 5'-end of the sense strand) are as follows:

[0122] In some embodiments of the application, other GalNAc targeting ligand structures used (attached at the 3'-end of the sense strand) are as follows:

[0123] For the modified siRNA conjugates listed in the table below, the base sequence of the sense strand of each modified siRNA conjugate before modification corresponds to one of SEQ ID NO: 2 to SEQ ID NO: 298, SEQ ID NO: 596 to SEQ ID NO: 750, SEQ ID NO: 906 to SEQ ID NO: 908 listed above, and the base sequence of the antisense strand before modification corresponds to one of SEQ ID NO: 299 to SEQ ID NO: 595, SEQ ID NO: 751 to SEQ ID NO: 904, SEQ ID NO: 909 to SEQ ID NO: 911 listed above.

[0124] As used herein, "modified siRNA conjugate" (or "conjugate") refers to an siRNA conjugate obtained by conjugating a modified siRNA double strand with a conjugate molecule. It should be noted that there is no necessary correspondence between "modified siRNA conjugate X" (or "conjugate X") and the number X in "modified siRNA double strand X" or "unmodified siRNA double strand X". For example, "modified siRNA conjugate 237" (or "conjugate 237") does not necessarily correspond to "modified siRNA double strand 237" or "unmodified siRNA double strand 237". In other words, "modified siRNA conjugate 237" does not refer to a double strand obtained by modifying or conjugating "modified siRNA double strand 237" or "unmodified siRNA double strand 237". Correspondingly, unless otherwise specified, the modified siRNA conjugates provided in this invention are selected from, for example, modified siRNA conjugates 1 to 256 provided in Table 3.

[0125] In some embodiments of the present invention, the siRNA conjugate is selected from conjugate 1 to conjugate 256: Table 3. Sequences of modified siRNA conjugates

[0126] The structure characterization method and results of the modified duplexes, conjugates are shown in Table 3b, 3c: LC-MS representative test method: when the test sample is detected by denaturing IP RP-LC, the complementary paired double strands are separated into single strands (sense strand and antisense strand), and then the parent ions of the sense / antisense strands are gas-phase fragmented by tandem mass spectrometry. The software CONFIRM Sequence is used to analyze all detected fragment ions and resolve them. The sequence of the test sample is consistent with the theoretical sequence, that is, the actual molecular weight (MW) deviates from the theoretical molecular weight (MW) by less than 5 parts per million. The results are shown in Table 3b, 3c.

[0127] Table 3b Molecular weight (MW) of modified duplexes

[0128] Table 3c Molecular weight (MW) of conjugates

[0129] The present application also provides a pharmaceutical composition comprising any of the above siRNAs and / or any of the above siRNA conjugates and a pharmaceutically acceptable carrier.

[0130] In some embodiments, the pharmaceutically acceptable carrier is a delivery carrier. A delivery carrier is a substance that improves the delivery of a nucleic acid or oligonucleotide to a cell or tissue. Such substances can be any delivery carrier known in the art that can be suitable for nucleic acid or oligonucleotide delivery, including but not limited to: viruses (retrovirus, adenovirus, lentivirus, baculovirus, AAV); liposomes (Lipofectamine, cationic DOTAP, neutral DOPC); nanoparticles (cationic polymers, PEI); bacteria (tkRNAi); lipid nanoparticles (LNP); neutral liposomes (NL); polymeric nanoparticles (low molecular weight polymers or high molecular weight polymers); double-stranded RNA binding motifs (dsRBMs), etc.

[0131] In some embodiments, the siRNA can be encapsulated by the delivery carrier.

[0132] In some embodiments of the present application, the pharmaceutical composition contains one siRNA according to the first aspect. In other embodiments of the present application, the pharmaceutical composition contains at least two siRNAs (for example, but not limited to, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) according to the first aspect as active ingredients. Preferably, the at least two siRNAs according to the first aspect each target a different target sequence in the INHBE gene, whereby a synergistic effect can be expected from simultaneous action on different target sequences. Here, by "different target sequences" is meant that there is no overlap between the target sequences, or that the number of consecutive nucleotides that overlap between the target sequences is less than 5 (for example, the number of consecutive nucleotides that overlap is 4, 3, 2, 1, 0). In this case, the at least two siRNAs according to the first aspect can be present in any different ratio. Preferably, the at least two siRNAs according to the first aspect can be present in a molar ratio of 1:100 to 100:1 with respect to each other; more preferably, the at least two siRNAs according to the first aspect can be present in a molar ratio of 1:10 to 10:1, 1:5 to 5:1, or 1:2 to 2:1 with respect to each other. In some embodiments of the present application, the at least two siRNAs according to the first aspect are present in the same molar ratio.

[0133] The present application also provides the use of any of the above-mentioned siRNAs and / or any of the above-mentioned siRNA conjugates and / or the above-mentioned pharmaceutical composition in the preparation of a medicament for treating a pathological condition or disease associated with the expression of the INHBE gene.

[0134] Further, the pathological condition or disease is a metabolic disease and / or a cardiovascular disease. Further preferably, the metabolic disease is obesity, type 2 diabetes mellitus (T2DM), insulin resistance, lipodystrophy, fatty liver disease, non-alcoholic fatty liver disease (NAFLD) or metabolic dysfunction-associated fatty liver disease (MAFLD), non-alcoholic steatohepatitis (NASH) or metabolic dysfunction-associated steatohepatitis (MASH); the cardiovascular disease is hyperlipidemia or dyslipidemia, atherosclerosis, cardiomyopathy, heart failure or coronary heart disease (CHD).

[0135] The siRNAs, siRNA conjugates and pharmaceutical compositions provided by the present application have good stability, excellent INHBE gene inhibition activity, satisfactory cytotoxicity and immunostimulatory activity, and can significantly reduce body fat levels, body weight and improve metabolic abnormalities.

[0136] The sequence of the INHBE gene targeted by the siRNA in the present application is shown in SEQ ID NO: 1: SEQ ID NO: 1 (INHBE gene) 1 AGTAGCCAGA CATGAGCTGT GAGGGTCAAG CACAGCTATC CATCAGATGA TCTACTTTCA 61 GCCTTCCTGA GTCCCAGACA ATAGAAGACA GGTGGCTGTA CCCTTGGCCA AGGGTAGGTG 121 TGGCAGTGGT GTCTGCTGTC ACTGTGCCCT CATTGGCCCC CAGCAATCAG ACTCAACAGA 181 CGGAGCAACT GCCATCCGAG GCTCCTGAAC CAGGGCCATT CACCAGGAGC ATGCGGCTCC 241 CTGATGTCCA GCTCTGGCTG GTGCTGCTGT GGGCACTGGT GCGAGCACAG GGGACAGGGT 301 CTGTGTGTCC CTCCTGTGGG GGCTCCAAAC TGGCACCCCA AGCAGAACGA GCTCTGGTGC 361 TGGAGCTAGC CAAGCAGCAA ATCCTGGATG GGTTGCACCT GACCAGTCGT CCCAGAATAA 421 CTCATCCTCC ACCCCAGGCA GCGCTGACCA GAGCCCTCCG GAGACTACAG CCAGGGAGTG 481 TGGCTCCAGG GAATGGGGAG GAGGTCATCA GCTTTGCTAC TGTCACAGAC TCCACTTCAG 541 CCTACAGCTC CCTGCTCACT TTTCACCTGT CCACTCCTCG GTCCCACCAC CTGTACCATG 601 CCCGCCTGTG GCTGCACGTG CTCCCCACCC TTCCTGGCAC TCTTTGCTTG AGGATCTTCC 661 GATGGGGACC AAGGAGGAGG CGCCAAGGGT CCCGCACTCT CCTGGCTGAG CACCACATCA 721 CCAACCTGGG CTGGCATACC TTAACTCTGC CCTCTAGTGG CTTGAGGGGT GAGAAGTCTG 781 GTGTCCTGAA ACTGCAACTA GACTGCAGAC CCCTAGAAGG CAACAGCACA GTTACTGGAC 841 AACCGAGGCG GCTCTTGGAC ACAGCAGGAC ACCAGCAGCC CTTCCTAGAG CTTAAGATCC 901 GAGCCAATGA GCCTGGAGCA GGCCGGGCCA GGAGGAGGAC CCCCACCTGT GAGCCTGCGA 961 CCCCCTTATG TTGCAGGCGA GACCATTACG TAGACTTCCA GGAACTGGGA TGGCGGGACT 1021 GGATACTGCA GCCCGAGGGG TACCAGCTGA ATTACTGCAG TGGGCAGTGCCCTCCCCACC 1081 TGGCTGGCAG CCCAGGCATT GCTGCCTCTT TCCATTCTGC CGTCTTCAGCCTCCTCAAAG 1141 CCAACAATCC TTGGCCTGCC AGTACCTCCT GTTGTGTCCC TACTGCCCGAAGGCCCCTCT 1201 CTCTCCTCTA CCTGGATCAT AATGGCAATG TGGTCAAGAC GGATGTGCCAGATATGGTGG 1261 TGGAGGCCTG TGGCTGCAGC TAGCAAGAGG ACCTGGGGCT TTGGAGTGAAGAGACCAAGA 1321 TGAAGTTTCC CAGGCACAGG GCATCTGTGA CTGGAGGCAT CAGATTCCTGATCCACACCC 1381 CAACCCAACA ACCACCTGGC AATATGACTC ACTTGACCCC TATGGGACCCAAATGGGCAC 1441 TTTCTTGTCT GAGACTCTGG CTTATTCCAG GTTGGCTGAT GTGTTGGGAG ATGGGTAAAG 1501 CGTTTCTTCT AAAGGGGTCT ACCCAGAAAG CATGATTTCC TGCCCTAAGTCCTGTGAGAA 1561 GATGTCAGGG ACTAGGGAGG GAGGGAGGGA AGGCAGAGAA AAATTACTTAGCCTCTCCCA 1621 AGATGAGAAA GTCCTCAAGT GAGGGGAGGA GGAAGCAGAT AGATGGTCCAGCAGGCTTGA 1681 AGCAGGGTAA GCAGGCTGGC CCAGGGTAAG GGCTGTTGAG GTACCTTAAGGGAAGGTCAA 1741 GAGGGAGATG GGCAAGGCGC TGAGGGAGGA TGCTTAGGGG ACCCCCAGAAACAGGAGTCA 1801 GGAAAATGAG GCACTAAGCC TAAGAAGTTC CCTGGTTTTT CCCAGGGGACAGGACCCACT 1861 GGGAGACAAG CATTTATACT TTCTTTCTTC TTTTTTATTT TTTTGAGATCGAGTCTCGCT 1921 CTGTCACCAG GCTGGAGTGC AGTGACACGA TCTTGGCTCA CTGCAACCTCCGTCTCCTGG 1981 GTTCAAGTGA TTCTTCTGCC TCAGCCTCCC GAGCAGCTGG GATTACAGGCGCCCACTAAT 2041 TTTTGTATTC TTAGTAGAAA CGAGGTTTCA ACATGTTGGC CAGGATGGTCTCAATCTCTT 2101 GACCTCTTGA TCCACCCGAC TTGGCCTCCC GAAGTGATGA GATTATAGGCGTGAGCCACC 2161 GCGCCTGGCT TATACTTTCT TAATAAAAAG GAGAAAGAAA ATCAACAAAT GTGAGTCATA 2221 AAGAAGGGTT AGGGTGATGG TCCAGAGCAA CAGTTCTTCA AGTGTACTCT GTAGGCTTCT 2281 GGGAGGTCCC TTTTCAGGGG TGTCCACAAA GTCAAAGCTA TTTTCATAATA ATACTAACA 2341 TGTTATTTGC CTTTTGAATT CTCATTATCT TAAAATTGTA TTGTGGAGTT TTCCAGAGGC 2401 CGTGTGACAT GTGATTACAT CATCTTTCTG ACATCATTGT TAATGGAAT GTGTGCTTGTA

[0137] "siRNA" as used herein refers to an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that is capable of reducing or inhibiting the translation of a messenger RNA (mRNA) in a sequence-specific manner. The siRNA can function through an RNA interference mechanism (e.g., by inducing mRNA degradation through interaction with the mRNA interference pathway machinery of a mammalian cell (the RNA-induced silencing complex, RISC)), or any other mechanism or pathway. While it is believed that the siRNA agents used in the present application function primarily through an RNA interference mechanism, the siRNA agents are not limited or restricted to any particular mechanism or pathway of action. siRNA agents include, but are not limited to, single-stranded antisense oligonucleotides, short interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and dicer substrates. The siRNA agents described herein are comprised of an oligonucleotide strand that is at least partially complementary to the mRNA that is the target. In some embodiments, the siRNA agents described herein are double-stranded and are comprised of an antisense strand and a sense strand that is at least partially complementary to the antisense strand.

[0138] The term "sequence" or "nucleotide sequence" refers to the order or succession of nucleobases or nucleotides, represented in alphabetical order using standard nucleotide nomenclature.

[0139] In the present application, capital letters C, G, U, A, T represent the base composition of nucleotides: C (cytosine), G (guanine), U (uracil), A (adenine), T (thymine), including modified and unmodified nucleotides; lowercase letter m represents that the nucleotide adjacent to the right of the mark m is a 2'-methoxy nucleotide; lowercase letter f represents that the nucleotide adjacent to the right of the mark f is a 2'-fluoro nucleotide; lowercase letter d represents that the nucleotide adjacent to the right of the mark d is a 2'-deoxy nucleotide; the mark * represents that the two nucleotides adjacent to the left and right of the mark * are connected by phosphorothioate group; eVP represents that the nucleotide adjacent to the right of eVP is an (E)-vinyl phosphate modified nucleotide; invAb represents an inverted dealkylated residue; L96 refers to the conjugation of the targeting ligand GalNAc (L96) at this position; Ser(GN) refers to the conjugation of the targeting ligand Ser(GN) at this position; A1GN refers to the conjugation of the targeting ligand A1GN at this position.

[0140] In the present application, ln applied without special instructions is locked nucleic acid, cEt is 2'-O-ethyl bridged nucleic acid, and the structure is as follows:

[0141] wherein Base is base A, U, G, 5mC, T or other modified base.

[0142] wherein " represents the connection of the oligonucleotide at this position to the rest of the oligonucleotide by phosphodiester bond or phosphorothioate bond.

[0143] In the present application, the term "complementary" refers to the ability of an oligonucleotide of a first sequence to hybridize and form a duplex structure with an oligonucleotide of a second sequence under certain conditions. "At least partially complementary" means that the two sequences can be completely complementary, or have no more than 5, 4, 3, or 2 mismatched base pairs in total, while retaining the ability to hybridize under the relevant conditions. In addition, where the two oligonucleotides are designed to hybridize with one or more single-stranded overhangs, such overhangs should not be considered mismatches for purposes of determining complementarity. In the present application, "complementary" sequences can also include or be formed entirely from non-Watson-Crick base pairs and / or base pairs formed from non-natural and modified nucleotides, to the extent that the above hybridization ability is met. Such non-Watson-Crick base pairs include, but are not limited to, G:U wobble base pairing or Hoogstein base pairing. Correspondingly, in the present application, "mismatch" refers to the non-complementary pairing of bases at the corresponding position in the siRNA duplex molecule, without special instructions.​

[0144] In the present application, unless otherwise specified, "difference in nucleotide sequence" means that the base type of a nucleotide at the same or corresponding position is changed compared to the original nucleotide sequence. For example, when one nucleotide base in the original nucleotide sequence is A, and the nucleotide base at the same or corresponding position is changed to U, C, G, or dT, dC, dG, etc., it is considered that there is a difference in nucleotide sequence at that position. It is noted that, when the nucleotide at the same or corresponding position is only different in the presence or type of modification compared to the original nucleotide sequence, it is not considered that there is a difference in nucleotide sequence at that position. For example, when one nucleotide base in the original nucleotide sequence is U, and the nucleotide at the same or corresponding position is dT or other base-modified nucleotide (such as I, m6A, X, B), it is not considered that there is a difference in nucleotide sequence at that position.

[0145] In the present application, unless otherwise specified, the term "pharmaceutically acceptable" means that the carrier, vehicle, diluent, adjuvant, and / or salt / ester / hydrate thereof, etc. is generally chemically or physically compatible with other ingredients constituting a certain pharmaceutical dosage form, and is physiologically compatible with the recipient.

[0146] In the present application, unless otherwise specified, the term "inhibition" means that the expression of a target gene is down-regulated due to siRNA-mediated degradation of the mRNA of the target gene. The "down-regulation" means that the expression level of the target gene is decreased by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% or even 100% compared to the case without siRNA treatment. Among them, the decrease of the expression level of the target gene by 100% means that there is no detectable level of expression of the target gene.

[0147] In the present application, the siRNA can also contain modified nucleotides as needed, which do not cause a significant impairment or loss of the function of the siRNA in inhibiting the expression of the INHBE gene. At present, there are various ways to modify siRNA in the art, including, for example, backbone modification (such as modification of phosphate groups), ribose group modification, and base modification, etc. (Watts, J.K., G.F. Deleavey, and M.J. Damha, Nat Rev Drug Discov, 2008. 7(9): p. 750-62; Watts, J.K., G.F. Deleavey, and M.J. Damha, Drug Discov Today, 2008. 13(19-20): p. 842-55). Chemically modified siRNA: tools and applications. Drug Discov Today, 2008. 13(19-20): p. 842-55).

[0148] Obviously, according to the above content of the present application, according to the ordinary technical knowledge and means in the art, other various forms of modifications, replacements or changes can be made without departing from the above basic technical idea of the present application.

[0149] The above content of the present application will be further explained in detail through the following specific embodiments in the form of examples. However, it should not be understood that the scope of the above subject matter of the present application is limited to the following examples. Any technology realized based on the above content of the present application belongs to the scope of the present application.

[0150] In the present application, the following embodiments are also involved: Embodiment 1: An siRNA for inhibiting the expression of INHBE gene, characterized in that the siRNA comprises a sense strand and an antisense strand; wherein the antisense strand comprises at least 17 continuous nucleotides differing no more than 4 nucleotides from the nucleotide sequence shown in any one of SEQ ID NO: 299~SEQ ID NO: 595, SEQ ID NO: 751~SEQ ID NO: 904, SEQ ID NO: 909~SEQ ID NO: 911, and the length of the antisense strand is 17~30 nucleotides; the length of the sense strand is 17~30 nucleotides, and the sense strand is at least partially complementary to the antisense strand.

[0151] Embodiment 2: The siRNA according to embodiment 1, characterized in that the length of the antisense strand is 19~27 nucleotides; the length of the sense strand is 19~25 nucleotides.

[0152] Embodiment 3: The siRNA according to embodiment 1, characterized in that the antisense strand differs no more than 4 nucleotides from any one of the nucleotide sequences shown in SEQ ID NO: 299~SEQ ID NO: 595, SEQ ID NO: 751~SEQ ID NO: 904, SEQ ID NO: 909~SEQ ID NO: 911.

[0153] Embodiment 4: The siRNA according to embodiment 1, characterized in that the sense strand has no more than 3 nucleotide mismatches with the antisense strand.

[0154] Embodiment 5: The siRNA according to embodiments 1~4, characterized in that the sequence of the siRNA is selected from duplex 1~duplex 297 and duplex 298~duplex 455 shown in Table 1.

[0155] Embodiment 6: The siRNA according to any one of embodiments 1~5, characterized in that the siRNA contains at least one modified nucleotide.

[0156] Embodiment 7: The siRNA according to embodiment 6, wherein all nucleotides in the sense strand and / or the antisense strand of the siRNA are modified nucleotides or nucleotide analogs.

[0157] Embodiment 8: The siRNA according to embodiment 7, wherein the modified nucleotides are selected from 2'-methoxy nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2', 3'-seco nucleotide analogs, 2'-fluoro-arabinonucleotides, 2'-methoxyethyl nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, 3'-methoxy nucleotides, 2'-allyl modified nucleotides, nucleotides comprising phosphorothioate groups, nucleotides comprising methylphosphonate groups, nucleotides comprising 5'-phosphate esters, nucleotides comprising 5'-phosphate ester mimics, glycol modified nucleotides, abasic nucleotides, morpholino nucleotides, locked nucleotides, unlocked nucleotides, threose nucleotides, or glycerol nucleotides.

[0158] Embodiment 9: The siRNA according to any one of embodiments 1-8, wherein the 5' end and the 3' end of the sense strand independently comprise 0, 1 or 2 phosphorothioate group linkages, respectively; and / or the 5' end and the 3' end of the antisense strand independently comprise 1 or 2 phosphorothioate group linkages, respectively.

[0159] Embodiment 10: The siRNA according to any one of embodiments 6-9, wherein the siRNA is selected from the group consisting of modified duplexes 1-297 as shown in Table 2.

[0160] Embodiment 11: The siRNA according to any one of embodiments 1-10, wherein the first nucleotide at the 5' end of the antisense strand is an (E)-vinylphosphonate modified nucleotide, and / or the 5' end and / or the 3' end of the sense strand optionally comprises a capping residue (e.g. invAb).

[0161] Embodiment 12: The siRNA according to any one of embodiments 1-11, wherein the siRNA comprises at least one base modified nucleotide.

[0162] Embodiment 13: An siRNA conjugate of the siRNA according to any one of embodiments 1-12 conjugated to a conjugating molecule.

[0163] Embodiment 14: The siRNA conjugate according to embodiment 13, wherein the targeting ligand is optionally linked to the 3' end or the 5' end of the sense strand of the siRNA, independently or simultaneously, via a linker forming the conjugating molecule.

[0164] Embodiment 15: The siRNA conjugate according to Embodiment 14, characterized in that the targeting ligand is GalNAc(L96) or Ser(GN), or GalNAc(Ser1), GalNAc(Ser2), GalNAc(Ser3), GalNAc(Ser4), or LP-GalNAc, XY-GalNAc, GalNAc(A1GN), GalNAc(A1dGN), GalNAc(A3GN), GalNAc(A3dGN), GalNAc(A5GN), GAlNAc(NAG25), GAlNAc(NAG37), wherein GalNAc(L96) has the following structure:

[0165] Ser(GN) can have the following structure:

[0166] GalNAc(Ser1), GalNAc(Ser2), GalNAc(Ser3), GalNAc(Ser4) have the following structures, respectively:

[0167] LP-GalNAc has the following structure:

[0168] XY-GalNAc has the following structure: or

[0169] GalNAc(A1GN), GalNAc(A1dGN), GalNAc(A3GN), GalNAc(A3dGN), GalNAc(A5GN), GAlNAc(NAG25), GAlNAc(NAG37) have the following structures, respectively:

[0170] the targeting ligand moiety is attached to the 3' end of the siRNA sense strand, or to the 5' end of the siRNA sense strand, or to the inverted abasic residue (invAb) at the 3' end of the siRNA sense strand, or to the inverted abasic residue (invAb) at the 5' end of the siRNA sense strand, or one or more of the targeting ligand moieties are attached to the 3' end of the siRNA sense strand, to the 5' end of the siRNA sense strand, to the inverted abasic residue (invAb) at the 3' end of the siRNA sense strand, to the inverted abasic residue (invAb) at the 5' end of the siRNA sense strand;

[0171] Preferably, the targeting ligand GalNAc (L96) or Ser(GN) is attached to the 3' end of the siRNA sense strand or to the 5' end of the siRNA sense strand; Ser(GN) can be attached to the 3' end and to the 5' end of the siRNA sense strand simultaneously, one or several;

[0172] More preferably, the targeting ligand GalNAc (L96) is attached to the 3' end of the siRNA sense strand.

[0173] Embodiment 16: The siRNA conjugate according to embodiments 14-15, characterized in that the siRNA conjugate is selected from the group consisting of conjugate 1 to conjugate 256 as shown in Table 3.

[0174] Embodiment 17: A pharmaceutical composition, characterized in that it comprises the siRNA according to any one of embodiments 1-12 and / or the siRNA conjugate according to any one of embodiments 13-16 and a pharmaceutically acceptable carrier.

[0175] Embodiment 18: Use of the siRNA according to any one of embodiments 1-12 and / or the siRNA conjugate according to any one of embodiments 13-16 and / or the pharmaceutical composition according to embodiment 17 for the manufacture of a medicament for the treatment and / or prevention of a pathological condition or disease associated with overexpression of the INHBE gene.

[0176] Embodiment 19: Use according to embodiment 18, characterized in that the pathological condition or disease is a metabolic disease and / or a cardiovascular disease; further preferably, the metabolic disease is obesity, type 2 diabetes mellitus (T2DM), insulin resistance, lipodystrophy, fatty liver disease, non-alcoholic fatty liver disease (NAFLD) or metabolic dysfunction-associated fatty liver disease (MAFLD), non-alcoholic steatohepatitis (NASH) or metabolic dysfunction-associated steatohepatitis (MASH); the cardiovascular disease is hyperlipidemia or dyslipidemia, atherosclerosis, cardiomyopathy, heart failure or coronary heart disease (CHD).

[0177] Beneficial effects: The siRNA and its conjugates of the present invention have good to excellent in vitro INHBE gene expression inhibitory activity. They can effectively inhibit the level of INHBE mRNA in a variety of cell lines, have satisfactory immunostimulatory properties, no obvious off-target effects, and can significantly reduce the expression of INHBE mRNA in animal levels with good persistence. Attached Figure Description

[0178] Figure 1 The stability of conjugates 3 and 244 against 3' exonucleases was demonstrated.

[0179] Figure 2 Display using 100nM ( Figure 2 -A) and 10 nM ( Figure 2 -B) Volcano plot of differentially expressed genes (DEGs) between different groups in human primary hepatocytes (PHH) treated with conjugate 3. Detailed Implementation

[0180] Those skilled in the art will recognize that the siRNA described in this invention can be obtained using conventional siRNA preparation methods (e.g., solid-phase synthesis and liquid-phase synthesis), both of which are commercially available custom-made services. Those skilled in the art will also understand that modified nucleotide groups can be introduced into the siRNA described in this invention using appropriately modified nucleotide monomers. Methods for preparing appropriately modified nucleotide monomers are well known to those skilled in the art, and commercially available monomers are also available.

[0181] Example 1: siRNA Synthesis For the sense and antisense strands of the siRNA sequence of the present invention, as well as the sense and antisense strands of the modified double strands, deoxynucleoside CPG is used as a solid support; the sense strand is synthesized using the solid support, and the antisense strand is synthesized using universal CPG.

[0182] Sequence synthesis was performed using a 48-channel synthesizer at a scale of 0.2 μmol. The phosphoramide monomer was used at a concentration of 0.05 M, and the activator was 0.3 M BTT.

[0183] Sequence cutting and deprotection were performed in 1.5 ml tubes. The first step used AMA, followed by deprotection of the second-position protecting group using triethylamine trifluoride. For sequences containing all modifications at the second position, ammonia hydrolysis was performed. The cut and deprotected sequences were precipitated using an acetone:ethanol (80:20) mixture and dissolved in RNase-free water. Sequence accuracy was determined by LC-MS, quantification by spectrophotometry, and purity was determined by HPLC.

[0184] After HPLC purification, freeze-drying and quality inspection, the siRNA was salted out with sodium acetate alcohol, desalted with a 3KD ultrafiltration tube, and the positive and negative strands were quantified by spectrophotometer after desalination. The siRNA duplex was formed by mixing and annealing at a ratio of 1:1.

[0185] Example 2: In vitro activity detection-Hep3B cell transfection Cell culture and transfection Cell culture: Hep3B cells (ATCC) were cultured at 37°C in a 5% CO2 environment using MEM complete medium (Gibco, added with 10% FBS) until near confluence, then the cells were trypsinized and plated using a 12-well plate, 2.0 x 10 5 Hep3B cells and 1.0 mL of MEM complete medium (Gibco, added with 10% FBS) per well, and then transfection was performed after 16-24h of culture at 37°C in a 5% CO2 environment.

[0186] Cell transfection: 1.5 μL of lipofectamine RNAiMax (Invitrogen) was added to 48.5 μL of opti-MEM per well, then 50 μL of siRNA was added for mixing, the siRNA mixture was added to a PCR tube and incubated at room temperature for 5 minutes, and finally the siRNA mixture was added to the above-mentioned cells and cultured for 24h before RNA extraction. The experiment was performed at 10nM and 0.1nM, or 5nM, 1nM and 0.2nM, or 1nM and 0.2nM siRNA concentrations.

[0187] RNA extraction The total RNA isolation kit (omega company, cat: R6834-02) was used: the cells were collected, washed with 1% PBS, then lysed with 400 μL of lysis buffer (containing 2% β-mercaptoethanol), and the subsequent steps were performed according to the RNA isolation kit instructions. Finally, 30 μL of RNase-free water was added, and after standing for 2 minutes, the RNA was collected by centrifugation at 14000g for 2 minutes.

[0188] cDNA synthesis The total RNA was added with 1 μg of gDNA removal cDNA synthesis kit (Beijing Geneseed Biotech Co., Ltd., Beijing, China Cat# AE311-03). The gradient thermal cycler (LongGene, A600) was used to perform cDNA synthesis according to the instructions.

[0189] Real-time fluorescent quantitative PCR The synthesized cDNA and mixed mother liquor (containing primers, qPCR premix and ultrapure water) were added to the 384-well plate (BioKan Cat# PC-0040-9U) to make the final real-time fluorescent quantitative PCR system containing 0.25 μM of each primer upstream and downstream of the target gene (INHBE) or the reference gene (GADPH), 1x SYBR Green premix (Applied Biosystem Cat# A25742).

[0190] Real-time fluorescent PCR was performed in ABI QuantStudio™ 6 Real-time Fluorescent PCR System using ΔΔCt determination method. Each duplex was tested 3-4 times independently, and each transfection was determined in triplicate.

[0191] wherein the Pc is the following sequence compound: Sense strand (5'→ 3'): c*u*gucafCafGfAfCuccacuucau (L96) Antisense strand (5'→ 3'): a*fU*gadAggnTggagucfUgfUgacag*u*a Table 4, modified duplex Hep3B transfection test results

[0192] Table 5, modified duplex Hep3B transfection test results

[0193] Table 6, modified duplex Hep3B transfection test results

[0194] Table 7, modified duplex Hep3B transfection test results

[0195] Table 8, conjugate in Hep3B transfection test results

[0196] Example 3, in vitro activity detection - free uptake of human primary hepatocytes After the human primary hepatocytes were recovered, the cells were diluted with the medium to adjust the cell density to 600,000 cells / mL. Different concentrations of the conjugates were added to the 96-well collagen plates at an amount of 10 μL / well, and 90 μL / well of human primary hepatocytes (54,000 cells / well) were added to the plates, and a PBS control group was set up. After plating, the plates were incubated in a 5% CO2, 37 °C incubator for 48 hours. After 48 hours, the medium was removed and the cells were collected for RNA extraction. Total RNA was extracted using the RNeasy 96 Kit (QIAGEN-74182) according to the kit instructions. Then, cDNA was synthesized using the HiScript III RT SuperMix for qPCR (+gDNA wiper) (Vazyme-R323-01) according to the instructions. Real-time fluorescent PCR was performed in an Applied Biosystems-QuantStudio 7 Flex real-time fluorescent PCR system using the ΔΔCt determination method (Tables 9-10). Among them, the reference conjugate Pc with known INHBE gene inhibition effect was used as a positive control, and the information of the reference conjugate Pc is as follows: Sense strand (5'→3'): c*u*gucafCafGfAfCuccacuucau (L96) Antisense strand (5'→3'): a*fU*gadAggnTggagucfUgfUgacag*u*a Table 9, Human primary hepatocyte free uptake test results

[0197] Table 10, Human primary hepatocyte free uptake test results

[0198] Example 4, In vivo activity test of HDI in hINHBE overexpression mice by high pressure tail vein injection 6~7 week-old mice were randomly divided into groups according to body weight, with 3~5 mice in each group. On Day 1, the conjugates were injected subcutaneously at a dose of 1 mpk (mg / kg) or 3 mpk, and an equal volume of PBS was injected as a control. On Day 4 or Day 21, all mice were injected with a solution of hINHBE plasmid DNA at a volume of 8% of their body weight through the tail vein within 5 seconds. On Day 5 or Day 22 (24 h after INHBE plasmid injection), all groups of mice were euthanized by CO2 inhalation, and the livers were collected. The hINHBE mRNA level in the liver was detected by QPCR method to evaluate the knockdown effect of different conjugates on the target gene (Tables 11-12).

[0199] Table 11, Inhibition of liver hINHBE mRNA by conjugates in HDI-hINHBE mice

[0200] Table 12, Inhibition of liver hINHBE mRNA by conjugates in HDI-hINHBE mice

[0201] Example 5, 3' Exonuclease stability test Conjugate 3 and conjugate 244 solutions were prepared at a concentration of 0.26 mg / mL, 1 μL of 3' exonuclease (PDEI, Sigma-Aldrich) was added to 19 μL of conjugate solution, resulting in a final concentration of 0.25 μg / μL of conjugate 3 and conjugate 244 and 10 mU / μL of exonuclease, and incubated at 25 °C for 0, 24 and 48 hours. The reaction was stopped by adding 2.5 μL of 0.5 M EDTA. At the 0 hour time point, the reaction was stopped by adding 0.5 M EDTA to the exonuclease before adding to the conjugate 3 and conjugate 244 solution. The reaction stop solution was taken at 3 time points and run on a 10% Native PAGE, the gel was stained with TBE + Gel-red stain for 10 to 15 minutes and the gel was visualized. The 0 hour sample was used for normalization analysis and the results are shown in Table 13 and Figure 6. Figure 1

[0202] Table 13: Normalization analysis using the 0h sample of each sequence resulted in the following:

[0203] Results: After 48 hours of incubation with 3' exonuclease, conjugate 3 and conjugate 244 still have >60% of the siRNA conjugate remaining. Conjugate 3 and conjugate 244 have excellent stability.

[0204] Example 6, INHBE RNAi immunogenicity test ​The siRNAs and control compound poly IC were transfected into freshly isolated and mixed human PBMCs according to the Lipofectamine® 3000 Transfection Kit (Thermo-L3000-015) instructions, with a final cell number of 20,000 cells / well in the cell plate. The cell supernatants were collected after 24 hours incubation in a 5% CO2concentration, 37°C cell incubator for the detection of IFN alpha, IL-6 and TNF alpha contents (Cytokine kit Thermo-PPX-04-MXRWG3K). The fold change of each siRNA corresponding cytokine change was calculated by comparing with the cytokine content of the control well to evaluate the induction of different cytokines by siRNAs in human PBMCs (Table 14).

[0205] Table 14. In vitro immunogenicity test results of conjugates

[0206] The above results show that the conjugate 3, conjugate 23, conjugate 33 of the present application all have very low immunostimulatory properties.

[0207] Example 7. INHBE RNAi off-target analysis - human primary hepatocytes free uptake RNAseq After the human primary hepatocytes were recovered, the cells were diluted with medium to adjust the cell density to 670000 cells / mL. Different concentrations of conjugates were added to 24-well collagen plates at a volume of 50 μL / well, and 450 μL / well of human primary hepatocytes were added to the plates, while PBS controls were set up. After plating, they were incubated in a 5% CO2, 37 ℃ incubator for 48 hours. After 48 hours, the medium was removed and the cells were collected for RNA extraction. Total RNA was extracted using the RNeasy 96 Kit (QIAGEN-74182) according to the kit instructions. 1 μg of total RNA after extraction was treated with the Ribo-off rRNA Depletion Kit (Human / Mouse / Rat) (Vazyme N406-02), VAHTS Universal V6 RNA-seq Library Prep Kit for Illumina (Vazyme NR604-02), and VAHTS RNA Multiplex Oligos Set1-Set2 for Illumina (Vazyme N323 / N324) kit to build a library, and a next-generation sequencer (NovaSeq6000, Illumina) was used to sequence all samples. The sequencing results of the blank sample were compared and analyzed to identify significantly down-regulated genes after RNAi treatment (log2FoldChange ≤-1, p-adjust<0.05). Then cDNA was synthesized using the HiScript III RTSuperMix for qPCR (+gDNA wiper) (Vazyme-R323-01) according to the instructions. Real-time fluorescent PCR verification of significantly down-regulated genes was performed in the Applied Biosystems-QuantStudio 7 Flex real-time fluorescent PCR system using the ΔΔCt determination method.

[0208] In the sequencing analysis of human primary hepatocyte RNA samples treated with conjugate 3, only INHBE mRNA levels were significantly reduced. Specifically, as shown in Figure 2 -A (100 nM) and Figure 2 -B (10 nM). This indicates that conjugate 3 has no obvious off-target effect in human primary hepatocytes, and its inhibition of INHBE is highly specific.

[0209] Example 8, conjugate in vivo activity test in cynomolgus monkeys Healthy male cynomolgus monkeys were screened during the acclimation period based on body weight, hematology, and blood chemistry levels, and randomly divided into groups of 3. Liver samples were collected at baseline (pre-dose) by liver puncture, and after the animals recovered for 1-2 weeks, subcutaneous injection was performed for dosing. The conjugate 3, conjugate 23, and conjugate 33 single-dose groups were subcutaneously dosed at a dose of 4.5 mg / kg on Day 0. The conjugate 3 QM*2 group was subcutaneously dosed at a dose of 4.5 mg / kg on Day 0 and Day 28, for a total of 2 doses. The PBS group was subcutaneously injected on Day 0. Liver samples were collected by liver puncture on Day 14, Day 28, Day 42, Day 56, and Day 84. The relative expression levels of INHBE mRNA in the liver at different time points were detected by QPCR (Table 15).

[0210] Table 15. Inhibition of liver INHBE mRNA by conjugates in cynomolgus monkeys

[0211] NA represents not detected.

[0212] The results show that conjugate 3 has a significant inhibitory effect on INHBE mRNA in the liver of cynomolgus monkeys when subcutaneously dosed at a single dose of 4.5 mg / kg, and the effect lasts until Day 56 after dosing, with a maximum inhibition rate of about 70% (Day 14-42). When conjugate 3 is injected at a dose of 4.5 mg / kg on Day 0 and Day 28, the inhibition rate of INHBE mRNA in the liver of cynomolgus monkeys reaches 74% on Day 84. When subcutaneously dosed at a single dose of 4.5 mg / kg, conjugate 23 has an inhibition rate of about 80% on INHBE mRNA in the liver of cynomolgus monkeys on Day 28-42, and 75% on Day 56. When subcutaneously dosed at a single dose of 4.5 mg / kg, conjugate 33 has an inhibition rate of 82% on INHBE mRNA in the liver of cynomolgus monkeys on Day 42, 84% on Day 56, and 62% on Day 84.

[0213] In summary, the siRNA and conjugates thereof of the present application have good to excellent in vitro INHBE gene expression inhibition activity, can effectively inhibit the level of INHBE mRNA in a variety of cell lines, have satisfactory immunostimulatory properties, have no obvious off-target effect, can significantly reduce the expression of INHBE mRNA at the animal level, and have good persistence.

Claims

1. An siRNA for inhibiting the expression of an INHBE gene, characterized in that: The siRNA comprises a sense strand and an antisense strand, wherein the antisense strand comprises a nucleotide sequence of SEQ ID NO: 470, 5'-UAUUAAGAAAGUAUAAGCCAGGC-3', and wherein the sense strand comprises a nucleotide sequence of SEQ ID NO: 173, 5'-CUGGCUUAUACUUUCUUAAUA-3'.

2. The siRNA of claim 1, wherein: The siRNA comprises at least one modified nucleotide.

3. The siRNA of claim 2, wherein: All nucleotides in the sense strand and / or the antisense strand of the siRNA are modified nucleotides or nucleotide analogs.

4. The siRNA of claim 2, wherein: The modified nucleotide is selected from a 2'-methoxy nucleotide, a 2'-fluoro nucleotide, a 2'-deoxy nucleotide, a 2', 3'-seco nucleotide analog, a 2'-fluoro-arabinonucleotide, a 2'-methoxyethyl nucleotide, a 2'-amino modified nucleotide, a 2'-alkyl modified nucleotide, a 3'-methoxy nucleotide, a 2'-allyl modified nucleotide, a nucleotide comprising a phosphorothioate group, a nucleotide comprising a methylphosphonate group, a nucleotide comprising a 5'-phosphate, a nucleotide comprising a 5'-phosphate mimic, a glycol modified nucleotide, an abasic nucleotide, a morpholino nucleotide, a locked nucleotide, an unlocked nucleotide, a threose nucleotide, or a glycerol nucleotide.

5. The siRNA according to any one of claims 1 to 4, characterized in that: The 5' end and the 3' end of the sense strand independently comprise 0, 1 or 2 phosphorothioate linkages, respectively; and / or the 5' end and the 3' end of the antisense strand independently comprise 1 or 2 phosphorothioate linkages, respectively.

6. The siRNA according to any one of claims 1 to 4, wherein: The first nucleotide at the 5' end of the antisense strand is an (E)-vinylphosphonate modified nucleotide.

7. The siRNA according to any one of claims 2-4, wherein: The siRNA comprises a modified sense strand and a modified antisense strand, wherein the modified sense strand comprises a nucleotide sequence of 5'-mC*mU*mGmGmCmUmUmAfUfAfCmUmUmUmCmUmUmAmAmUmA-3'; and the modified antisense strand comprises a nucleotide sequence of 5'-mU*fA*mUmUfAmAmGfAmAmAmGfUmAfUmAfAmGmCmCmAmG*mG*mC-3' or 5'-eVPmU*fA*mUmUfAmAmGfAmAmAmGfUmAfUmAfAmGmCmCmAmG*mG*mC-3', wherein mU, mC, mA, mG represent 2'-OMe modified nucleotides; fU, fC, fA, fG represent 2'-F modified nucleotides; each asterisk * represents a phosphorothioate linkage; eVP represents an (E)-vinylphosphonate modified nucleotide.

8. An siRNA conjugate obtained by conjugating the siRNA of any one of claims 1-7 with a conjugating molecule.

9. The siRNA conjugate of claim 8, wherein: The targeting ligand is optionally conjugated to the 3' end of the sense strand of the siRNA, either independently or simultaneously, via a linker.

10. The siRNA conjugate of claim 9, wherein: The targeting ligand is GalNAc (L96) wherein GalNAc (L96) has the following structure: 。 11. The siRNA conjugate according to claim 9 or 10, characterized in that: The siRNA conjugate is selected from conjugate 3 or conjugate 244.

12. A pharmaceutical composition, characterized by: The pharmaceutical composition comprises the siRNA of any one of claims 1-7 and / or the siRNA conjugate of any one of claims 8-11 and a pharmaceutically acceptable carrier.

13. Use of the siRNA of any one of claims 1-7 and / or the siRNA conjugate of any one of claims 8-11 and / or the pharmaceutical composition of claim 12 for the manufacture of a medicament for the treatment and / or prevention of a pathological condition or disease associated with overexpression of the INHBE gene.

14. Use according to claim 13, characterized in that: The pathological condition or disease is a metabolic disease and / or a cardiovascular disease.

15. Use according to claim 14, characterized in that: The metabolic disease is obesity, type 2 diabetes, insulin resistance, lipodystrophy, fatty liver disease, non-alcoholic liver steatosis or metabolic dysfunction-associated liver steatosis, non-alcoholic steatohepatitis or metabolic dysfunction-associated steatohepatitis; the cardiovascular disease is hyperlipidemia or dyslipidemia, atherosclerosis, cardiomyopathy, heart failure or coronary heart disease.

Images