Construction method and application of efficient and stable genetic transformation system of flammulina velutipes

Abstract

The invention belongs to the technical field of genetic engineering of edible mushrooms, and particularly relates to a construction method of an efficient and stable genetic transformation system of flammulina velutipes. The construction method comprises the following steps: culturing in an MM culture medium by taking a flammulina velutipes strain 0747 as a receptor; the pFgnpt vector is converted into agrobacterium AGL1 (AGL1); inoculating hyphae into an IM liquid culture medium containing acetosyringone and MES, mixing with agrobacterium tumefaciens, culturing, and transferring the hyphae to an IM solid flat plate paved with filter paper; hyphae are transferred to a PDA resistance plate containing G418 and cephalosporin for resistance screening, and an efficient and stable flammulina velutipes genetic transformation system is obtained. The new selection marker G418 is developed and applied, limitation of a traditional selection marker is broken, more choices are provided for flammulina velutipes genetic transformation, a new thought is provided for genetic transformation research of other edible mushrooms, and the application field of an agrobacterium tumefaciens-mediated transformation technology is expanded.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of edible fungus genetic engineering, and particularly relates to a construction method and application of a high-efficiency and stable genetic transformation system of Flammulina filiformis. BACKGROUND

[0002] Flammulina filiformis is a kind of edible fungus with rich nutrition, containing high protein, fatty acids, essential amino acids and polysaccharides, and can improve human immunity. Due to its short planting cycle and wide consumer group, it has a significant impact on the rural economic development and agricultural income of various regions in Asia. In the post-genomic era, a large amount of genomic data emerges, and numerous functional genes are in urgent need of verification. Genetic transformation has become an important biological technology for gene function research and breeding. Therefore, it is of great significance to develop a high-efficiency and stable genetic transformation system. In the gene function of edible fungus, traditional genetic transformation methods such as polyethylene glycol, electric shock method, gene gun method and restriction enzyme-mediated integration method are limited in their application in gene function research due to their complex operation or low transformation efficiency. Agrobacterium-mediated transformation is widely used in the field of molecular genetics of edible fungus in recent years due to its wide range of recipient materials, high frequency of single copy integration of T-DNA and other characteristics.

[0003] In recent years, although an Agrobacterium-mediated genetic transformation system has been established in Flammulina filiformis, and some progress has been made in gene function verification, it still faces the challenge of low genetic transformation efficiency. Studies on Agrobacterium-mediated genetic transformation of plants and fungi have shown that this process is highly dependent on the genotype of the recipient material. Agrobacterium-mediated genetic transformation of Flammulina filiformis includes Agrobacterium infection and selection of transformants. Although some studies have explored the effects of Agrobacterium type and acetylchalcone (AS) concentration on infection, there is no report on the factors that play a decisive role in the efficiency of genetic transformation, such as the interaction between Agrobacterium strains and recipient strains, the genotype of the recipient, and the conditions for culturing the recipient. Selection of transformants is a key step in genetic transformation. Currently, Flammulina filiformis mainly relies on the selection of transformants using the hygromycin resistance gene (hph or hyg), and there are few reports on the development and application of other selection markers. In addition, plant transformation studies have confirmed that the toxicity of different selection markers to recipient materials and their effects on transformation efficiency are significantly different.

[0004] Therefore, the development of new selection markers is of great significance to improve the efficiency of genetic transformation. In summary, improving the genetic transformation efficiency of Flammulina filiformis requires optimization from multiple dimensions, including selecting suitable Agrobacterium strains, developing new selection markers, and finding suitable genotypic materials for genetic transformation, but there is no report on this in the genetic transformation of Flammulina filiformis. By optimizing the key steps in the process of Agrobacterium infection of Flammulina filiformis genetic transformation, a high-efficiency and stable genetic transformation system is established, which provides technical support for functional gene research and variety improvement. SUMMARY

[0005] The technical problem to be solved by the present application is how to improve the genetic transformation efficiency of Flammulina velutipes, specifically including the following aspects:

[0006] (1) Finding a suitable genotype material for genetic transformation of Flammulina velutipes, starting from the perspective that the transformation efficiency is highly dependent on the recipient genotype, to provide a basis for improving the transformation efficiency;

[0007] (2) Developing a new selection marker to provide a new selection tool for genetic transformation of Flammulina velutipes, changing the current situation of mainly relying on hygromycin resistance genes for transformation screening, thereby improving the transformation efficiency;

[0008] (3) The present application improves the genetic transformation efficiency of Flammulina velutipes to 44%-66% through multi-factor combination and optimization;

[0009] The present application discloses a high-efficiency genetic transformation method of Flammulina velutipes with mycelium as the recipient, which comprises the following steps: strain G418 resistance analysis, construction of a binary vector containing a resistance gene, transformation of the vector into Agrobacterium, preparation of Flammulina velutipes recipient material, co-culture of mycelium and Agrobacterium liquid; resistance screening of transformants, and positive detection of transformants.

[0010] The method of the present application has a positive rate of 44%-66% for genetic transformation of plants, shortens the transformation time, and has stable and highly repeatable transformation results.

[0011] The present application provides a construction method of a high-efficiency and stable genetic transformation system of Flammulina velutipes, comprising the following steps:

[0012] (1) Taking Flammulina velutipes strain 0747 cultured in MM medium as the recipient to obtain mycelium blocks through culture;

[0013] (2) Transforming pFgnpt vector into Agrobacterium AGL1; the pFgnpt vector is obtained by linking the sequences shown in SEQ ID NO. 1 and SEQ ID NO. 8 to pDHT plasmid;

[0014] (3) Taking the mycelium blocks of step (1) to obtain mycelium, inoculating in IM liquid medium containing acetosyringone and MES, ultrasonic treatment, mixing with Agrobacterium in step (2), and then transferring the mycelium to an IM solid plate covered with filter paper after culture, and dark culture;

[0015] (4) Transferring the mycelium after dark culture in step (3) to a PDA resistance plate containing G418 and cephalosporin for resistance screening, and obtaining a high-efficiency and stable genetic transformation system of Flammulina velutipes;

[0016] Further, the composition of the MM culture medium in step (1) is: glucose 20 g / L, L-asparagine 2 g / L, MgSO4.7H2O 0.5 g / L, KH2PO4 0.46 g / L, K2HPO4 0.1 g / L, agar powder 15 g / L

[0017] Further, the culture time of the Flammulina velutipes strain 0747 in step (1) is 7 days.

[0018] Further, in step (2), the sequence of SEQ ID NO. 1 is obtained by amplification with the Flammulina velutipes Dan3 genome as a template and a primer pair with sequences of SEQ ID NO. 2 and SEQ ID NO. 3.

[0019] Further, the construction process of the pFgnpt vector in step (2) is as follows:

[0020] The pDHT-bar is double-cut by BamHI / BcuI endonuclease, the pDHT vector skeleton is recovered, and the linearized pDHT vector is obtained.

[0021] SEQ ID NO. 1 and SEQ ID NO. 8 are seamlessly cloned and connected with the linearized pDHT vector, and the pFgnpt vector is obtained.

[0022] Further, in step (3), the method for obtaining the Agrobacterium AGL1 containing the pFgnpt vector is:

[0023] The Agrobacterium AGL1 is taken, the vector pFgnpt in claim 4 is added, ice bath for 30 min, liquid nitrogen quick-freezing for 5 min, 37 DEG C water bath for 5 min, immediately ice bath for 2 min, 1ml LB liquid is added, 28 DEG C, 150 rpm culture for 3h, 5000 rpm centrifugal for 5 min, pour supernatant, leave 100ul, take half and pour into LB resistance solid plate containing 50ug / ml carbenicillin and 50ug / ml kanamycin, blow dry, 28 DEG C, inverted culture for 2-2.5d, take 3-5 single colonies, re-streak to LB resistance solid plate, 28 DEG C, 220 rpm culture for 2d, and the Agrobacterium AGL1 containing the pFgnpt vector is obtained.

[0024] Further, the PDA plate resistance plate in step (4) contains G418 25ug / ml+Cef 450ug / ml.

[0025] The application also provides the application of the construction method in the construction of the high-efficiency and stable genetic transformation system of Flammulina velutipes.

[0026] Compared with the prior art, the application has the following beneficial effects:

[0027] The present application focuses on the innovation of Flammulina velutipes genetic transformation technology, significantly improves the transformation efficiency through systematic optimization, successfully solves the technical problem of Agrobacterium-mediated transformation of Flammulina velutipes, and has important value for Flammulina velutipes genetic engineering research and application. The specific advantages are as follows:

[0028] 1. Efficiency is significantly improved: The Flammulina velutipes genetic transformation system is optimized from multiple dimensions, including screening of suitable Agrobacterium strains, development of new screening markers, selection of suitable genotypes of materials, and improvement of Agrobacterium infection conditions. After optimization, the genetic transformation efficiency is as high as about 65%, effectively breaking through the bottleneck of low efficiency of the original transformation system, providing efficient technical support for Flammulina velutipes functional gene research and variety improvement;

[0029] 2. Expand the application boundary: The present application develops and applies the screening marker G418, breaking the limitation of traditional screening markers, not only providing more choices for Flammulina velutipes genetic transformation, but also providing new ideas for other edible fungus genetic transformation research, expanding the application field of Agrobacterium-mediated transformation technology;

[0030] 3. Accelerate gene research: Efficient genetic transformation method can make a large number of functional genes to be verified express quickly and accurately in Flammulina velutipes, which helps to accelerate the analysis of Flammulina velutipes genome data, and deeply excavate the gene function related to food and medicinal value, laying a theoretical foundation for cultivating Flammulina velutipes new varieties;

[0031] In addition, the present application also has unique advantages in transformation receptors and screening markers:

[0032] In the transformation receptor, mycelial block is used as the receptor material, which has a short preparation time compared with mycelial ball or millet mycelium, and the transformation results are stable and the experimental repeatability is high;

[0033] In the screening marker, G418 is used instead of the commonly used hyg, and the false positive of the transformation obtained by G418 resistance is less, and the stability of the resistance gene in the transformation is higher;

[0034] Compared with existing research, Liu Jianyu et al. in 2015 used dikaryon strain G1 mycelial fragments as receptors, and through Agrobacterium-mediated transformation and hyg screening, although the transformation efficiency was 40.31%, the method required solid culture followed by liquid culture and mycelial fragment preparation, which increased the experimental period and pollution risk, and the subsequent research was not continued. While the present research method only needs to use the solid cultured strain as the transformation receptor, which is simple and efficient and stable. BRIEF DESCRIPTION OF DRAWINGS

[0035] Figure 1Figure for analysis of G418 sensitivity of the strains of Flammulina velutipes in Example 1, wherein 0747, 0990, B20A18, G1 are dikaryotic strains of Flammulina velutipes, and Dan3 is monokaryotic strain of Flammulina velutipes;

[0036] Figure 2 Figure for construction of pFgnpt vector in Example 1, wherein (A) is Ffgpd fragment and nptII fragment, (B) is verification of pFgnpt vector, (C) is map of pFgnpt vector, (D) is schematic diagram of nptII resistance expression frame of pFgnpt vector, Ffgpd is Flammulina velutipes gpd promoter, Ffgpd is first intron containing gpd gene and four coding amino acids, nptII is resistance gene of G418, and nos terminator is terminator;

[0037] Figure 3 Figure for effect of Agrobacterium AGL1 on genetic transformation efficiency of the recipient strains cultured in different media in Example 1, the transformation efficiency of the strains cultured in different media (MM, PDA) by Agrobacterium AGL1 is counted, the experiment is repeated three times, and N represents total transformation blocks. The three points in the column chart represent the transformation efficiency of each experiment, respectively;

[0038] Figure 4 Figure for effect of Agrobacterium GV3101 on genetic transformation efficiency of the recipient strains cultured in different media in Example 1, the transformation efficiency of the strains cultured in different media (MM, PDA) by Agrobacterium GV3101 is counted, the experiment is repeated three times, and N represents total transformation blocks. The three points in the column chart represent the transformation efficiency of each experiment, respectively;

[0039] Figure 5 Figure for selection of G418 resistant transformants of dikaryotic strain 0747 in Example 1, wherein (A) is primary screening of 0747 transformants on G418 resistance plate; (B) is second screening of 0747 transformants on G418 resistance plate; the middle is wild type control (ck); and the surrounding is suspicious resistant transformants;

[0040] Figure 6 Verification of G418 resistant transformants of dikaryotic strain 0747 of Flammulina velutipes in Example 1, 1-8: transformants before passage; 9-16: transformants after mitotic passage; Wt: wild type 0747; pc: product amplified with plasmid as template; nc: product amplified with water as template, and M is nucleic acid Marker 2000;

[0041] Figure 7For the construction of the pFgnpt-Cas9 vector in Experiment Example 1, Figure A shows the Glgpd-Cas9 fragment as a Cas9 expression element, containing Ganoderma lucidum gpd (Glgpd), the Cas9 fragment, and the T. reesei pdc terminator; Figure B shows the verification of pFgnpt-Cas9 using VcasF / VcasR; Figure C is a schematic diagram of the construction of the pFgnpt-Cas9 vector.

[0042] Figure 8 The images show the pFgnpt-Cas9 transformant and its verification electrophoresis diagrams from Experiment Example 1. (A) shows the primer positions used to verify the amplified fragment in the pFgnpt-Cas9 transformant, the gene position of the primers used for pcF / pcR amplification of the Cas9 fragment, and the gene position of the primers used for pnF / pnR amplification of the nptII fragment; (B) shows the transformant screening diagram; and (C) shows the transformant verification diagram. Amplified Cas9 and nptII are used to determine the integration of the transformed exogenous fragment into the genome, and actin is used as an internal control gene.

[0043] Biological Preservation Certificate:

[0044] Preservation Institution: Guangdong Microbial Culture Collection Center;

[0045] Accession number: GDMCC No. 66225;

[0046] Preservation date: 2025.4.27；

[0047] Storage address: No. 59, Building 5, 100, Martyr's Road, Guangzhou;

[0048] Taxonomic nomenclature: Flammulina filiformis . Detailed Implementation

[0049] Example 1

[0050] (1) G418 resistance test

[0051] Flammulina velutipes strains 0747, 0990, B20A18, G1, and Dan3 (preserved and provided by the Institute of Edible Fungi, Shanghai Academy of Agricultural Sciences) with colony diameters of 5-6 cm were selected. They were inoculated using a perforator on resistance-resistant PDA medium containing G418 concentrations (0 ug / ml, 6.25 ug / ml, 12.5 ug / ml, 25 ug / ml, 50 ug / ml, and 100 ug / ml) for 10 days at 25°C. The growth of the strains under different antibiotic concentrations was compared to analyze their resistance to G418.

[0052] The results are as follows Figure 1Results of the analysis by G418 resistance concentration gradient showed that the bacteriostatic concentration of G418 on PDA resistant medium (purchased from BD company) for 0747, 0990, B20A18, G1, Dan3 was 25 ug / ml, so 25 ug / ml was determined as the screening concentration of G418 for transformants.

[0053] (2) Fgnpt vector construction

[0054] The Ffgpd promoter Ffgpd (containing the first intron of gpd gene) was amplified from the Flammulina velutipes Dan3 genome by using primer pair FfgpdF / FfgpdR; the fragment of nptII fused with nos terminator was amplified from plGN-35S plasmid (professor Fan Yanhua of Southwest University) by using primer pair nptF / nptR;

[0055] The amplification system was as follows: 2x Phanta Max Master Mix (vazyme) 25 μl, 10 μmol / l primer 1 μl each, genomic DNA template 1 μl (10 ng / μl), and water to 50 μl system.

[0056] The PCR reaction parameters were as follows: 95℃ (5 min); 30 cycles: 95℃ (30 sec), 58℃ (30 sec), 72℃ (30 sec); 72℃ (15 min). After 1.2% agarose electrophoresis, the Ffgpd fragment of about 820 bp and the npt fused with nos terminator fragment of about 1000 bp were recovered.

[0057] The pDHT-bar (professor Chen YX of Chinese Academy of Sciences, Molecular Plant Science Center for Excellence, Wang CS* et al. 2015. Biosynthesis of non-melanin pigment by a divergent polyketide synthase in Metarhizium robertsii. Fungal Genetics and Biology, 81: 142-149.) was double digested by BamHI / BcuI endonuclease, the pDHT vector skeleton was recovered, and the linearized pDHT vector was obtained; the Ffgpd promoter and the npt fused with nos terminator fragment were ligated with the linearized pDHT vector by seamless cloning (EZ-HiFi Seamless Cloning Kit, GenStar, T196), and the ligation product was transformed into E. coli, and the colony PCR was verified by primer pair M13F / M13R, and the plasmid of the sample correctly verified by PCR was extracted, and the plasmid was named as pFgnpt; wherein, the Fgnpt vector construction process was as follows:Figure 2 as shown.

[0058] The specific steps of E. coli transformation and PCR verification are as follows:

[0059] Take 100 μL of E. coli competent TOP10 (purchased from Shanghai Weidi Biotechnology Co., Ltd.) and thaw on ice for 10 min; add the above-mentioned ligation product, mix gently, and place on ice for 30 min; 42°C water bath heat shock for 90 s, and quickly place in ice water mixture to cool for 5 min; (ultra-clean bench) add 1 ml of LB liquid (without antibiotics), 37°C, 180 rpm for 1 h; centrifuge the bacterial solution at 5000 rpm for 5 min; (ultra-clean bench) pour off the supernatant, leave 100 μL (blow and mix evenly) and spread on LB plates (containing kanamycin), 37°C, inverted culture for 12-18 h;

[0060] Pick 8 single colonies and streak on LB plates (containing kanamycin), and use the primers M13F / M13R on the vector to do colony PCR verification. The amplification system is: 2x Premix Taq Version (TAKARA, RR901A) 10 μl, 10 μmol / l primer each 1 μl, colony, add water to 20 μl system.

[0061] PCR reaction parameters: 95°C (3 min); 30 cycles: 95°C (30 sec), 58°C (30 sec), 72°C (2 min); 72°C (15 min). Electrophoresis on 1.2% agarose gel, and select 3 samples of target size for sequencing.

[0062] (3) Transformation of pFgnpt vector into Agrobacterium

[0063] Take the Agrobacterium AGL1 and GV3101 competent cells stored at -80°C (purchased from Shanghai Weidi Biotechnology Co., Ltd.), thaw on ice for 10 min, 1 ul pFgnpt plasmid, mix by blowing, ice bath for 30 min, liquid nitrogen freezing for 5 min, 37°C water bath for 5 min, immediately ice bath for 2 min, (ultra-clean bench) add 1 ml of LB liquid, 28°C, 150 rpm for 3 h; centrifuge at 5000 rpm for 5 min, (ultra-clean bench) pour off the supernatant, leave 100 ul, take half of it and pour on LB resistant solid plates, blow dry, 28°C, inverted culture for 2-2.5 d; take 3-5 single colonies, restreak on LB resistant solid plates, 28°C, 220 rpm for 2 d, (ultra-clean bench) take the colonies for PCR verification.

[0064] Carbenicillin, rifampicin and kanamycin were purchased from Sangon Biotech.

[0065] The composition of the LB resistant solid plate is: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl.

[0066] LB solid plates for AGL1 also contain 50 μg / mL carbenicillin (Carb) and 50 μg / mL kanamycin (kan);

[0067] LB solid plates for GV3101 also contain 12.5 μg / mL rifampicin (rif) and 50 μg / mL kanamycin (kan).

[0068] PCR amplification system: 2x Premix Taq Version (TAKARA, RR901A) 10 μl, primer M13F / M13R each 0.5 μl, template is colony, add water to 20 μl system. Among them, M13F / M13R amplification fragment is about 1 kb. Amplification procedure: 95°C pre-denaturation 5 min, 30 cycles: 95°C 30 s, 56°C 30 s, 72°C 1 min, 72°C extension 10 min.

[0069] (4) Agrobacterium culture:

[0070] Inoculate Agrobacterium containing pFgnpt vector into 3 mL LB liquid medium containing corresponding antibiotics, AGL1 uses (kan+Carb), GV3101 uses (kan+rif), 28°C, 200 rpm, culture for 14-20 h; in a clean bench, take 2 mL Agrobacterium liquid into a centrifuge tube, 12000 rpm, 2 min, discard the supernatant, add 1 mL IM liquid medium to resuspend the bacterial body, take 500 μL bacterial liquid into 5 mL IM liquid medium, 28°C, 200 rpm, culture for 4 h, adjust AGL1 to OD600=0.35, adjust GV3101 to OD600=0.3.

[0071] Among them, the composition of IM liquid medium is 400 ml 2.5x MM salt solution / l, 5 ml glycerol / l, glucose 1.8 g / l, (add 200 μmol / l acetyl-syringone and 40 mmol / l MES before use), avoid light storage)

[0072] (5) Infection and co-culture:

[0073] Take the Flammulina velutipes cultured on PDA or MM medium for 7 d, punch near the edge mycelium with a 200 ul syringe, and inoculate in IM liquid medium, after ultrasonic (53 kHz, 1 min), mix with 4 h cultured Agrobacterium, continue to shake bed culture for 2 h, 25°C, 50 rpm. Discard the Agrobacterium, move the mycelium block to IM solid plate coated with filter paper, and take the mycelium without Agrobacterium as control; 25°C dark culture for 3 d;

[0074] The MM culture medium is composed of 20 g of glucose, 2 g of L-asparagine, 0.5 g of MgSO4.7H2O, 0.46 g of KH2PO4, 0.1 g of K2HPO4 and 15 g of agar powder per liter.

[0075] The IM liquid culture medium is composed of 400 ml of 2.5×MM salt solution / l, 5 ml of glycerol / l, 1.8 g of glucose / l, 200 μmol / l of acetyl-syringone and 40 mmol / l of MES (added before use) per liter.

[0076] The IM solid plate is composed of 400 ml of 2.5×MM salt solution / l, 5 ml of glycerol / l, 0.9 g of glucose / l, 15 g of agar powder / l, 200 μmol / l of acetyl-syringone and 40 mmol / l of MES (added before use) per liter, and is sterilized at 121°C for 15 min.

[0077] 2.5×MM salt solution (liquid, 1 L): 3.625 g of KH2PO4, 5.125 g of K2HPO4, 1.250 g of MgSO4.7H2O, 0.375 g of NaCl, 0.165 g of CaCl2.2H2O, 0.0062 g of FeSO4.7H2O, 1.250 g of (NH4)2SO4 and 1 L of water.

[0078] (6) Screening culture:

[0079] The co-culture plate is soaked with 20-30 ml of Cef sterilized water containing 600 μg / ml for 30 min, so that the mycelial blocks are completely submerged, and then the mycelial blocks of the Flammulina velutipes are moved to the PDA plate resistance plate (containing G418 25 μg / ml+Cef 450 μg / ml) and cultured at 25°C until the resistant colonies appear.

[0080] The principle of screening the transformants is that the PDA culture medium containing 25 μg / ml of G418 resistance is the screening culture medium, and when the pFgnpt plasmid is integrated into the genome and the nptII gene is expressed, the suspected transformants grow on the resistant plate, and the strains without the pFgnpt plasmid cannot grow.

[0081] (7) Obtaining of G418-resistant transformants:

[0082] Through the analysis of the types of recipient strains, the culture conditions of recipient strains and the types of Agrobacterium and other factors, it is found that:

[0083] The transformation efficiency of 0747, G1 and Dan3 strains was lower than 2% when the recipient strains were cultured on MM medium, and 0990 and B20A18 did not obtain transformants. When the recipient strains were cultured on PDA medium, the transformation efficiency of 0747 and Dan3 strains was still lower than 2%, and 0990, B20A18 and G1 did not obtain transformants. Figure 3 The calculation method of transformation efficiency was the number of resistant transformants divided by the total number of transformed blocks (%).

[0084] The transformation efficiency of 0747, G1 and Dan3 strains was lower than 2% when the recipient strains were cultured on MM medium, and 0990 and B20A18 did not obtain transformants. When the recipient strains were cultured on PDA medium, the transformation efficiency of 0747 and Dan3 strains was still lower than 2%, and 0990, B20A18 and G1 did not obtain transformants. Figure 4

[0085] The results of multi-factor combination analysis showed that using Agrobacterium AGL1 for infection, MM medium for culture, and 25ug / ml G418 for screening of transformants, a high-efficiency and stable genetic transformation method of Flammulina velutipes was obtained. If one of the variables is changed, the transformation efficiency will be significantly reduced, or even no transformants can be obtained.

[0086] (8) G418 transformant screening and mitosis verification.

[0087] The obtained resistant transformant strain of Flammulina velutipes 0747 was subcultured on the corresponding resistant medium, repeated 3 times, with the recipient strain 0747 as control Figure 5 ), and the transformants were transferred to PDA medium plates after 5 days of dark culture at 25°C. After 5 consecutive subcultures, they were transferred to PDA (containing G418 (25ug / ml) selective medium for culture. The transformants growing on PDA resistant plates were selected, their genomes were extracted by CTAB method and verified by PCR, and the untransformed recipient strain 0747 was used as control.

[0088] Transformant identification: The genomes of the colonies resistant to mitosis were extracted, such as Figure 6 ​As shown, using the nptII-specific primers pnF / pnR, the transformed strains amplified a fragment of approximately 845 bp, while the wild-type strains could not. Using the specific primers ActF / ActR for the *Flammulina velutipes* actin internal reference gene, both the transformed and wild-type strains amplified a fragment of approximately 217 bp, indicating the reliability of the data amplified from the *Flammulina velutipes* genome. These results demonstrate that the exogenous nptII gene has been integrated into the *Flammulina velutipes* 0747 genome.

[0089] Experimental Example 1

[0090] The stability of the above method was verified by reconstructing a binary vector expressing Cas9 protein using nptII as an resistance selection marker.

[0091] This study utilized the highly efficient Agrobacterium-mediated transformation established above to construct a binary vector expressing Cas9. Figure 7 The genome of *Flammulina velutipes* 0747 was introduced into the genome via Agrobacterium-mediated transformation. Transformants were screened using G418 and verified by PCR. Figure 8 The transformation efficiency reached 56.25% (Table 1). The integration rate of the nptII fragment was 90.74%, and that of the Cas9 fragment was 88.9% (Table 1). These results indicate that the efficient genetic transformation of strain 0747 as the recipient strain established in this application is reproducible and stable.

[0092] (1) Construction of pFgnpt-Cas9 vector

[0093] like Figure 7 As shown: Using pFgnpt as the backbone, the vector was digested with xhoI, the linearized vector was recovered, and the Cas9 expression cassette (6380 bp) was amplified using plasmid PT302-6011 (a gift from Professor Zhao Mingwen of Nanjing Agricultural University) and primers CAS9F / CAS9R. The fragment was seamlessly ligated into the linearized vector (EZ-HiFi Seamless Cloning Kit, GenStar, T196), and the ligation product was transformed into E. coli. Colony PCR was performed using primers pcF / pcR for verification. Plasmids were extracted from samples that passed PCR verification and named pFgnpt-Cas9.

[0094] (2) Transformation of 0747 with Agrobacterium containing pFgnpt-Cas9 vector (steps are the same as in Example 1)

[0095] The recipient strain used was 0747 cultured in MM medium, and the Agrobacterium was AGL1 containing pFgnpt-Cas9.

[0096] (3) Screening and identification of transformants

[0097] The transformant screening method is the same as in Example 1;

[0098] Transformation identification: 96 bacterial blocks were co-transformed by the above method, and 54 transformants were obtained, with a transformation rate of 56.25% (Table 1). In Agrobacterium-mediated genetic transformation, there may be partial integration of elements between T-DNA. In order to understand the probability of element integration on the genome, the genomes of 54 transformants were extracted to detect the integration of each element. The Cas9 fragment was amplified by primers pcF / pcR, of which 48 transformants could amplify a target fragment of about 1004 bp, while the wild type strain could not. The nptII fragment was amplified by pnF / pnR, of which 49 could amplify a target band of about 845 bp, while the wild type strain could not. The specific primers ActF / ActR of the actin internal reference gene of Pholiota nameko were used to amplify a fragment of about 217 bp from the transformants and wild type strains, as a genomic control, indicating that the data amplified by the Pholiota nameko genome were reliable. Figure 8 ). According to the above results, about 88.9% of the strains could integrate all elements. This is a relatively high integration efficiency. The probability of resistance screening is as high as 90.74% (Table 2). The results show that the exogenous foreign gene has been integrated into the Pholiota nameko 0747 genome, and the positive rate is high.

[0099] Table 1 is the transformation efficiency statistics of pFgnpt-Cas9 vector, and Table 2 is the fragment integration of pFgnpt-cas9 transformants.

[0100] Table 1

[0101]

[0102] Table 2

[0103]

[0104] The primer pair sequences and gene sequences used in the examples and experimental examples are as follows:

[0105] SEQ ID NO. 1 Ffgpd fragment sequence:

[0106] TAGACTCTTGGCTGGTACTGGGCGACCAATCACGAGGTGCCTGTGGCGCACATTATGGCTCTCCGTGTGCTCCAGCCAATTAGGTTCCGGGGAGGGGTTATGCATTAGAAACGATCTGTTCATATGAAAGGTGGTATCGCGTTTGTTGTGTGGATGACCACCCTAGATGAGGCCTGGATGATACTGCCTTAAAATTGGAGGCGCGTCCAGGGCGCGTCGTTCTCCGAGTCTGTTCCGCTGATGAATTTTGCCTGCTCGACATCGTTTCTGCGGACATGCGATCGACGAGATCTTTGCGTTAGACGCCGTTGGGAAAGGACTCGGAGGTGGGTTTAGACCTGCGTGGTAGAAGAATGGGACGAGTATATGAGTAGAGTACCGCGTCGATACCGCGTAACCGTGCATGTGCTACTACTCCTTGACCGCTGATTGGTTGCGAACTCGACATGATCTAGGTCGTCCTCGTCTGGACTCCTAATCAAGAGAGACAAGAGAATGGTTGAGGAGCTGCTCAAATTTTGGCGGATAACGTCGTCGGTATCCTATGAATCTACGTTGTGTATCTCTAATGCTTTGTACGTCTTTGACGCGGTAAGAATTTAGGACGGAATGCAGACGAAATGACAGCGATGACGTAACATCCGATTATCAGCGCGACAGTATAAAAGGCGCAGAATTTTGACATCTCTCCTTTCTGCAACCGCCATCTTCCACACTTCAATCTCTTTACCATCTCCTCATCTACAATCATGGCCGTACGTGTCTCTTCATCTGCTGTTTGCTGCTCGTCTTGCTCACCATTTTACAGGTCAAAGTTGGA

[0107] Gene sequence of gpd is bold, the first intron of the gene is bold italic;

[0108] Primers used for amplifying Ffgpd fragment:

[0109] FfgpdF SEQ ID NO. 2: CTGCAGCCCGGGGGATCCTAGACTCTTGGCTGGTACTG

[0110] FfgpdR SEQ ID NO.3: agaacctgcGTGCAATCCATCTCCAACTTTGACctgtaaaat

[0111] Primers used to amplify nptll and nos terminator fusion fragment:

[0112] nptF SEQ ID NO.4: attttacagGTCAAAGTTGGAGATGGATTGCACgcaggttct

[0113] nptR SEQ ID NO.5: CGGCCGCTCTAGAACTAGTggattttggttttaggaa

[0114] Vector verification universal primers:

[0115] M13F SEQ ID NO.6: CAGGGTTTTCCCAGTCACG

[0116] M13R SEQ ID NO.7: GAGCGGATAACAATTTCACAC

[0117] nptll and nos terminator fusion sequence:

[0118] SEQ ID NO.8:

[0119] GATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGAATTAATTCGGTACGCTGAAATCACCAGTCTCTCTCTACAAATCTATCTCTCTCTATTTTCTCCATAAATAATGTGTGAGTAGTTTCCCGATAAGGGAAATTAGGGTTCTTATAGGGTTTCGCTCATGTGTTGAGCATATAAGAAACCCTTAGTATGTATTTGTATTTGTAAAATACTTCTATCAATAAAATTTCTAATTCCTAAAACCAAAATCC

[0120] Bold part is nptII gene, bold italic is nos terminator sequence, non-bold italic is XmnI endonuclease site;

[0121] Specific primer of exogenous gene nptII:

[0122] pnF SEQ ID NO.9: GAGAGGCTATTCGGCTATGACT

[0123] pnR SEQ ID NO.10: CCCTTATCGGGAAACTACTCAC

[0124] Specific primer of reference gene actin of Flammulina velutipes:

[0125] ActF SEQ ID NO.11: GATCGTATGCAGAAGGAGTTGACAC

[0126] ActR SEQ ID NO.12: CCACTCTCGTCGTACTCTTGCTTG

[0127] 845bp amplified sequence of pnF / pnR:

[0128] SEQ ID NO.13:

[0129] GAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGAATTAATTCGGTACGCTGAAATCACCAGTCTCTCTCTACAAATCTATCTCTCTCTATTTTCTCCATAAATAATGTGTGAGTAGTTTCCCGATAAGGG

[0130] ActF / ActR amplified sequence:

[0131] SEQ ID NO. 14:

[0132] GATCGTATGCAGAAGGAGTTGACACAACTGTCGCCTTCCAGCATGAAGGTTCGTATTCTTATGTTAAAATTTCAAGTGCCTACTAACTCGTGTTATAGGTCAAGATTGTCGCTCCTCCCGAACGTAAATACTCTGTCTGGATTGGTGGATCCATTCTCGCGTCGCTCTCCACTTTCCAGAACTTGTGGTGCTCCAAGCAAGAGTACGACGAGAGTGG

[0133] CAS9F SEQ ID NO. 15: taccgggccccccctcgag TCCAAAGCCGCTCTCATGGCA

[0134] CAS9R SEQ ID NO. 16: aagcttatcgataccgtcgac TGGACGCCTCGATGTCTTCCTCT pcF SEQ ID NO. 17: AAGACCAACCGCAAGGTCACGGTC

[0135] pcR SEQ ID NO. 18: GTTGAGGAGCTGGCGCCAGTAGTT

[0136] Cas9 fragment primer

[0137] pcF SEQ ID NO. 19: AAGACCAACCGCAAGGTCACGGTC

[0138] pcR SEQ ID NO. 20: GTTGAGGAGCTGGCGCCAGTAGTT

[0139] Cas9 partial fragment 1004 bp, SEQ ID NO. 21:

[0140]

[0141] The above-described embodiments are merely intended to describe the preferred modes of the present application, and are not intended to limit the scope of the present application. Various modifications and improvements of the present application made by those skilled in the art based on the above-described embodiments should fall within the scope of the present application defined by the claims.

Claims

1. A method for constructing a high-efficiency stable genetic transformation system of Flammulina velutipes, characterized by, Comprise the following steps: (1) take the Flammulina velutipes strain 0747 cultured in MM medium as the receptor, and culture to obtain mycelial blocks; (2) transform the pFgnpt vector into Agrobacterium AGL1; the pFgnpt vector is obtained by connecting the sequences shown in SEQ ID NO. 1 and SEQ ID NO. 8 to the pDHT plasmid; (3) take the mycelium of step (1) to obtain mycelium, inoculate in the IM liquid medium containing acetosyringone and MES, ultrasonic treatment, mix with Agrobacterium in step (2), after culture, transfer the mycelium to the IM solid flat plate paved with filter paper, and dark culture; (4) transfer the mycelium after dark culture in step (3) to the PDA resistance flat plate containing G418 and cephalosporin for resistance screening, and obtain the high-efficiency and stable genetic transformation system of Flammulina velutipes; In step (1), the composition of the MM medium is: glucose 20 g / L, L-asparagine 2 g / L, MgSO4·7H2O 0.5 g / L, KH2PO4 0.46 g / L, K2HPO4 0.1 g / L, and agar powder 15 g / L.

2. The construction method according to claim 1, characterized in that, The culture time of the Flammulina velutipes strain 0747 in step (1) is 7 days.

3. The construction method of claim 1, wherein, In step (2), the sequence of SEQ ID NO. 1 is obtained by amplification with the Flammulina velutipes Dan3 genome as the template and the primer pair with the sequences of SEQ ID NO. 2 and SEQ ID NO.

3.

4. The construction method according to claim 3, characterized in that, The construction process of the pFgnpt vector in step (2) is as follows: double enzyme cut the pDHT-bar plasmid with BamHI / BcuI endonuclease, recover the pDHT vector skeleton, and obtain linearized pDHT vector; perform seamless cloning connection of SEQ ID NO. 1 and SEQ ID NO. 8 with the linearized pDHT vector, and obtain the pFgnpt vector.

5. The construction method of claim 1, wherein, In step (3), the method for obtaining Agrobacterium AGL1 containing the pFgnpt vector is as follows: take Agrobacterium AGL1, add the vector pFgnpt of claim 4, ice bath for 30 min, liquid nitrogen quick-freezing for 5 min, 37℃ water bath for 5 min, immediately ice bath for 2 min, add 1 ml of LB liquid, cultivate at 28℃ for 3h at 150 rpm; centrifuge at 5000 rpm for 5 min, pour the supernatant, leave 100ul, take half of it to the LB resistance solid flat plate containing 50ug / ml carbenicillin and 50ug / ml kanamycin, blow dry, cultivate at 28℃ for 2-2.5d; take 3-5 single colonies, re-streak to the LB resistance solid flat plate, cultivate at 28℃ for 2d at 220 rpm, and obtain Agrobacterium AGL1 containing the pFgnpt vector.

6. The construction method of claim 1, wherein, The PDA flat plate resistance flat plate in step (4) contains G418 25ug / ml+Cef 450ug / ml.

7. The application of the construction method in any one of claims 1-6 in the construction of the high-efficiency and stable genetic transformation system of Flammulina velutipes.

Images