Rice tillering angle and tillering number control gene LAZY5 and application thereof

Abstract

The invention discloses a rice tillering angle and tillering number control gene LAZY5 and application thereof, and belongs to the technical field of biological breeding. The invention discloses a method for regulating and controlling the tillering angle and / or the tillering number of a plant, and the method comprises the step of regulating and controlling the expression quantity of a coding gene of LAZY5 protein in a receptor plant so as to regulate and control the tillering angle and / or the tillering number of the receptor plant, the LAZY5 protein is a protein of which the amino acid sequence is as shown in SEQ ID No. 2. According to the application, the coding gene of the LAZY5 protein is finally localized through gene localization and map-based cloning. The gene significantly increases the tillering angle and / or the tillering number. The rice gene LAZY5 can be widely applied to the plant fields of rice genetic breeding, germplasm resource improvement, transgenosis, genome editing breeding and the like, and plays an important role in improving germplasm resources of crops such as rice and the like.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological breeding, and particularly relates to a rice tillering angle and tiller number control gene LAZY5 and application thereof. BACKGROUND

[0002] The rice tillering angle is a key factor affecting the plant type of rice. The plant type of rice not only determines the growth form of rice, but also directly affects its light energy utilization rate and ventilation and light transmission. By adjusting the tillering angle, the plant type structure of rice can be optimized, thereby improving the photosynthetic efficiency and yield. The research on the rice tillering angle is of great significance for understanding the growth and development rules of rice. Through in-depth study on the formation mechanism of the tillering angle, the internal rules and regulation mechanism of the growth and development of rice can be revealed, thereby providing a theoretical basis for formulating scientific cultivation and management measures. The research on the rice tillering angle is also helpful to improve the stress resistance of rice. By adjusting the tillering angle, the population structure of rice can be improved, and the ability of anti-lodging and disease resistance can be enhanced, thereby improving the stress resistance and adaptability of rice.

[0003] The rice tiller number is one of the important factors affecting the yield of rice. Tillering is an important feature in the growth process of rice, which directly determines the effective panicle number of rice plants. A proper tiller number can increase the panicle number per unit area, thereby increasing the yield of rice. The tiller number is also directly related to the photosynthesis and nutrient absorption capacity of rice. By increasing the tiller number, the leaf area of rice can be expanded, the efficiency of photosynthesis can be improved, and the growth and development of rice can be promoted. At the same time, tillering can also increase the number and distribution range of rice root systems, which is beneficial to the absorption of nutrients and water in the soil by plants. However, it should be noted that the more tillers of rice are not the better. Excessive tillering will lead to intensified competition among plants, deteriorated ventilation and light transmission conditions, and will affect the growth and yield of rice. Therefore, reasonable control of the tiller number of rice and maintenance of a moderate population density are the key to realizing high and stable yield of rice.

[0004] The research on the rice tillering angle and tiller number is of great significance in optimizing the plant type of rice, understanding the growth and development rules, improving the stress resistance, and cultivating high-yield and high-quality varieties of rice. By using molecular genetic means to regulate the rice tillering angle and tiller number, new varieties of rice with ideal plant type, high yield and high quality can be cultivated, thereby providing strong variety support for agricultural production. Therefore, the cloning and functional research on the rice tillering angle control gene have important theoretical and practical significance. SUMMARY

[0005] The technical problem to be solved by the present application is how to regulate the tillering angle and / or the tiller number of plants.

[0006] To solve the above technical problems, the present application provides a method for regulating tillering angle and / or tillering number of plants, which can comprise regulating expression amount of a LAZY5 protein coding gene in a receptor plant to regulate tillering angle and / or tillering number of the receptor plant.

[0007] The LAZY5 protein can be any one of the following proteins:

[0008] a1), a protein with an amino acid sequence shown in SEQ ID No. 2;

[0009] a2), a protein with 80% or more identity to the amino acid sequence shown in a1) and related to tillering angle and / or tillering number of plants, obtained by substitution, deletion and / or addition of amino acid residues of the amino acid sequence shown in a1);

[0010] a3), a fusion protein obtained by connecting a tag to N terminal and / or C terminal of a1) or a2).

[0011] In the present application, the regulation can be improvement or promotion or up-regulation.

[0012] In the present application, the regulation can also be reduction or inhibition or down-regulation.

[0013] In the present application, the protein can be derived from rice.

[0014] In the present application, SEQ ID No. 2 consists of 787 amino acid residues.

[0015] The above protein can be artificially synthesized, or its coding gene can be synthesized first and then expressed biologically.

[0016] The connection in a3) can be through a peptide bond.

[0017] The protein tag refers to a polypeptide or protein fused and expressed with a target protein by DNA in vitro recombination technology, so as to facilitate expression, detection, tracking and / or purification of the target protein. The protein tag can be a Flag protein tag, a His protein tag, an MBP protein tag, an HA protein tag, a myc protein tag, a GST protein tag and / or a SUMO protein tag, etc.

[0018] Further, the method can comprise M1) or M2),

[0019] M1), increasing expression amount of the LAZY5 protein coding gene in a receptor plant to increase tillering angle and / or tillering number of the receptor plant;

[0020] M2) reducing the expression amount of the coding gene of the LAZY5 protein in the recipient plant, to reduce the tiller angle and / or the tiller number of the recipient plant containing the coding gene of the LAZY5 protein.

[0021] Further, in the method, the expression amount of the coding gene of the LAZY5 protein in the recipient plant can be increased by introducing the coding gene of the LAZY5 protein into the recipient plant; and the expression amount of the coding gene of the LAZY5 protein in the recipient plant can be reduced by introducing an RNA molecule (dsRNA) and / or a DNA encoding the RNA molecule into the recipient plant, the RNA molecule inhibiting or reducing the expression of the coding gene of the LAZY5 protein.

[0022] Further, in the method, the coding gene of the LAZY5 protein can be any one of the following g1) to g3):

[0023] g1) a DNA molecule of SEQ ID No. 1 as the coding sequence of the coding strand;

[0024] g2) a DNA molecule of SEQ ID No. 1 as the nucleotide sequence of the coding strand;

[0025] g3) a DNA molecule having 80% or more identity with the DNA molecule of g1) or g2), and regulating the tiller angle and / or the tiller number of a plant;

[0026] The target sequence of the RNA molecule can be SEQ ID No. 3.

[0027] Further, in the method, the coding gene and / or the DNA encoding the RNA molecule is introduced into the recipient plant in the form of a vector.

[0028] In an embodiment of the present application, the vector containing the coding gene is the overexpression vector pTCK303-LA5. The overexpression vector pTCK303-LA5 can express the LAZY5 protein with the amino acid sequence of SEQ ID No. 2.

[0029] In some embodiments of the present application, the vector containing the DNA encoding the RNA molecule can be the RNAi vector LA5 RNAi vector. The RNAi vector LA5 RNAi vector can encode the interfering RNA targeting the DNA molecule shown in SEQ ID No. 3.

[0030] Further, in the method, the plant is selected from monocotyledonous plants.

[0031] Further, in the method, the monocotyledonous plant is selected from plants of the family Poaceae.

[0032] Further, in the method, the plant in the Poaceae family is selected from the genus Oryza.

[0033] Further, in the method, the plant in the Poaceae family is selected from the genus Oryza.

[0034] The present application also provides the use of the LAZY5 protein or the substance for regulating the expression of the LAZY5 protein coding gene or the substance for regulating the activity or content of the LAZY5 protein in any of the following,

[0035] A1), in regulating the tiller angle of a plant;

[0036] A2), in preparing a product for regulating the tiller angle of a plant;

[0037] A3), in regulating the tiller number of a plant;

[0038] A4), in preparing a product for regulating the tiller number of a plant;

[0039] A5), in plant breeding or plant assisted breeding;

[0040] A6), in preparing a product for plant breeding or plant assisted breeding.

[0041] Further, in the use, the substance for regulating the expression of the LAZY5 protein coding gene or the substance for regulating the activity or content of the LAZY5 protein is a biological material, which can be any of the following:

[0042] B1), a nucleic acid molecule encoding the LAZY5 protein;

[0043] B2), an expression cassette containing the nucleic acid molecule of B1);

[0044] B3), a recombinant vector containing the nucleic acid molecule of B1) or an expression cassette containing the nucleic acid molecule of B2);

[0045] B4), a recombinant microorganism containing the nucleic acid molecule of B1), or an expression cassette containing the nucleic acid molecule of B2), or a recombinant microorganism containing the recombinant vector of B3);

[0046] B5), a transgenic plant cell line containing the nucleic acid molecule of B1), or an expression cassette containing the nucleic acid molecule of B2), or a transgenic plant cell line containing the recombinant vector of B3);

[0047] B6), a transgenic plant tissue containing the nucleic acid molecule of B1), or an expression cassette containing the nucleic acid molecule of B2), or a transgenic plant tissue containing the recombinant vector of B3);

[0048] B7) a transgenic plant organ comprising the nucleic acid molecule of B1), or a transgenic plant organ comprising the expression cassette of B2), or a transgenic plant organ comprising the recombinant vector of B3);

[0049] B8) a nucleic acid molecule capable of inhibiting or reducing the expression of the LAZY5 protein-encoding gene;

[0050] B9) an expression cassette, a recombinant vector, a recombinant microorganism, a transgenic plant cell line, a transgenic plant tissue and / or a transgenic plant organ comprising the nucleic acid molecule of B8).

[0051] Further, in the application, the nucleic acid molecule of B1) can be a DNA molecule as described in any one of g1) to g3):

[0052] g1) a DNA molecule whose coding sequence of the coding strand is SEQ ID No. 2;

[0053] g2) a DNA molecule whose nucleotide sequence of the coding strand is SEQ ID No. 1;

[0054] g3) a DNA molecule having more than 80% identity with the DNA molecule of g1) or g2) and capable of regulating the tiller angle of a plant;

[0055] The nucleic acid molecule of B8) can be an RNA molecule whose target sequence is SEQ ID No. 3 and / or a DNA encoding the RNA molecule.

[0056] Further, in the application, the expression cassette of B2) refers to a DNA capable of expressing the LAZY5 protein in a host cell. The DNA can include not only a promoter capable of initiating the transcription of the LAZY5 protein-encoding gene, but also a terminator or / and an enhancer sequence capable of terminating the transcription of the LAZY5 protein-encoding gene.

[0057] In some embodiments of the present application, the recombinant vector of B3) can be the overexpression vector pTCK303-LA5. The overexpression vector pTCK303-LA5 can express the LAZY5 protein whose amino acid sequence is SEQ ID No. 2.

[0058] In some embodiments of the present application, the structure of the overexpression vector pTCK303-LA5 is that the fragment between the Kpnl and SacI enzyme recognition sites (the small fragment between the Kpnl and SacI enzyme recognition sites) of the binary vector pTCK303 is replaced with the DNA molecule whose nucleotide sequence is SEQ ID No. 1, while the other nucleotide sequences of the binary vector pTCK303 remain unchanged.

[0059] In some embodiments of the present application, the recombinant vector described in B9) can be a LA5 RNAi vector. The LA5 RNAi vector can encode an interfering RNA targeting the DNA molecule shown in SEQ ID No. 3.

[0060] In some embodiments of the present application, the structure of the LA5 RNAi vector is as follows: the fragment between the BamHI and Kpnl, SacI and Spel enzyme recognition sites of the binary vector pTCK303 (the small fragment between the above enzyme recognition sites) is replaced with a DNA molecule having the nucleotide sequence shown in SEQ ID No. 3, the two inserted targeting fragments are in opposite directions, and the other nucleotide sequences of the binary vector pTCK303 remain unchanged.

[0061] Further, in the use described above, the recombinant microorganism can be a yeast, a bacterium, an alga, and a fungus.

[0062] Further, in the use described above, the plant tissue can be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos, and anthers.

[0063] Further, in the use described above, the transgenic plant organ can be a root, a stem, a leaf, a flower, a fruit, and a seed of a transgenic plant.

[0064] Further, in the use described above, the transgenic plant cell line, the transgenic plant tissue, and the transgenic plant organ can or can not include propagation material.

[0065] Further, in the use described above, the plant is selected from monocotyledonous plants.

[0066] Further, in the use described above, the monocotyledonous plant is selected from a plant of the family Poaceae.

[0067] Further, in the use described above, the plant of the family Poaceae is selected from a plant of the genus Oryza.

[0068] Further, in the use described above, the plant of the genus Oryza is selected from Oryza sativa L.

[0069] Further, in the use described above, the index of plant breeding can include tiller angle and / or tiller number.

[0070] Further, in the use described above, the purpose of plant breeding can include breeding a plant having increased tiller angle and / or tiller number.

[0071] The present application also provides a method for obtaining a rice having the purpose of increased tiller angle and / or tiller number, which comprises introducing into a recipient rice a nucleic acid molecule encoding the LAZY5 protein described above to obtain a rice having the purpose of increased tiller angle and / or tiller number.

[0072] In the present application, the number of tillers can be the number of branches of plants such as Poaceae that occur below or near the ground. They are produced on tillering nodes that are relatively swollen and store rich nutrients. The primary tillers are directly produced from the basal tillering nodes of the main stem, and new tillering buds and adventitious roots can be produced at the base of the primary tillers, forming secondary tillers. Under good conditions, tertiary and quaternary tillers can be formed.

[0073] Further, in the application, the number of tillers can be the effective number of tillers.

[0074] The effective number of tillers can be the number of tillers of plants such as Poaceae that are produced early and can produce panicles and bear fruit. The effective number of tillers is directly related to the number of panicles per unit area.

[0075] In the present application, identity refers to the identity of an amino acid sequence or a nucleotide sequence. The identity of an amino acid sequence (or a nucleotide sequence) can be determined using a homology search site on the Internet, such as the BLAST page of the NCBI homepage. For example, the identity of a pair of amino acid sequences can be calculated by using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, setting Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively, and performing a search in Advanced BLAST 2.1, and then the value of identity (%) can be obtained.

[0076] The above-mentioned 80% or more identity can be 80%, 85%, 90%, or 95% or more identity.

[0077] The above-mentioned 80% or more identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The above-mentioned 85% or more identity can be at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The above-mentioned 90% or more identity can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The above-mentioned 95% or more identity can be at least 95%, 96%, 97%, 98%, or 99% identity.

[0078] The beneficial technical effects obtained by the present application are as follows:

[0079] The application finally locates the coding gene of LAZY5 protein through gene location and map-based cloning. The gene significantly increases the tiller angle and / or the tiller number. The rice gene LAZY5 can be widely applied in the fields of plant genetics and breeding, germplasm improvement, transgenic and genome editing breeding, and has an important role in improving and modifying the germplasm resources of rice and other crops. BRIEF DESCRIPTION OF DRAWINGS

[0080] Figure 1 Cloning and functional verification of the tiller angle and tiller number regulation gene LAZY5 of rice. (A) The LAZY5 gene is located in the interval between molecular markers M3 and M9 by using an F2 separation population, and a T-DNA insertion is found at 809 bp upstream of the promoter of the subsequent gene LOC_Os03g17350. (B) The tiller angle phenotype of the LOC_Os03g17350 overexpression transgenic plants and the RNAi transgenic plants. The scale = 25 centimeters. (C) The gravity response phenotype of the LOC_Os03g17350 overexpression transgenic plants and the RNAi transgenic plants. The scale = 1 centimeter. (D) The tiller angle statistical results of the LOC_Os03g17350 overexpression transgenic plants and the RNAi transgenic plants (corresponding to Figure B). The data is represented by mean ± standard deviation (n = 10). (E) The gravity response statistical results of the LOC_Os03g17350 overexpression transgenic plants and the RNAi transgenic plants (corresponding to Figure C). The data is represented by mean ± standard deviation (n = 16).

[0081] Figure 2 Tiller number statistics in LAZY5 transgenic plants and LAZY5 expression detection. (A) Tiller number statistics of LAZY5 overexpression transgenic plants and RNAi transgenic plants; the data is represented by mean ± standard deviation (n = 10). (B) Expression amount detection of LAZY5 in LAZY5 overexpression transgenic plants and RNAi transgenic plants. The data is represented by mean ± standard deviation (n = 3). DETAILED DESCRIPTION

[0082] The application will be further described in conjunction with the specific embodiments. The examples given are only for the purpose of illustrating the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the application.

[0083] The experimental methods in the following examples are all routine methods, unless otherwise specified, which are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained commercially.

[0084] Oryza sativa L. materials ZH11 (japonica) and 93-11 (indica) in the following examples were preserved in the laboratory and disclosed in the literature “Linzhou Huang. etc. LAZY2 controls rice tiller angle through regulating starch biosynthesis in gravity-sensing cells. New Phytologist. 27 May 2021. DOI: 10.1111 / nph.17426.” The above biological materials can be obtained from the applicant, and the above biological materials are only used for repeating the experiments of the present application and cannot be used for other purposes.

[0085] Oryza sativa L. material Nipponbare (japonica) in the following examples was preserved in the laboratory and disclosed in the literature “Li Zhen. etc. OsBRXL4 Regulates Shoot Gravitropism and Rice Tiller Angle through Affecting LAZY1 Nuclear Localization. Mol Plant. 2019 Aug 5; 12(8): 1143-1156. doi: 10.1016 / j.molp.2019.05.014. Epub 2019 Jun 12. PMID: 31200078.” The above biological materials can be obtained from the applicant, and the above biological materials are only used for repeating the experiments of the present application and cannot be used for other purposes.

[0086] Cloning vectors in the following examples - T Easy is a product of Promega, and the product number is A1360.

[0087] The binary vector pTCK303 used in the following examples was a gift from Dr. Zeng Kang, Institute of Genetics, Chinese Academy of Sciences, and was disclosed in the literature "Zhen Wang. etc. A Practical Vector for Efficient Knockdown of Gene Expression in Rice (Oryza sativa L.). Genetic Resources Published: 03 September 2012 Volume 22, pages 409-417, (2004)." The above biological material is available from the applicant, and the resulting above biological material is only used for repeating the experiments of the present application, and cannot be used for other purposes.

[0088] The NB medium (also called NB minimal medium) used in the following examples has the following composition: 2830 mg / L KNO3, 463 mg / L (NH4)2SO4, 400 mg / L KH2PO4, 185 mg / L MgSO4 7H2O, 166 mg / L CaCl2 2H2O, 27.8 mg / L FeSO4 7H2O, 37.5 mg / L Na2EDTA, 10 mg / L MnSO4 4H2O, 3 mg / L H3BO3, 2 mg / L ZnSO4 7H2O, 0.25 mg / L Na2MoO4 2H2O, 0.025 mg / L CuSO4 5H2O, 0.025 mg / L CoCl2 6H2O, 0.75 mg / L KI, 10 mg / L Vitamin B1, 1 mg / L Vitamin B6, 1 mg / L Nicotinic acid, 100 mg / L Myo-inositol, 300 mg / L Casein hydrolysate, 500 mg / L Glutamine, 2 mg / L Glycine, 1000 mg / L Proline, 2 mg / L 2,4-D, and the rest is water.

[0089] The YEP medium used in the following examples has the following composition: 10 g / L yeast extract, 10 g / L Bacto Peptones, 5 g / L NaCl, and the rest is water.

[0090] The YEP solid medium used in the following examples is based on the above composition, with the addition of 15 g / L agar, sterilized at 120°C for 20 min.

[0091] The composition of the immersion medium in the following examples is: 1 x NB basal medium, 2 g / L Inositol, 2 g / L Glutamine, 500 mg / L Casein hydrolysate, 10 mL / L 10% (w / v) Synperonic PE, 100 mM Acetosyringone, the balance being water.

[0092] The composition of the differentiation medium in the following examples is: 1 x NB basal medium, 100 mg / L Inositol, 2 g / L Casein hydrolysate, 0.2 mg / L NAA, 0.2 mg / L Kinetin, 2 mg / L 6-BA, 30 g / L Sorbitol, 30 g / L Sucrose, 3 g / L Hygromycin, 50 mg / L Gelrite, 10 g / L Agar, the balance being water.

[0093] The composition of the rooting medium in the following examples is: 1 x NB basal medium, 1.0-5.0 mg / L Methionine, 0.5 mg / L IBA, 10 g / L Agar, the balance being water.

[0094] The quantitative test in the following examples is set up in triplicate, and the average value is taken unless otherwise specified.

[0095] The data is processed using GraphPad Prism statistical software, and Student's t-test. Different letters above the column indicate statistically significant differences at the P < 0.05 level (one-way ANOVA, Tukey's honestly significant difference).

[0096] Example 1, positional cloning and functional verification of genes

[0097] 1.1, gene cloning

[0098] To better investigate the molecular mechanisms of tillering angle and gravity response in rice, several mutants with increased tillering angles were collected and map-based cloning was performed. One mutant, la5-D (ZH11 background), was selected as the subject of this study due to its larger tillering angle. To obtain the gene controlling the scattered phenotype of the la5-D mutant, map-based cloning was used to locate LA5 between two molecular markers, M3 and M9, in an F2 segregating population of la5-D and 93-11. Further fine mapping ultimately located the candidate gene within a 216 kb region of rice. Further analysis revealed that the LOC_Os03g17350 gene contains a T-DNA insertion at -810 bp in its promoter region, leading to upregulation of LOC_Os03g17350 gene expression. It was inferred that the LOC_Os03g17350 gene is likely the target gene controlling the scattered phenotype of the mutant and was named the LAZY5 gene.

[0099] The LAZY5 gene sequence has no introns. Its coding sequence (CDS) is a DNA molecule whose nucleotide sequence is SEQ ID No. 1. The LAZY5 gene encodes a protein whose amino acid residue sequence is SEQ ID No. 2, named the LAZY5 protein.

[0100] 1.2 Carrier Construction

[0101] (1) Construction of the overexpression vector pTCK303-LA5

[0102] Based on the cDNA coding region sequence of the LAZY5 gene, specific PCR primers pTCK303-LA2-OE-F and pTCK303-LA2-OE-R were designed to amplify the DNA fragment containing the entire open reading frame of the LAZY5 gene. KpnI and SacI restriction enzyme recognition sites were added to the 5' ends of the two primers, respectively. PCR amplification was performed using ZH11 genomic DNA as a template. After gel recovery of the PCR products, [the following steps were taken]. The intermediate vector T-LA5 was obtained through Easy ligation. After sequencing, the correct coding region fragment of the LAZY5 gene was obtained. Then, it was ligated into the binary vector pTCK303 using KpnI and SacI restriction sites to form the LAZY5 gene overexpression vector pTCK303-LA5 driven by the Ubiquitin promoter, which was used to transform rice callus. The structure of the overexpression vector pTCK303-LA5 is as follows: the fragment between the KpnI and SacI restriction recognition sites of the binary vector pTCK303 was replaced with a DNA molecule with the nucleotide sequence of SEQ ID No. 1, while keeping the other nucleotide sequences of the binary vector pTCK303 unchanged.

[0103] (2) Construction of LA5 RNAi vector

[0104] Two pairs of RNAi primers were designed according to the LAZY5 gene for amplifying the targeting fragments, and the nucleotide sequence of the targeting fragments was SEQ ID No. 3. The first pair was pTCK303-LA2-RNAi-1F and pTCK303-LA2-RNAi-1R, and the second pair was pTCK303-LA2-RNAi-2F and pTCK303-LA2-RNAi-2R. The 5' ends of the first pair of upstream and downstream primers contained BamHI and Kpnl enzyme recognition sites, respectively, and the 5' ends of the second pair of upstream and downstream primers contained SacI and Spel enzyme recognition sites, respectively. PCR amplification was performed using the intermediate vector T-LA5 as a template. The product amplified by the first pair of primers was ligated to the binary vector pTCK303 digested by BamHI and Kpnl. After sequencing verification of the first ligation sequence, the vector pTCK303 with the first ligation sequence was digested by SacI and Spel, and the product amplified by the second pair of primers was ligated to the above-mentioned recovered binary vector. After sequencing detection again, the LA5 RNAi vector was obtained. The structure of the LA5 RNAi vector was that the DNA molecule with the nucleotide sequence of SEQ ID No. 3 replaced the fragment (small fragment between the above-mentioned enzyme recognition sites) between the BamHI and Kpnl, SacI and Spel enzyme recognition sites of the binary vector pTCK303, the two inserted targeting fragments were in opposite directions, and the other nucleotide sequences of the binary vector pTCK303 were kept unchanged.

[0105] The specific primer sequences were as follows (5'-3'):

[0106] pTCK303-LA2-OE-F: AAGGTACCATGTCGCGGTTTGTCGACAA;

[0107] pTCK303-LA2-OE-R: AAGAGCTCCTACCTCCGCTTGTTCCTGCT;

[0108] pTCK303-LA2-RNAi-1F: AAGGATCCTACTACCAGCCGCACAGCAAC;

[0109] pTCK303-LA2-RNAi-1R: AAGGTACCACGACCCCTTCCTCCGCT;

[0110] pTCK303-LA2-RNAi-2F: AAGAGCTCTACTACCAGCCGCACAGCAAC;

[0111] pTCK303-LA2-RNAi-2R: AAACTAGTACGACCCCTTCCTCCGCT;

[0112] 1.3 Agrobacterium-mediated genetic transformation of rice

[0113] The background rice is Nipponbare, and the specific operation steps are as follows:

[0114] (1) Induction of rice callus: the shelled full rice seeds were washed with 75% (v / v) ethanol for 1 min, then soaked with 2.5% (v / v) sodium hypochlorite for 45 min, washed with sterile water for 3 times, and then sowed on NB medium. After about 15 days, callus grew at the mature embryo shield piece. The smooth and dense embryonic callus with light yellow color was picked and subcultured on NB medium, and then subcultured every 14 days.

[0115] (2) Agrobacterium transformation and culture: 1-2 μL of successfully constructed transgenic plasmid (overexpression vector pTCK303-LA5 or LA5 RNAi vector) was added to Agrobacterium competent cells EHA105. After electroporation, it was cultured at 28°C for 1 h. Then it was uniformly coated on YEP solid medium containing 50 mg / L kanamycin and 25 mg / L rifampicin, and inverted at 28°C for 2 d. Agrobacterium monoclonal was picked and cultured in 1 mL YEP liquid medium containing 50 mg / L kanamycin and 25 mg / L rifampicin. After 9 h culture at 28°C, it was transferred to 50 mL YEP liquid medium containing 50 mg / L kanamycin, 25 mg / L rifampicin and 19.6 mg / L acetyl-piperitone. After 12 h overnight culture at 28°C, the bacterial body was collected by centrifugation at 3,000 rpm for 10 min, and resuspended with infiltration liquid for standby.

[0116] (3) Agrobacterium infection: the rice callus cultured on fresh NB medium for 4 days was transferred to a 100 mL sterile conical flask, and the resuspended Agrobacterium infection liquid was added. It was placed at room temperature for 20 min, and shaken every 5 min. The rice callus was taken out and the excess bacterial liquid on the surface was absorbed with sterile filter paper, and then placed on NB solid medium containing 100 μM acetyl-piperitone and covered with a layer of sterile filter paper, and cultured at 26°C in the dark for 2-3 d.

[0117] (4) Screening, differentiation and plant regeneration of resistant callus: the Agrobacterium-infected rice callus is transferred to NB medium containing 50 mg / L hygromycin for screening culture for 7 days, and then transferred to new selection medium for the next round of screening culture. After four rounds of such screening culture, the obtained resistant callus is placed on differentiation medium for about 30 days of differentiation. The differentiated rice seedlings are cut off the roots and placed on rooting medium for secondary rooting culture. When the rice seedlings grow to about 15 cm, they are transplanted to the test field after 7 days of hardening.

[0118] Among them, the rice in step (1) is Nipponbare, and the transgenic plasmid in step (2) is the overexpression vector pTCK303-LA5 or the LA5 RNAi vector. The T0 generation positive plants obtained by screening are named as follows:

[0119] The overexpression positive plants are named OE-1 and OE-2, respectively;

[0120] The RNAi positive plants are named RNAi-1 and RNAi-2, respectively.

[0121] The T0 generation positive plants are self-crossed to obtain T1 generation plants, which are seeded on 4% agar plates containing hygromycin. The roots that can grow and extend are homozygous T1 generation transgenic positive plants. The T1 generation transgenic positive plants are self-crossed to obtain T2 generation plants, which are used for phenotype determination.

[0122] 1.4, Phenotype determination

[0123] (1) Determination of LAZY5 gene relative expression in transgenic positive plants, determination of rice tillering angle and tiller number

[0124] Nipponbare, LAZY5 overexpression transgenic plants and RNA transgenic plants are respectively planted in the field, 6 rows of each material, 5 plants per row, and the plant spacing is 30 cm. The stem base RNA of the above plants is extracted at the seedling stage, reverse transcribed, and the expression of LAZY5 in transgenic plants is detected by using LAZY5 quantitative primers. The tillering angle and tiller number of rice and the relative expression of LAZY5 gene are counted at the adult stage. The internal reference gene Ubi is used as a reference, and the relative expression of LAZY5 gene is detected by qRT-PCR method. The primer sequences are as follows (5'-3'):

[0125] qUbi-F: AACCAGCTGAGGCCCAAGA;

[0126] qUbi-R: ACGATTGATTTAACCAGTCCATGA;

[0127] qLAZY5-F:ACCATGTACTACACCTGCTCCG;

[0128] qLAZY5-R:TTGTACCGCCGTCTCCCTGA.

[0129] Experimental results are as follows Figure 1 B, D and Figure 2 As shown in the figure. Phenotypic observation and statistical analysis showed that, compared with wild-type Nipponbare, the tillering angle, tiller number, and relative expression level of LAZY5 gene in the two LA5 overexpression lines were significantly greater than those in wild-type Nipponbare. The tillering angle, tiller number, and relative expression level of LAZY5 gene in the two LA5 RNAi lines were significantly smaller than those in wild-type Nipponbare.

[0130] The above results indicate that increasing the expression of the LAZY5 protein-coding gene can increase the tillering angle and tiller number in rice.

[0131] (2) Gravity response experiment

[0132] Gravity response experiment of rice seedlings: Approximately 100 plump and uniform rice seeds (wild-type Nipponbare and T2 generation OE-1, OE-2, RNAi-1, RNAi-2) were selected and placed in a 300mL Erlenmeyer flask. After adding water, the seeds were soaked in a 37℃ water bath. After 2-3 days, the uniformly germinated rice seeds were neatly sown on square petri dishes containing tilted solidified 0.4% agar and placed vertically in a rice culture room. When the rice seedlings grew to about 2.5cm, the position of the young stems was marked with a marker. After rotating 90° and placing them in the dark for 72 hours of gravity stimulation, the phenotype of the seedlings was recorded under light.

[0133] Experimental results are as follows Figure 1 As shown in C and E. Phenotypic observation and statistical analysis revealed that, compared with wild-type Nipponbare, the stem bending angles of both LA5 overexpression lines were significantly smaller than those of wild-type Nipponbare. Conversely, the stem bending angles of both LA5 RNAi lines were significantly higher than those of wild-type Nipponbare.

[0134] The above results indicate that increasing the expression of the LAZY5 protein-encoding gene can reduce the gravitational response of rice stems.

[0135] Table 1. Some sequences in this application

[0136]

[0137]

[0138]

[0139] The application has been described in detail. For those skilled in the art, the application can be implemented in a wider range under the same parameters, concentrations and conditions without departing from the spirit and scope of the application and without unnecessary experiments. Although the application gives a special example, it should be understood that the application can be further improved. In summary, according to the principle of the application, the application intends to include any change, use or improvement of the application, including the change made by the conventional technology known in the art, which is out of the range disclosed in the application.

Claims

1. A method of modulating tiller angle and / or tiller number in a plant, comprising, The method comprises regulating the expression amount of a gene encoding the LAZY5 protein in a recipient plant to regulate the tillering angle and / or the tiller number of the recipient plant; the LAZY5 protein is any one of the following proteins: a1), a protein with an amino acid sequence shown in SEQ ID No. 2; a2), a protein with an amino acid sequence shown in a1) after substitution, deletion and / or addition of amino acid residues, the protein having more than 80% identity with the amino acid sequence shown in a1) and being related to the tillering angle and / or the tiller number of a plant; a3), a fusion protein obtained by connecting a tag to the N-terminus or / and the C-terminus of a1) or a2).

2. The method of claim 1, wherein, The method comprises M1) or M2), M1), increasing the expression amount of a gene encoding the LAZY5 protein in a recipient plant to increase the tillering angle and / or the tiller number of the recipient plant; M2), decreasing the expression amount of a gene encoding the LAZY5 protein in a recipient plant to decrease the tillering angle and / or the tiller number of the recipient plant, the recipient plant containing a gene encoding the LAZY5 protein.

3. The method of claim 2, wherein, The expression amount of a gene encoding the LAZY5 protein in a recipient plant is increased by introducing a gene encoding the LAZY5 protein into the recipient plant; the expression amount of a gene encoding the LAZY5 protein in a recipient plant is decreased by introducing an RNA molecule and / or a DNA encoding the RNA molecule into the recipient plant, the RNA molecule inhibiting or decreasing the expression of a gene encoding the LAZY5 protein as claimed in claim 1.

4. The method of claim 3, wherein, The gene encoding the LAZY5 protein is any one of the following g1)-g3): g1), a DNA molecule with a coding sequence of SEQ ID No. 1; g2), a DNA molecule with a nucleotide sequence of SEQ ID No. 1; g3), a DNA molecule having more than 80% identity with the DNA molecule as claimed in g1) or g2) and regulating the tillering angle and / or the tiller number of a plant; The target sequence of the RNA molecule is SEQ ID No.

3.

5. The method according to claim 3 or 4, characterized in that, The gene and / or the DNA encoding the RNA molecule are introduced into a recipient plant in the form of a vector.

6. The method according to any one of claims 1-5, characterized in that, The plant is selected from monocotyledonous plants.

7. Use of the LAZY5 protein as claimed in claim 1 or a substance regulating the expression of a gene encoding the LAZY5 protein or a substance regulating the activity or content of the LAZY5 protein in any one of the following, A1), use in regulating the tillering angle of a plant; A2), use in preparing a product for regulating the tillering angle of a plant; A3), use in regulating the tiller number of a plant; A4), use in preparing a product for regulating the tiller number of a plant; A5), use in plant breeding or plant assisted breeding; A6), use in preparing a product for plant breeding or plant assisted breeding.

8. Use according to claim 7, characterized in that, The substance regulating the expression of a gene encoding the LAZY5 protein or the substance regulating the activity or content of the LAZY5 protein is a biological material, the biological material being any one of the following: B1), a nucleic acid molecule encoding the LAZY5 protein as claimed in claim 1. B2) an expression cassette comprising the nucleic acid molecule of B1); B3) a recombinant vector comprising the nucleic acid molecule of B1) or an expression cassette of B2); B4) a recombinant microorganism comprising the nucleic acid molecule of B1), or an expression cassette of B2), or a recombinant vector of B3); B5) a transgenic plant cell line comprising the nucleic acid molecule of B1), or an expression cassette of B2), or a recombinant vector of B3); B6) a transgenic plant tissue comprising the nucleic acid molecule of B1), or an expression cassette of B2), or a recombinant vector of B3); B7) a transgenic plant organ comprising the nucleic acid molecule of B1), or an expression cassette of B2), or a recombinant vector of B3); B8) a nucleic acid molecule that inhibits or reduces the expression of the LAZY5 protein-encoding gene of claim 1; B9) an expression cassette, a recombinant vector, a recombinant microorganism, a transgenic plant cell line, a transgenic plant tissue and / or a transgenic plant organ comprising the nucleic acid molecule of B8).

9. Use according to claim 8, characterized in that, The nucleic acid molecule of B1) is a DNA molecule according to any one of g1) to g3): g1) a DNA molecule whose coding sequence of the coding strand is SEQ ID No. 2; g2) a DNA molecule whose nucleotide sequence of the coding strand is SEQ ID No. 1; g3) a DNA molecule that has more than 80% identity with the DNA molecule of g1) or g2) and regulates the tiller angle of a plant; The nucleic acid molecule of B8) is an RNA molecule whose target sequence is SEQ ID No. 3 or a DNA that encodes the RNA molecule.

10. A method for obtaining a rice plant of interest having an increased tiller angle and / or tiller number, characterized in that, The method comprises introducing into a recipient rice a nucleic acid molecule that encodes the LAZY5 protein of claim 1 to obtain a rice plant with increased tiller angle and / or tiller number.

Images