Hypsizigus marmoreus strain

Abstract

The invention provides a hypsizigus marmoreus strain new variety Fujian No.7 (FB4), which is obtained by performing single spore hybridization on two different varieties of strains, namely Fujian No.3 and white beech mushroom, as parent strains, the sporocarp is clustered and white, pileus is hemispherical, the edge is adducted after maturation, marble stripes on the pileus are clear, the stipe length is moderate, the texture is harder, the hypsizigus marmoreus strain new variety is easy to preserve and transport, and the shelf life is prolonged; the method also has the characteristics of high yielding ability, high quality, strong disease resistance and the like, has excellent commodity characters, and has good production and application values.

Description

Technical Field

[0001] This invention relates to the field of edible fungi technology, specifically to a strain of *Hylocereus undatus*. Background Technology

[0002] True Plum Mushroom ( Hypsizygus marmoreus (Peck) HE Bigelow belongs to the kingdom Fungi, phylum Basidiomycotina, class Agaricomycetes, order Agaricales, family Lyophyllaceae, and genus *Heliconia*. Hypsizigus It is an edible fungus favored by consumers both domestically and internationally for its dual use as food and medicine. The shiitake mushroom has a unique umami flavor and rich nutritional value, offering benefits such as boosting immunity and lowering blood sugar, making it highly popular among consumers. Therefore, the shiitake mushroom industry, as part of the edible fungus industry, has broad development prospects due to its unique advantages. Shiitake mushrooms were introduced to my country around the 1970s and began artificial cultivation. Compared to other traditional edible fungi, shiitake mushrooms have lagged behind varieties like shiitake and wood ear in variety selection, resulting in relatively fewer dominant strains for industrial cultivation.

[0003] Currently, the most common methods for breeding *Pleurotus eryngii* are artificial selection breeding, hybridization breeding, and protoplast fusion breeding. Bao Zhuqin et al. domesticated the straw mushroom 'Pingyou No. 1' under low-temperature conditions and eventually bred the low-temperature resistant straw mushroom variety 'V20'. Liu Jianzhong et al. successfully screened a *Pleurotus eryngii* fusion strain 'Jinshan No. 1' with good production and application potential using the protoplast fusion breeding method.

[0004] Due to its inherent physiological characteristics, *Pleurotus eryngii* (also known as shiitake mushroom) is susceptible to environmental factors such as pests and diseases, and strain degeneration. With increasing emphasis on the edible mushroom industry in my country, more and more scholars are engaged in research and development of related technologies, leading to the gradual improvement of industrialized cultivation techniques for *Pleurotus eryngii*. However, research on the breeding of *Pleurotus eryngii* varieties during industrialized production is scarce. Therefore, breeding *Pleurotus eryngii* varieties with superior traits is particularly important. Nevertheless, overall, the current level of hybridization breeding is far from meeting the needs of the edible mushroom industry for new *Pleurotus eryngii* varieties. Summary of the Invention

[0005] This invention provides a strain of Pleurotus ostreatus, which is characterized by high yield, high quality, and strong disease resistance. The fruiting bodies are clustered, white, with hemispherical caps that taper inward after maturity, clear marbled patterns on the cap surface, wavy gills, moderately long and hard stipes, a small amount of downy hairs at the base, good uniformity in appearance, excellent commercial characteristics, and good production and application value.

[0006] In a first aspect of the present invention, a strain of *Hylocereus equi* is provided, named 'Minzhen No. 7' (FB4). The InDel marker of the strain of *Hylocereus equi* is located at 112bp-157bp, and the nucleotide sequence is TGCGGTGTTGGCCGGGCTCCCTGTTCAATTCTGCGATCATGACGGG. And / or the InDel marker of the *Hymenochaetus* strain is located at 169bp-237bp, with the nucleotide sequence TGTAATGATTGCTGAATCTTCGATTCTGCGCTGATACATACCCCAGTGTTCAGGAAGTGATTCGATGGT. And / or the InDel marker of the *Hylocereus undatus* strain is located at 205bp-212bp, with the nucleotide sequence TTCGTTCA; And / or the InDel marker of the *Hylocereus undatus* strain is located at 264bp-267bp, with the nucleotide sequence TCAA; And / or the InDel marker of the *Hylocereus undatus* strain is located at 335bp-339bp, with the nucleotide sequence ACATA.

[0007] Preferably, the *Hypsizygus mamoreus* strain was deposited on March 31, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.41872, located at Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The preservation classification and name are: *Hypsizygus mamoreus*.

[0008] Preferably, the cap of the *Pleurotus eryngii* is hemispherical, with the edges tapering inward after maturity, and the cap surface has clear marbled patterns.

[0009] Secondly, the present invention provides the application of the *Hylocereus undatus* strain described in the first aspect as a parent in the field of breeding.

[0010] Thirdly, the present invention provides the application of the *Hylocereus undatus* strain described in the first aspect in food processing.

[0011] Compared with the prior art, the *Hylocereus undatus* strain provided by this invention has at least the following beneficial effects: The new variety 'Minzhen No. 7' (FB4) provided by this invention was obtained by single-spore hybridization of two different strains, 'Minzhen No. 3' (BB) and 'White Jade Mushroom' (SC5), as parent strains.

[0012] The new variety 'Minzhen No. 7' (FB4) has clustered, white fruiting bodies with hemispherical caps that taper inwards when mature. The cap surface has clear marbled patterns, wavy gills, moderately long and relatively hard stipes, and a small amount of downy hairs at the base. The appearance is quite uniform.

[0013] In summary, the new variety 'Minzhen No. 7' (FB4) bred in this invention has the characteristics of high yield, high quality, and strong disease resistance, and has excellent commercial traits, indicating that this variety has good production and application value. Attached Figure Description

[0014] Figure 1 This is a comparison chart of the growth rates of hybrid varieties and their parents at different temperatures; Figure 2 These are comparison images of bacterial colonies between hybrid varieties and their parents at different temperatures; Figure 3 This is a comparison chart of mycelial diameter between hybrid varieties and their parents at different temperatures; Figure 4 This is a comparison chart of the number of clamp connections between hybrid varieties and their parents at different temperatures; Figure 5 It is a diagram of the antagonistic experiment between the selected varieties (FB series) and their parents; Figure 6 This is an appearance diagram of the fruiting agronomical characteristics of the new strain of Pleurotus eryngii, 'Minzhen 7' (FB4). Figure 7 This is a comparison chart of the fruiting characteristics between hybrid varieties and main cultivated varieties in different areas; Figure 8 This is a comparison chart of the characteristics of hybrid varieties and main cultivated varieties in a single bag; Figure 9 These are the PCR amplification results of the new strain of Pleurotus eryngii, 'Minzhen 7' (FB4) (left: amplification results of primers F24F and F24R; right: amplification results of primers F41F and F41R). Detailed Implementation

[0015] To make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be further described in detail below with reference to specific embodiments and accompanying drawings.

[0016] Test strains 'Minzhen No. 3' (No. BB): Minjianjun 2020008, independently bred by the Special Edible Fungus Variety Innovation and Metabolic Engineering Team of Fujian Agriculture and Forestry University; 'White Jade Mushroom' (SC5): The fruiting bodies were isolated by the Fujian Agriculture and Forestry University's Special Edible Fungus Variety Innovation and Metabolic Engineering Team and purchased from a mushroom company in Fuzhou by Yonghui Supermarket.

[0017] Main cultivated variety (HX-1, also known as 'factory control'): produced by a biotechnology company in Fujian and purchased commercially.

[0018] Example 1: Selection of strains The breeding of the new strain of Pleurotus eryngii, ‘Minzhen 7’ (FB4), specifically includes the following steps: The main cultivated *Pleurotus eryngii* strains BB and SC5 were selected as hybrid parents. Both parents were selected based on their rapid mycelial growth rate and the fact that all three generations were monokaryotic. After stable subculturing and observation of growth on PDA solid medium, 60 monokaryotic strains of BB and SC5 were initially screened. The growth rates of the 60 BB and SC5 monokaryotic strains on PDA solid medium in plates and on cultivation medium in test tubes were measured. Finally, four monokaryotic strains of BY and four monokaryotic strains of BB with different genotypes were selected. After mating the BB and SC5 monokaryotic mycelia, stability tests showed that all were dikaryotic hybrid mycelia, resulting in a total of six hybrid strains. In the antagonism test, FB4 showed significant antagonism with both parents; in terms of agronomic traits, FB4 had more buds than its parents; in terms of biological efficiency, FB4 and both parents achieved a result of over 1; in terms of yield, FB4 had the highest yield, reaching 98%; in terms of quality, FB4 had higher protein and amino acid content. FB4 was identified as the superior shiitake mushroom variety selected in this study and named "Minzhen No. 7".

[0019] Example 2: Comparative test between the new variety and its parents 2.1 Growth Rate Test The activated hybrid strains and parental strains were punched with a 0.8 cm punch and transferred to PDA solid medium, with 6 replicates per strain. They were incubated in the dark at 24°C. After 3 days, a cross was drawn with the inoculum block as the center. The diameter of the mycelial rings was measured and photographed daily to record the mycelial growth.

[0020] Statistical results show that FB4 has the fastest growth rate among all hybrid varieties, reaching 0.35 cm / d, which is higher than its parent SC5.

[0021] Subsequently, the test varieties were quantitatively inoculated into 90mm diameter petri dishes using a punch (5mm) on PDA solid medium. The petri dishes were then incubated in the dark at 10℃, 15℃, 20℃, 25℃, and 30℃ for 10 days, respectively. The colony diameter was measured, and seven replicates were performed. The mycelial growth status was photographed and recorded. Figure 1 , 2 At 10℃, the mycelial growth rate was the slowest, with no significant difference between the hybrid variety and the parent. At 25℃, the mycelial growth rate reached its fastest, with BB (6.98 mm / d) > FB4 (6.80 mm / d) > SC5 (5.88 mm / d), and the colonies were white and dense. The hybrid variety FB4 showed significantly better mycelial growth rate than the parent SC5, and was basically consistent with the parent BB.

[0022] like Figure 3 , 4As temperature increases, the mycelial diameter gradually decreases, but the hybrid variety exhibits a larger mycelial diameter than both parents between 10-25℃, reaching a maximum of 6.03μm. At the optimum temperature of 25℃, the hybrid variety shows a significantly higher number of clamp connections than its parents, indicating that the mycelium of the hybrid variety FB4 is stronger and superior to that of its parents.

[0023] 2.2 Antagonism Test After punching holes for the hybrid strain and the parent strain, they were transferred to PDA solid medium plates. The hybrid strain was placed in the middle, and the two parents were placed on the left and right sides of the hybrid strain, respectively. The distance between the bacterial blocks was 2.0 cm. The plates were placed in a constant temperature incubator at 24℃ and cultured in the dark. After the hyphae came into contact and cross-linked, the plates were cultured for another 7 days to observe the antagonistic effect.

[0024] Results of hybrid strain and parental antagonism experiments are as follows Figure 5 As shown, all hybrid varieties (FB1-FB6) have antagonistic protrusions directly or indirectly at the mycelial junction with their parents. The degree of difference between different varieties varies, and FB4 shows obvious antagonism with both parents.

[0025] 2.3 Yield and agronomic traits testing The hybrid strain and the parent strain were simultaneously cultured on a culture medium at 23-25℃ for 120 days, then transferred to a fruiting room and fruited at 14-18℃. Harvesting was carried out after 27 days. Agronomic traits such as primordia formation time (d), yield per bottle (uncut), yield per bottle (cut), fruiting days (d), yield of finished mushrooms per bottle (g), number of finished mushrooms per bottle, yield rate (%), cap color, stipe texture, and biological efficiency (%) were measured for different varieties.

[0026]

[0027] 2: Biological efficiency = ; 2.3.1 Production Analysis The yield analysis results of the eight *Pleurotus eryngii* varieties are shown in Table 1. It can be seen that among the *Pleurotus eryngii* varieties with white fruiting bodies, SC5 and FB4 had the same primordia formation time of 8 days. In terms of fruiting time, BB had the shortest fruiting period at 24 days, while SC5 and FB4 had fruiting times of 26 days. The longest difference in fruiting time between different varieties reached 3 days. In terms of biological efficiency, BB, SC5, and FB4 achieved a result above 1, with FB4 having the highest biological efficiency at 113% and an average yield of 67.50 g / bottle, exceeding its parents BB and SC5. In terms of yield, BB and FB4 had the highest yield, reaching 98%.

[0028] Table 18 Production Analysis of Pleurotus eryngii Varieties

[0029] Note: * indicates that no mushrooms have sprouted.

[0030] 2.3.2 Agronomic Trait Analysis Eight *Pleurotus eryngii* cultivars, including the selected varieties and their parents, were observed for their fruiting agronomical traits. Among the selected varieties, FB4 could produce fruiting bodies normally, with clustered fruiting bodies (e.g., ...). Figure 6 As shown in a); the stipe is of moderate length and relatively hard in texture (as shown in a). Figure 6 (as shown in b); the cap is white and hemispherical (as shown in b). Figure 6 (as shown in c and 6d). Furthermore, according to Table 2, among the white varieties, FB4 has a higher number of mushroom buds compared to its parent. Comparison of indicators such as mushroom length and diameter reveals that FB4 is quite similar to its parent, SC5.

[0031] Table 28 Agronomic Traits Analysis of Pleurotus ostreatus Varieties

[0032] Note: * indicates that no mushrooms have sprouted.

[0033] Example 3: Comparison between the new variety and the main cultivated variety The main cultivar selected in this embodiment is the production cultivar currently planted and sold by many enterprises, with an annual production of about 30 million bags of spawn. It has been recognized by the market. Therefore, by comparing it with the cultivar recognized by the market, it can be shown that 'Minzhen No. 7' (FB4) is not only a new cultivar, but also has actual economic value.

[0034] 3.1 Comparison of fruiting characteristics During the FB4 mycelial recovery stage, maintain the temperature at around 14-16℃, with an initial humidity of over 95% and a CO2 concentration of 3000ppm in the storage room. After the mycelium turns white, provide intermittent light at an intensity of 500Lx and a humidity of around 80%. During the fruiting body growth and development stage, maintain the temperature at 14-16℃, humidity at 90%, and a CO2 concentration of 3000-9000ppm, with intermittent light. See the fruiting images below. Figure 7 , 8 As shown.

[0035] FB4 fruiting bodies grow in clusters, are white, have hemispherical caps that taper inwards when mature, and have clear marble patterns on the cap surface. The gills are wavy, the stem is of moderate length and has a relatively hard texture. There are a few hairs at the base, and the appearance is quite neat. It has a delicious flavor when cooked and a smooth, crisp texture.

[0036] The main cultivated variety has clustered fruiting bodies that are white; the cap is hemispherical with clear marbled patterns on the surface; the gills are radial; and the stipe is thin, soft, and hairless.

[0037] 3.2 Comparison of main yield and quality traits 3.2.1 Production Comparison The yield and quality trait identification results of 'Minzhen No. 7' (FB4) at Fujian Fuquanxin Biotechnology Co., Ltd. are shown in Table 3. At 29 days of harvest, the average yield of fresh mushrooms with heads of the control variety (HX-1) was 597.53 g / bag; the average yield of mushrooms cut from heads was 563.37 g / bag. The average yield of fresh mushrooms with heads of FB4 was 676.77 g / bag; the average yield of mushrooms cut from heads was 638.73 g / bag, representing an 11.69% increase in yield compared to the control. As shown in Table 4, the yield increase of FB4 relative to the control variety (HX-1) was highly significant. P <0.01).

[0038] Table 3. Comparison of fruiting yield between the main cultivated variety (HX-1, control) and the new cultivar 'Minzhen 7' (FB4) of Pleurotus ostreatus.

[0039] Table 4. Results of Variance Analysis of Fruiting Yield Among Different Varieties

[0040] 3.2.2 Agronomic traits The agronomic traits of 'Minzhen No. 7' (FB4) and the main cultivated variety (HX-1) are shown in Table 5. At 28 days of harvest, the average cap diameter and height of the main cultivated variety were 1.83 cm and 1.00 cm, respectively; the average stipe length and diameter were 13.66 cm and 1.17 cm, respectively, with 96 high-quality mushrooms. At 28 days of harvest, the average cap diameter and height of FB4 were 1.98 cm and 1.34 cm, respectively; the average stipe length and diameter were 13.54 cm and 1.24 cm, respectively, with 92 high-quality mushrooms. As shown in Table 6, the cap height of FB4 was significantly different from that of the main cultivated variety (HX-1). P <0.01). Table 7 lists the results of visual comparison of agronomic traits between the main cultivated variety (control, HX-1) and the new cultivar FB4 of Pleurotus ostreatus.

[0041] Table 5. Comparison of agronomic traits between the main cultivated variety (control) and the new cultivar 'Minzhen 7' (FB4) of Pleurotus ostreatus.

[0042] Table 6. Results of analysis of variance on cap height among different varieties

[0043] Table 7. Comparison of visually observed agronomic traits between the main cultivated variety (control) and the new cultivar 'Minzhen 7' (FB4) of Pleurotus ostreatus.

[0044] Example 4 InDel Marker Analysis The total DNA extracted from FB4, BB, and SC5 *Pleurotus ostreatus* was sent to Sangon Biotech (Shanghai) Co., Ltd. for whole-genome sequencing. The Genome Anlysis Toolkit (GATK) software and the HaplotypeCaller algorithm were used for analysis. The genome sequences of BB and SC5 were compared with those of FB4 to obtain fragments of differentially expressed sequences.

[0045] Table 8 Primers for FB4 InDel fragment amplification

[0046] The PCR amplification results of *Hymenochys hymenopus* strain FB4 using different primers are as follows: Figure 9 As shown in Table 8, the two sets of specific primers can amplify single and specific bands. After sequencing alignment, the fragment amplified by primer 24 showed some differences between FB4 and SC5 sequences. Compared to SC5, FB4 contained two InDel sequences of lengths 46 bp and 69 bp. Similarly, after sequencing alignment, the fragment amplified by primer 41 showed some differences between FB4 and BB sequences. Compared to BB, FB4 contained a 9 bp InDel sequence and two differential sequences of lengths 4 bp and 5 bp located at different sites.

[0047] The above results were tested by the Institute of Edible Fungi, Fujian Academy of Agricultural Sciences, which issued a "DNA Fingerprint Detection Report for the New Variety of Pleurotus eryngii, Minzhen 7 (FB4)". The conclusion was: "There are significant differences in the DNA fingerprints of FB4, SC5 and BB, which can confirm that they are different varieties." The differential sequence information between FB4, SC5 and BB is shown in Table 9.

[0048] Table 9. Differential sequence information for FB4, SC5, and BB. The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above descriptions are merely specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A strain of *Pleurotus ostreatus*, named 'Minzhen No. 7', characterized in that... The InDel marker of the *Hymenochaetus* strain is located at 112bp-157bp, and the nucleotide sequence is TGCGGTGTTGGCCGGGCTCCCTGTTCAATTCTGCGATCATGACGGG. And / or the InDel marker of the *Hymenochaetus* strain is located at 169bp-237bp, with the nucleotide sequence TGTAATGATTGCTGAATCTTCGATTCTGCGCTGATACATACCCCAGTGTTCAGGAAGTGATTCGATGGT. And / or the InDel marker of the *Hylocereus undatus* strain is located at 205bp-212bp, with the nucleotide sequence TTCGTTCA; And / or the InDel marker of the *Hylocereus undatus* strain is located at 264bp-267bp, with the nucleotide sequence TCAA; And / or the InDel marker of the *Hylocereus undatus* strain is located at 335bp-339bp, with the nucleotide sequence ACATA.

2. The *Hylocereus undatus* strain according to claim 1, characterized in that, The *Pleurotus ostreatus* strain was deposited on March 31, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.41872. The deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

3. The *Hylocereus undatus* strain according to claim 1 or 2, characterized in that, The cap of the *Pleurotus eryngii* mushroom is hemispherical, with the edges tapering inward after maturity, and the cap surface has clear marbled patterns.

4. The application of the *Hylocereus undatus* strain according to any one of claims 1-3 as a parent in the field of breeding.

5. The use of the *Hylocereus undatus* strain according to any one of claims 1-3 in food processing.

Images