Clostridium and application thereof in fermentation production of alcohol

Abstract

The invention discloses clostridium and application thereof in fermentation production of alcohol, and belongs to the technical field of industrial microorganisms. The clostridium is a carbon monoxide eating clostridium strain GG6, and is preserved in the China General Microbiological Culture Collection Center (CGMCC), the preservation number is CGMCC No.34975, and the preservation time is June 23, 2025. The clostridium is a carbon monoxide eating clostridium strain GG6 which is preserved in the China General Microbiological Culture Collection Center (CGMCC), the preservation number is CGMCC No.34975, and the preservation number is CGMCC No.34975. The carbon monoxide eating clostridium GG6 is obtained by enriching tail gas flue sediments of a coal chemical plant through an abundant culture medium, evolving a screening culture medium and sorting single bacteria, the bacterial strain is fermented by taking synthesis gas (CO / H2 / CO2) as raw material gas to generate acetic acid, ethanol, butyric acid and butanol, the thallus biomass OD600 is more than or equal to 6, the concentration of produced ethanol is more than or equal to 10g / L, the concentration of produced butanol is more than or equal to 2.5 g / L, and the concentration of produced butanol is more than or equal to 2.5 g / L; and commercialized implementation of butanol production through gas fermentation is facilitated.

Description

Technical Field

[0001] This invention relates to the field of industrial microbiology, specifically to a Clostridium and its application in the fermentation production of alcohols. Background Technology

[0002] Ethanol and butanol are both important bulk chemicals that can be used directly as fuel additives and are also raw materials for the production of aviation kerosene (SAF). In traditional processes for producing ethanol by yeast fermentation and butanol by solvent-producing Clostridium fermentation, the cost of raw materials such as starch, molasses, and straw sugar can account for more than half of the total production cost, and there is also the issue of competition with human resources for food. In industrial processes such as coal chemical, steel, metallurgy, and coking, as well as in biomass or solid waste gasification processes, a large amount of carbon-containing gases (such as CO2, CO, and CH4) that are not converted to high-value forms are generated. Using these carbon-containing gases as alternative carbon sources for fermentation is a more sustainable and low-carbon footprint option.

[0003] Acetic acid-producing bacteria are a class of anaerobic microorganisms that can autotrophically produce acetic acid using syngas components (CO, CO2, and H2) via the Wood-Ljungdahl pathway. Some strains can also produce ethanol, butyric acid, butanol, lactic acid, 2,3-BDO, and other partial products. Furthermore, the microbial protein obtained from the fermented cells after centrifugation and drying can replace soybean meal in livestock, poultry, and aquaculture. Therefore, gas fermentation technology that uses acetic acid-producing bacteria to ferment syngas to produce higher value-added chemicals and co-produce microbial protein has attracted attention. Among these, *Clostridium autoethanogenum* has been commercially applied to co-produce ethanol and microbial protein from tail gas containing CO, CO2, and H2 from the iron and steel and ferroalloy industries, complementing existing ethanol fermentation production technologies. Some acetic acid-producing bacteria, such as *C. carboxidivorans* P7 and P20 and *C. muellerianum* P21, produce not only acetic acid and ethanol but also longer-chain butyric acid and butanol. Butyric acid can be used in animal husbandry to improve gut health, enhance immunity, and improve feed utilization. Acetone-butanol-ethanol (ABE) fermentation by Clostridium solubilizing agents is a traditional butanol fermentation process, but it has been discontinued due to its low economic viability caused by high raw material costs and low substrate conversion rates.

[0004] The aforementioned Clostridium species provide a novel method for the fermentation production of butanol using gaseous fermentation technology. However, existing laboratory strains exhibit poor tolerance to syngas, and the biomass (0.5 g / L dry weight, OD) during the fermentation process is limited. 600 The yield and proportion of butanol are relatively low (approximately 2%). Improving the growth and fermentation performance of existing laboratory strains, or screening for new strains with fast growth rates and good robustness, is key to promoting the commercial application of butanol production using gaseous fermentation technology. Summary of the Invention

[0005] Technical problem solved: To address the issues of low biomass and insufficient ethanol and butanol production by existing gas fermentation strains, this invention provides a Clostridium and its application in alcohol fermentation. This strain exhibits high biomass during syngas fermentation, along with high ethanol and butanol production, which will help promote the commercialization of butanol production through gas fermentation.

[0006] Technical solution: In the first aspect, the present invention provides a Clostridium carboxidivorans GG6, which has the accession number CGMCC No.34975.

[0007] This invention relates to a carbon monoxide-eating Clostridium GG6 strain obtained from the enrichment and sorting of flue gas sediments from a coal chemical plant. Experiments revealed that this strain exhibits high biomass during syngas fermentation, along with high yields of ethanol and butanol.

[0008] Preferably, the carbon monoxide-eating Clostridium GG6 is rod-shaped, Gram-positive, 0.6-0.8 μm × 2.2-8.1 μm, and arranged singly or in pairs.

[0009] Preferably, the nucleotide sequence of the 16S rDNA of the carbon monoxide-eating Clostridium gammaecum GG6 is shown in SEQ ID NO: 1.

[0010] Secondly, the present invention provides a bacterial agent comprising the above-mentioned Clostridium carbon monoxide-eating GG6.

[0011] The inoculum agent of Clostridium carbon monoxide-eating GG6 described in this invention can be in liquid or solid form.

[0012] Preferably, Clostridium carbon monoxide-eating GG6 can be cultured to prepare a bacterial suspension, or the bacterial suspension can be further prepared into a solid bacterial agent for subsequent gaseous fermentation production of alcohol.

[0013] Thirdly, the present invention provides the application of the above-mentioned Clostridium carbon monoxide-eating GG6 or the above-mentioned bacterial agent in the production of alcohols by gas fermentation.

[0014] Preferably, the products of gas fermentation also include acids, namely butyric acid and acetic acid, and alcohols, namely ethanol and butanol. The raw materials for gas fermentation include CO, CO2 and H2, and the fermentation conditions are: fermentation temperature of 30-37℃ and pH of 5.0-6.0.

[0015] Preferably, the volume fractions of CO, CO2, and H2 are 10%-70%, 2%-30%, and 5%-70%, respectively.

[0016] Preferably, the volume ratio of CO, CO2 and H2 is 30:5:65.

[0017] Fourthly, the present invention provides a method for producing alcohol by fermentation, wherein the above-mentioned Clostridium carbon monoxide-eating GG6 or the above-mentioned inoculum is first inoculated into a nutrient-rich Clostridium culture medium, and after anaerobic growth to the logarithmic phase, it is transferred to a nutrient-limited Clostridium culture medium. After anaerobic culture to the logarithmic phase in the presence of CO, CO2 and H2 syngas, it is transferred to a bioreactor (such as a stirred reactor) filled with syngas. The reactor is filled with nutrient-limited Clostridium culture medium. After inoculation, CO, CO2 and H2 syngas are continuously introduced during the fermentation process. The mixture is cultured for 24-96 h at a temperature of 30-37℃ and a pH of 5.0-6.0 to obtain the final products acetic acid, ethanol, butyric acid and butanol.

[0018] Preferably, the nutrient-rich Clostridium culture medium comprises: 5 g / L yeast extract, 10 g / L tryptone, 1 g / L potassium chloride, 1 g / L sodium acetate, 5 g / L glucose, 5 g / L fructose, 0.5 g / L L-arginine, and 0.5 g / L L-cysteine.

[0019] Preferably, the nutrient-limited Clostridium culture medium comprises: NH4Cl, 1.0 g / L; KH2PO4, 1.5 g / L; K2HPO4, 0.5 g / L; MgCl2·6H2O, 0.2 g / L; CaCl2·2H2O, 0.02 g / L; 100x trace element stock solution: 1 ml / L; 1000x vitamin stock solution: 1 ml / L; cysteine: 0.5 g / L; wherein the 100x trace element stock solution comprises: nitrilotriacetic acid, 10.0 g / L; (NH4)2SO4·FeSO4·6H2O, 4.0 g / L; MnSO4, 5.0 g / L; ZnSO4·7H2O, 1.0 g / L; CuCl2·2H2O, 0.1 g / L; NiCl2·6H2O, 0.1 g / L; CoCl2·6H2O, 1.0 g / L. g / L; Na2O4Se, 0.1 g / L; Na2MoO4·2H2O, 0.1 g / L; Na2WO4·2H2O, 0.1 g / L; 1000x vitamin stock solution includes: calcium pantothenate, 50.0 mg / L; lipoic acid, 50.0 mg / L; vitamin B6: 100 mg / L; thiamine, 50.0 mg / L; vitamin B2, 50 mg / L; biotin, 20.0 mg / L; folic acid, 20.0 mg / L; para-aminobenzoic acid, 50.0 mg / L; nicotinic acid, 50.0 mg / L; vitamin B12, 50.0 mg / L.

[0020] Specifically, the final product of *Clostridium carbon monoxide-eating* GG6 fermented with syngas (30% CO, 5% CO2, 65% H2) for 96 h, provided by this invention, has a biomass OD... 600≥6, Ethanol concentration ≥10g / L, Acetic acid concentration ≤3g / L, Butyric acid concentration ≤1.2g / L, Butanol concentration ≥2g / L.

[0021] Beneficial effects: This invention enriches and sorts a carbon monoxide-eating Clostridium strain GG6 from flue gas sediments of a coal chemical plant. Compared with previously reported experimental strains, this strain exhibits a higher biomass (OD) for syngas fermentation. 600 ≥6), while having high ethanol production (≥10 g / L) and butanol production (≥2 g / L), which helps to promote the commercialization of butanol production by gaseous fermentation.

[0022] Instructions for the preservation of biological materials:

[0023] The Clostridium carboxidivorans GG6 provided by this invention is deposited at the China General Microbiological Culture Collection Center (CGMCC); address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing; accession number: CGMCC No. 34975; deposit date: June 23, 2025. Attached Figure Description

[0024] Figure 1 The image shows the microscopic morphology of Clostridium carbon monoxide-eating GG6 in an embodiment of the present invention.

[0025] Figure 2 The figure shown is a liquid chromatogram of the product of the gaseous fermentation broth of Clostridium carbon monoxide GG6 in an embodiment of the present invention.

[0026] Figure 3 The figure shows the biomass (OD) of *Clostridium carbon monoxide-eating* GG6 during gaseous fermentation in a fermenter in an embodiment of the present invention. 600 The curve showing how the curve changes over time;

[0027] Figure 4 The figure shows the curve of the product of gaseous fermentation of Clostridium carbon monoxide-eating GG6 in a fermenter over time in an embodiment of the present invention.

[0028] Figure 5 The figure shows the curve of the product change over time of the control strain Clostridium carbon monoxide-eating P7 fermented in a fermenter in an embodiment of the present invention. Detailed Implementation

[0029] The following specific examples illustrate the implementation of the present invention. These examples are provided only to illustrate the present invention and are not intended to limit the scope of the present invention.

[0030] Unless otherwise specified, the materials, chemical reagents, instruments and equipment used in this application can be purchased commercially or prepared by existing methods, and the technical means used in the examples are conventional means used by those skilled in the art.

[0031] This application provides a carbon monoxide-eating Clostridium carboxidivorans GG6, with accession number CGMCC No.34975 and accession date of June 23, 2025.

[0032] The carbon monoxide-eating Clostridium GG6 is rod-shaped, Gram-positive, 0.6-0.8 μm × 2.2-8.1 μm, and arranged singly or in pairs.

[0033] In some embodiments, the nucleotide sequence of the 16S rDNA of the carbon monoxide-eating Clostridium gammaecum GG6 is shown in SEQ ID NO: 1.

[0034] In some embodiments, the carbon monoxide-eating Clostridium GG6 utilizes the biomass OD generated by syngas fermentation. 600 ≥6, ethanol concentration ≥10 g / L, butanol concentration ≥2 g / L.

[0035] The implementation process of the present invention will be further described in detail below with reference to the embodiments and accompanying drawings. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the present application.

[0036] Example 1: Isolation of Clostridium strains from sediments

[0037] In an anaerobic glove box, 2 g of tail gas flue sediment from a coal chemical plant (Xinxiang Zhongxin Chemical Co., Ltd., Xinxiang, Henan) was dissolved in a centrifuge tube containing 25 ml of sterile water, shaken to mix, and 1 ml of sediment suspension was inoculated into a blue-capped bottle containing 50 ml of nutrient-enriched Clostridium perfringens medium (YTDF medium). After anaerobic culture at 37℃ for 72 h, another 1 ml of culture was inoculated into fresh YTDF medium and anaerobic cultured at 37℃ for 48 h to obtain nutrient-enriched culture. The nutrient-enriched culture was transferred to a serum bottle containing 20 ml of nutrient-limited Clostridium monoxide medium (PETC). The serum bottle was filled with 1 bar of syngas (30% CO, 5% CO2, 65% H2, % being volume fractions) and incubated at 37°C and 100 rpm for 48 h on a shaker. The culture was transferred to the same serum bottle medium three times consecutively to obtain syngas-grown cultures. These cultures were diluted 10-5 times and spread onto PETC solid plates supplemented with 1.5 wt% agar. The plates were incubated in an anaerobic tank filled with syngas for 96 h to obtain single colonies. Single colonies were picked and purified by streak plating in four zones. This process was repeated three times to obtain a pure culture strain, which was named *Clostridium carbon monoxide-eating* GG6.

[0038] The YTDF culture medium consists of: 5 g / L yeast extract, 10 g / L tryptone, 1 g / L potassium chloride, 1 g / L sodium acetate, 5 g / L glucose, 5 g / L fructose, 0.5 g / L L-arginine, 0.5 g / L L-cysteine, and pH adjusted to 6.0.

[0039] The PETC culture medium components include: NH4Cl, 1.0 g / L; KH2PO4, 1.5 g / L; K2HPO4, 0.5 g / L; MgCl2·6H2O, 0.2 g / L; CaCl2·2H2O, 0.02 g / L; trace element storage solution (100x): 1 ml / L; vitamin storage solution (1000x): 1 ml / L; cysteine: 0.5 g / L; pH adjusted to 6.0 with 20% NaOH. The trace element storage solution (100x) formula is as follows: aminotriacetic acid, 10.0 g / L; (NH4)2SO4·FeSO4·6H2O, 4.0 g / L; MnSO4, 5.0 g / L; ZnSO4·7H2O, 1.0 g / L; CuCl2·2H2O, 0.1 g / L; NiCl2·6H2O, 0.1 g / L; CoCl2·6H2O, 1.0 g / L; Na2O4Se, 0.1 g / L; Na2MoO4·2H2O, 0.1 g / L; Na2WO4·2H2O, 0.1 g / L. After preparation, adjust the pH to 6.0. Filter for sterilization. Store at 4℃. The vitamin stock solution (1000x) formula is as follows: calcium pantothenate, 50.0 mg / L; lipoic acid, 50.0 mg / L; vitamin B6, 100 mg / L; thiamine, 50.0 mg / L; vitamin B2, 50 mg / L; biotin, 20.0 mg / L; folic acid, 20.0 mg / L; para-aminobenzoic acid, 50.0 mg / L; nicotinic acid, 50.0 mg / L; vitamin B12, 50.0 mg / L.

[0040] Example 2: Identification of Clostridium carbon monoxide-ingesting GG6

[0041] (1) Morphological identification

[0042] Microscopic observation revealed that the carbon monoxide-eating Clostridium gammaecum GG6 cells in Example 1 were rod-shaped, Gram-positive, 0.6-0.8 μm × 2.2-8.1 μm, and arranged singly or in pairs. The microscopic morphology of Clostridium gammaecum GG6 is shown in [Figure number missing]. Figure 1 .

[0043] (2) 16S rDNA identification

[0044] Clostridium carbon monoxide-eating (CCO)-GG6 was inoculated into YTDF medium and anaerobically cultured at 37°C for 24 h. One ml of culture was collected by centrifugation, and the GG6 genome was extracted using a bacterial genome extraction kit. The 16S rDNA of the GG6 genome was amplified using primers 27F and 1492R: Primer 27F: AGAGTTTGATCCTGGCTCAG (SEQ ID NO: 2), Primer 1492R: GGTTACCTTGTTACGACTT (SEQ ID NO: 3). The PCR amplification system (total 50 μL) consisted of: 25 μL of 2×PCR premix, 1 μL of primer F (10 μmol / L), 1 μL of primer R (10 μmol / L), 2 μL of bacterial genome, and diluted to 50 μL with pure water. Amplification program: 94℃ pre-denaturation for 5 min, 98℃ denaturation for 10 s, 55℃ annealing for 45 s, 72℃ extension for 1.5 min, for a total of 30 cycles; final extension at 72℃ for 10 min; reaction terminated at 4℃. 16S rDNA sequencing: The PCR products were detected by gel electrophoresis and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The 16S rDNA sequence of *Clostridium carbon monoxide-eating* GG6 is shown in SEQ ID NO: 1.

[0045] The 16S rDNA sequence of Clostridium carbon monoxide-eating GG6:

[0046]

[0047] Example 3: Detection of metabolites from Clostridium carbon monoxide-ingesting GG6

[0048] Clostridium carbon monoxide-eating GG6 was inoculated into YTFD medium tubes and anaerobically cultured at 37℃ for 36 h. The fermentation products were then analyzed. After centrifugation at 12000 rpm, the supernatant was filtered through a 0.22 μm membrane and analyzed by HPLC (Agilent 1260). The chromatographic column was Bio-Rad HPX-87H (300 × 7.8 mm, 9 μm), the mobile phase was 5 mM sulfuric acid aqueous solution, the flow rate was 0.6 ml / min, the column temperature was 55℃, a differential detector was used, and the injection volume was 10 μL. Results are as follows: Figure 2 As shown, the main components of the fermentation products are acetic acid, ethanol, butyric acid, and butanol.

[0049] Example 4: Gas fermentation of Clostridium carbon monoxide-eating GG6 in a fermenter

[0050] Clostridium carbon monoxide-eating strain GG6 and the laboratory control strain Clostridium carbon monoxide-eating strain P7 (DSMZ 15243) were inoculated into YTFD medium tubes and cultured anaerobically at 37°C until the logarithmic growth phase. After reaching this phase, the culture was transferred to PETC medium serum bottles, which were then filled with 1 bar of syngas (30% CO, 5% CO2, 65% H2) and cultured until the logarithmic growth phase. The culture was then transferred to 3L stirred-air reactors. Each 3L reactor contained 2L of PETC medium pre-added with approximately 1g / L acetic acid, and the pH was adjusted to 5.5 with ammonia. A 5% inoculum was inoculated, and syngas (30% CO, 5% CO2, 65% H2) was continuously aerated during fermentation. The aeration rate was 30 ml / min for the first 24 hours, gradually increasing to 150 ml / min and maintaining a stable rate. The pH was maintained at approximately 5.2 with ammonia during fermentation. During the 96-hour batch gas fermentation, the highest cell biomass of Clostridium carbon monoxide-eating strain GG6 reached OD200. 600 =6.33, while the laboratory control strain, Clostridium carbon monoxide-eating, P7, had the highest cell biomass, reaching OD. 600 =2.4 (e.g.) Figure 3 (As shown). The final products of *Clostridium carbon monoxide-eating* GG6 had an ethanol concentration of 10.4 g / L, an acetic acid concentration of 2.1 g / L, a butyric acid concentration of 1.2 g / L, and a butanol concentration of 2.5 g / L (as shown). Figure 4 As shown); the final product concentrations of the laboratory control strain *Clostridium carbon monoxide-eating* P7 were 1.8 g / L ethanol, 2.7 g / L acetic acid, 0.8 g / L butyric acid, and 0.4 g / L butanol (as shown). Figure 5 (As shown).

[0051] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A carbon monoxide-eating Clostridium ( Clostridium carboxidivorans GG6, characterized in that, Its accession number is: CGMCC No.34975.

2. The carbon monoxide-eating Clostridium GG6 according to claim 1, characterized in that, The carbon monoxide-eating Clostridium GG6 is rod-shaped, Gram-positive, 0.6-0.8 μm × 2.2-8.1 μm, and arranged singly or in pairs.

3. The carbon monoxide-eating Clostridium GG6 according to claim 1, characterized in that, The nucleotide sequence of the 16S rDNA of the carbon monoxide-eating Clostridium gammaecum GG6 is shown in SEQ ID NO:

1.

4. An inoculum containing the Clostridium carbon monoxide-eating GG6 as described in claim 1.

5. The application of the carbon monoxide-eating Clostridium GG6 of claim 1 or the inoculum of claim 4 in the production of alcohols via gaseous fermentation.

6. The application according to claim 5, characterized in that, The products of gas fermentation also include acids, namely butyric acid and acetic acid, and alcohols, namely ethanol and butanol. The raw materials for gas fermentation include CO, CO2 and H2. The fermentation conditions are: fermentation temperature of 30-37℃ and pH of 5.0-6.

0.

7. The application according to claim 6, characterized in that, The volume fractions of CO, CO2, and H2 are 10%-70%, 2%-30%, and 5%-70%, respectively.

8. A method for producing alcohol by fermentation, characterized in that, The carbon monoxide-eating Clostridium GG6 of claim 1 or the inoculum of claim 4 is first inoculated into a nutrient-rich Clostridium culture medium. After anaerobic growth to the logarithmic phase, it is transferred to a nutrient-limited Clostridium culture medium. After anaerobic culture to the logarithmic phase in the presence of CO, CO2 and H2 syngas, it is transferred to a bioreactor filled with syngas. The reactor is filled with nutrient-limited Clostridium culture medium. After inoculation, CO, CO2 and H2 syngas are continuously introduced during fermentation. The mixture is cultured for 24-96 h at a temperature of 30-37℃ and a pH of 5.0-6.0 to obtain the final products acetic acid, ethanol, butyric acid and butanol.

9. A method for producing alcohol by fermentation according to claim 8, characterized in that, The nutrient-rich Clostridium culture medium comprises: yeast extract 5 g / L, tryptone 10 g / L, potassium chloride 1 g / L, sodium acetate 1 g / L, glucose 5 g / L, fructose 5 g / L, L-arginine 0.5 g / L, and L-cysteine ​​0.5 g / L.

10. A method for producing alcohol by fermentation according to claim 8, characterized in that, The nutrient-limited Clostridium culture medium comprises: NH4Cl, 1.0 g / L; KH2PO4, 1.5 g / L; K2HPO4, 0.5 g / L; MgCl2·6H2O, 0.2 g / L; CaCl2·2H2O, 0.02 g / L; 100x micronutrient stock solution: 1 ml / L; 1000x vitamin stock solution: 1 ml / L; cysteine: 0.5 g / L; wherein the 100x micronutrient stock solution comprises: nitrilotriacetic acid, 10.0 g / L; (NH4)2SO4·FeSO4·6H2O, 4.0 g / L; MnSO4, 5.0 g / L; ZnSO4·7H2O, 1.0 g / L; CuCl2·2H2O, 0.1 g / L; NiCl2·6H2O, 0.1 g / L; CoCl2·6H2O, 1.0 g / L. g / L; Na2O4Se, 0.1 g / L; Na2MoO4·2H2O, 0.1 g / L; Na2WO4·2H2O, 0.1 g / L; 1000x vitamin stock solution includes: calcium pantothenate, 50.0 mg / L; lipoic acid, 50.0 mg / L; vitamin B6: 100 mg / L; thiamine, 50.0 mg / L; vitamin B2, 50 mg / L; biotin, 20.0 mg / L; folic acid, 20.0 mg / L; para-aminobenzoic acid, 50.0 mg / L; nicotinic acid, 50.0 mg / L; vitamin B12, 50.0 mg / L.

Images