NtWUN gene, expression product and expression vector thereof, and application of NtWUN gene in plant glandular hair development regulation

Abstract

The invention relates to an NtWUN gene as well as an expression product, an expression vector and application of the NtWUN gene in regulation and control of plant glandular hair development, and aims to solve the technical problems that the development mechanism of different types of epidermal hairs in plants (such as tobacco) is unknown and effective molecular regulation and control measures and utilization ways are lacked at present. According to the invention, an NtWUN gene for negatively regulating epidermal hair development is identified, a gene editing vector and an overexpression vector are constructed, and a gene editing homozygous strain and an overexpression homozygous strain are obtained through screening; tissue expression, MeJA response mode analysis, subcellular localization, plant phenotypic characteristic identification and the like show that the NtWUN can negatively regulate the occurrence of epidermal hair and influence the change of the total density of the epidermal hair, and the NtWUN has important application value in regulating the development process of the plant epidermal hair.

Description

Technical Field

[0001] This invention application relates to the field of assisted molecular breeding technology, and more particularly to a method NtWUN Genes, their expression products, expression vectors, and their applications in regulating plant glandular trichome development. Background Technology

[0002] Plant epidermal hairs ( Trichomes Glandular trichomes are hair-like appendages formed from the differentiation of epidermal cells, widely distributed on the surface of plant organs such as leaves, stems, flowers, and fruits. Based on their morphology, structure, and function, they can be divided into two main categories: glandular trichomes (secreting types) and non-glandular trichomes (non-secreting types), playing a crucial role in plant defense, environmental adaptation, and economic value. In tobacco plants (… Nicotiana tabacum L. In tobacco, the epidermal trichomes mainly include long-stalked glandular trichomes, short-stalked glandular trichomes, and protective trichomes. Long-stalked glandular trichomes not only serve as a natural physical barrier against adverse environmental conditions but also specifically synthesize and secrete various secondary metabolites such as terpenes and sucrose esters (important precursors of aroma substances in tobacco leaves), forming a chemical barrier. Short-stalked glandular trichomes primarily secrete hydrophobic alkanes and wax esters, forming a continuous waxy layer on the leaf surface (resisting insects and inhibiting transpiration). Long-stalked glandular trichomes focus on chemical defense (secreting insecticidal diterpenes), while short-stalked glandular trichomes emphasize physical barriers (waxy secretions + sticky secretions), and both work synergistically to enhance insect resistance. Therefore, increasing glandular trichome density is one of the key strategies for enhancing tobacco's stress resistance and improving the aroma quality of tobacco leaves.

[0003] WUN, a damage-inducing protein, belongs to the AP2 / ERF transcription factor family. The AP2 / ERF family (APETALA2 / ethyleneresponsive factor) is a key factor regulating plant growth, development, and hormone responses, playing a crucial role in meristematic dormancy and differentiation, leaf morphogenesis, and epidermal structure formation. Functional studies of cuticle / wax-related genes have revealed homologous genes in Arabidopsis. SHN Overexpression can increase stratum corneum permeability and alter epidermal hair density; WIN1 Overexpression can trigger wax accumulation and affect epidermal cell differentiation by regulating the expression of wax synthase genes. In tomatoes... Wow Genes activate wax synthesis genes ( SICER6、SIKCR1、SIPAS2 ) and transport genes ( SILTP This pathway promotes wax accumulation, and its knockout significantly inhibits wax synthesis, thereby affecting epidermal hair morphology. This suggests that the keratin / wax metabolism pathway may be involved in the regulation of epidermal hair development; however, the related mechanisms are unclear and there is a lack of effective regulatory methods and utilization pathways.

[0004] The information disclosed in this background section is intended only to enhance the understanding of the background technology of this disclosure and should not be construed as an admission or in any way implying that the information constitutes prior art known to those skilled in the art. Summary of the Invention

[0005] The inventor's preliminary research revealed that, NtJAZ 9 and NtWUN There is an interactive relationship. NtJAZ9 As a negative regulator of tobacco glandular trichome development, it is speculated that... NtWUN It plays a certain role in the development of tobacco epidermal hairs. Therefore, the present invention will subsequently improve upon ordinary tobacco... NtWUN Homologous cloning and expression pattern analysis were performed to observe... NtWUN The morphology of the epidermal hairs in transgenic plants is used to elucidate... NtWUN It lays the foundation for regulating the growth of epidermal hair.

[0006] The purpose of this invention is to provide a method for negative regulation of plant epidermal trichomes. NtWUN The aim is to discover genes and use them to construct gene editing vectors and overexpression vectors to transform plants, in order to solve the current technical problems of unclear mechanisms of plant epidermal hair formation and the lack of effective regulatory means and utilization pathways.

[0007] To solve the above-mentioned technical problems, the present invention adopts the following technical solution: Obtained from tobacco K326 NtWUN The full-length gene sequence was co-cloned, and two homologous sequences were named respectively. NtWUN- 1 and NtWUN-2 Subcellular localization analysis revealed NtWUN-1 and NtWUN-2 Localized in the cell nucleus; clearly defined using tissue expression and MeJA-induced expression analysis, etc. NtWUN It is a key gene involved in the negative regulation of tobacco epidermal hair formation.

[0008] This invention is the first to construct a gene editing vector. NtWUN- Cas and overexpression vector pC2300- NtWUN Subsequently, K326 was transformed to obtain transgenic homozygous lines, and the glandular hair type and density of the transgenic lines and control lines were studied.

[0009] The K326 negative regulation NtWUN Genes negatively regulate the development of trichomes in tobacco epidermis. Tissue expression patterns reveal that... NtWUN The gene is expressed to varying degrees in different tissues and organs of tobacco, with the highest expression level in leaves, followed by stems, epidermal hairs, and flowers, and the lowest expression level in roots. This indicates that the gene exhibits tissue-specific expression and may be involved in tobacco leaf development. Furthermore... NtWUN-2The relative expression levels in the above tissues were all higher than NtWUN-1 Under different concentrations of MeJA treatment, NtWUN-1 and NtWUN-2 The relative expression levels of MeJA gradually increased, reaching their highest levels 24 hours after treatment. NtWUN Strongly induced expression and time-sensitive, thus proving NtWUN It is a key component in the jasmonic acid signaling pathway, and its expression is strictly regulated by jasmonic acid signaling.

[0010] The NtWUN The gene, the expression product, or the expression vector is used in at least one of the following (1) to (8): (1) Negative regulation of plant epidermal hair development density or preparation of reagents for negative regulation of plant epidermal hair development density; (2) Negative regulation of plant glandular hair development density or preparation of reagents for negative regulation of plant glandular hair development density; (3) Negatively regulate the developmental density of long-stalked and / or short-stalked glandular hairs in plants, or prepare reagents that negatively regulate the developmental density of long-stalked and / or short-stalked glandular hairs in plants. (4) Breeding / identifying varieties / strains with relevant plant glandular hair density traits; (5) Construct transgenic plants with increased or decreased glandular hair density; (6) Enhance plant stress resistance or prepare reagents to enhance plant stress resistance; (7) To improve the aroma quality of plant leaves or to prepare reagents to improve the aroma quality of plant leaves; (8) Regulate the jasmonic acid signaling pathway or prepare reagents to regulate the jasmonic acid signaling pathway.

[0011] In some embodiments of this disclosure, NtWUN Gene downregulation or silencing significantly increases plant glandular hair density.

[0012] In some embodiments of this disclosure, the plants include tobacco and Arabidopsis thaliana.

[0013] In some embodiments of this disclosure, the plant stress resistance includes at least one of insect resistance, drought resistance, and ultraviolet radiation resistance.

[0014] A method for increasing the density of tobacco glandular trichomes is provided. NtWUN Specific segments of a gene ( NtWUN-1 269-288 bp NtWUN-2 Using ATAACCCGCAGAATGTTGGG (262-287 bp) as the target site, a gene editing vector was constructed to target and modify the gene. This vector was then transformed into recipient plants and cultured to obtain plant material with significantly increased glandular hair density.

[0015] This application involves cloning tobacco. NtWUN Genes were analyzed, their expression patterns were elucidated, and transgenic lines were constructed, revealing for the first time... NtWUN It functions as a negative regulator of epidermal hair development. Specific technical effects are as follows: 1. Breakthrough in gene function identification and regulatory mechanisms Key findings: Construction based on CRISPR-Cas9 gene editing technology NtWUN The mutant strain, through phenotypic analysis, was found to significantly increase the total density of tobacco epidermal trichomes (e.g., an increase of ≥40% in leaf glandular trichome density), providing the first [data / information / data]. NtWUN Direct genetic evidence for negative regulation of epidermal hair development; Mechanism association: confirmed through subcellular localization experiments NtWUN Located in the cell nucleus, and combined with its MeJA-induced activation, this study elucidates the molecular basis of its role as a nuclear transcription factor integrating the JA signaling pathway to regulate epidermal hair development, filling the gap in the current technology regarding the downstream mechanism of NtWUN-JAZ9 interaction.

[0016] 2. Innovation in research tools and breeding materials Tool Development: Successful Cloning of Tobacco NtWUN Genes, construct constitutive / inducible expression vectors and gene editing vectors, and provide a standardized genetic manipulation system for quantitatively regulating epidermal hair density; Material Creation: Acquisition NtWUN Stable genetic lines with overexpression and knockout exhibit gradient differences in epidermal hair density, providing key materials for elucidating the mechanism of epidermal hair morphogenesis.

[0017] 3. Application Value and Industry Prospects Foundations of Targeted Breeding: Based on NtWUN The negative regulatory function can be used to create new materials in high-density glandular trichome tobacco (such as enhancing insect resistance / metabolite accumulation) or low-density materials (such as improving tobacco processing quality) by editing this gene. Theoretical Mechanism Expansion: Establishing " NtWUN The regulatory network model of "JA signaling-wax synthesis-epidermal hair development" provides new targets for crop stress resistance and quality improvement. Attached Figure Description

[0018] Figure 1 Examples of embodiments in this application NtWUN-1 and NtWUN-2 Results of agarose gel electrophoresis.

[0019] Figure 2 Examples of embodiments in this application NtWUN-1 and NtWUN-2 Subcellular localization of fusion proteins.

[0020] Figure 3 Examples of embodiments in this application NtWUN-1 and NtWUN-2 The organizational expression pattern.

[0021] Figure 4 Examples of embodiments in this application NtWUN-1 and NtWUN-2 Expression analysis of responses after treatment with different concentrations of MeJA.

[0022] Figure 5 Examples of embodiments in this application NtWUN Sequence analysis results of gene-edited homozygous lines.

[0023] Figure 6 Examples of embodiments in this application NtWUN Sequence analysis results of overexpression homozygous lines.

[0024] Figure 7 K326 in the embodiments of this application NtWUN Gene-edited strains KO2 and KO20 and NtWUN Leaf epidermal trichome morphology of overexpression lines OE8 and OE9 was observed and statistically analyzed; significance was tested using the least significant difference method: *: 0.01 <P<0.05,**:P<0.01。 Detailed Implementation

[0025] The specific embodiments of the present invention will be described below with reference to the accompanying drawings and examples. However, the following examples are only used to illustrate the present invention in detail and do not limit the scope of the present invention in any way.

[0026] Unless otherwise specified, the plasmid vectors used in the following examples are all conventional commercial vectors; the reagents used are all commercially available conventional reagents; and the test methods used are all conventional methods unless otherwise specified.

[0027] Preliminary research findings of this invention NtWUN It is expressed in tissues such as tobacco leaves and epidermal trichomes, and is activated by MeJA. Therefore, this invention has completed the research. NtWUN Gene cloning was performed to pinpoint its location in the cell nucleus, and the genetic material was then used for identification. NtWUN It participates in regulating the formation of trichomes on the tobacco epidermis. The implementation of this invention will help clarify... NtWUN This study investigates the gene functions during the formation and development of epidermal hairs in tobacco, and provides a theoretical and material basis for the later creation of tobacco materials with different types and densities of glandular hairs.

[0028] Example 1 NtWUN Gene feature analysis This example uses homologous cloning technology, based on the genome sequence of the Solanaceae genome website (… https: / / solgenomics.net / tools / blast / Using the first strand of cDNA synthesized from total RNA reverse transcription of common tobacco K326 leaves as a template, the gene negatively regulating epidermal trichomes in K326 was amplified for the first time. NtWUN Two homologous sequences NtWUN-1 (Nitab4.5_0001592g0030.1) and NtWUN-2 (Nitab4.5_0004997g0010.1)( Figure 1 ),in, NtWUN-1 The coding region is 630 bp in length. NtWUN-2 The coding region is 636 bp in length, encoding 209 and 211 amino acids respectively. The nucleotide similarity between the two is 95.44%, and the amino acid sequence similarity is 97.63%.

[0029] Organizational expression pattern analysis revealed ( Figure 2 ), NtWUN-1 and NtWUN-2 The gene was expressed in tobacco roots, stems, leaves, flowers, and epidermal trichomes, showing a consistent trend. The highest expression level was observed in leaves, followed by stems, epidermal trichomes, and flowers, with the lowest expression level in roots, indicating tissue-specific expression of this gene. Furthermore, NtWUN-2 The relative expression levels in the above tissues were all higher than NtWUN- 1 .

[0030] K326 leaves were sprayed with MeJA solutions of different concentrations, and the effects of MeJA on the leaves were analyzed using real-time quantitative RT-PCR. NtWUN The effect of gene expression levels, the results showed that ( Figure 3 ), under different concentration treatments, NtWUN-1 and NtWUN-2 The relative expression level gradually increased under 200 μM MeJA hormone treatment. NtWUN-1 and NtWUN-2 The relative expression level was the highest; as time progressed, NtWUN-1 and NtWUN-2 The relative expression levels gradually increased, reaching their highest levels 24 hours after treatment, and NtWUN-2 The changes are more pronounced due to the influence of MeJA. This proves... NtWUN It is a component of the tobacco jasmonic acid signaling pathway, and its expression is regulated by jasmonic acid signaling.

[0031] Subcellular localization analysis revealed ( Figure 4 ), NtWUN -1-GFP and NtWUN The fluorescent signal of -2-GFP is only present in the cell nucleus, indicating that... NtWUN It is located in the cell nucleus.

[0032] Example 2 NtWUN Construction of transgenic materials Constructing gene editing vectors using the CRISPR / CAS system NtWUN- Cas, and simultaneously constructed the overexpression vector pC2300- using a double enzyme digestion method. NtWUN Then, it was introduced into tobacco using Agrobacterium-mediated leaf disc transformation.

[0033] Twenty-five positive plants (T0 generation) were obtained by PCR screening using the hygromycin resistance gene HYG. Based on... NtWUN-1 and NtWUN-2 Specific primers were designed before and after the target site to detect mutations. Sequencing analysis revealed mutations in T0 generation positive plants. NtWUN A total of 8 plants with base mutations in the sgRNA region were obtained, with a gene editing efficiency of 32%. Among them, 2 homozygous mutants with base insertions in the sgRNA region were obtained, and were named... NtWUN -KO2 and NtWUN -KO20. Sequencing of the T1 generation plants with gene mutation revealed ( Figure 5 A), where NtWUN Knock out plants KO2 and KO20 NtWUN-1 and NtWUN-2 The sgRNA regions all had a T base inserted. Protein translation prediction analysis of the sequences with the above base deletions revealed that this base insertion caused premature termination of the corresponding protein translation. Figure 5 B), ultimately leading to the loss of function of NtWUN-1 and NtWUN-2 proteins. Therefore, for NO 2 and NO Two individual plants were harvested for functional studies.

[0034] Based on the analysis results of organizational expression patterns, it can be concluded that... NtWUN-2 The relative expression levels in all tissues were higher than NtWUN-1 ,illustrate NtWUN-2 Because it is likely to perform a major function within the plant, NtWUN-2 was chosen as the sequence for constructing the gene overexpression vector. The successfully constructed pC2300- NtWUN-2 -GFP vector was transferred into Agrobacterium tumefaciens and then into K326 sterile seedlings via tobacco leaf disc transformation to obtain transgenic plants. DNA was extracted from the transgenic plants, and the kanamycin resistance genes NPTII-F / R, 35S-F, and pC2300- were used to detect the transgenic plants. NtWUN-2 -R primers were used for PCR amplification to determine whether the target gene had been inserted into the tobacco genome, and nine positive plants with vector resistance were obtained through screening. Figure 6 A). For selection NtWUN Functional analysis was performed on positive plants with high transcription levels. RNA was extracted from leaves of the same location in the control K326 and nine positive plants, respectively. NtL25 qRT-PCR analysis was performed on the internal reference gene. NtWUN The relative expression levels of the target gene in overexpression plants OE8 and OE9 were 22.78 times and 19.29 times that of K326, respectively. Figure 6 B), the offspring of these two single plants and their T1 generation were selected for further in-depth gene function analysis.

[0035] Example 3 NtWUN Functional verification of negative regulation of tobacco epidermal trichomes Randomly select K326, NtWUN -OE8、 NtWUN -OE9、 NtWUN -KO2、 NtWUN -KO20 seedlings at the six-leaf-one-heart stage were selected, and leaves of uniform size were placed under a super depth-of-field microscope for observation and density analysis of leaf epidermal hairs. Figure 7 Under normal growth conditions, compared with the control K326, there was no change in the type of epidermal trichomes on the leaf surface of different plants; all were composed of long-stalked glandular trichomes, short-stalked glandular trichomes, and non-secreting epidermal trichomes, indicating that... NtWUN The expression of this compound had no effect on the type of epidermal trichomes on tobacco leaves. Statistical analysis of epidermal trichome density revealed that overexpressing this compound affected plants... NtWUN -OE8、 NtWUN - The total density of epidermal trichomes on the leaf surface of OE9 was significantly reduced, with a significant decrease in the density of long-stalked and short-stalked glandular trichomes. The density decreased by 37.50% and 35.71% in OE8 plants, respectively, and by 43.75% and 50.00% in OE9 plants, respectively; knockout plants... NtWUN -KO2、 NtWUN The total density of epidermal trichomes on the leaf surface of KO20 plants increased significantly, with a significant increase in the density of long-stalked and short-stalked glandular trichomes. The density of KO2 plants increased by 50.00% and 57.14%, respectively, while that of KO20 plants increased by 56.25% and 42.86%, respectively. There was no significant change in the density of non-secretory epidermal trichomes. These results indicate... NtWUN Genes negatively regulate the density of glandular hairs in both long and short stalks of tobacco plants.

[0036] The above embodiments are preferred embodiments of this application. However, those skilled in the art will understand that the embodiments of this application are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of this invention should be considered equivalent substitutions and are included within the protection scope of this application.

Claims

1. A kind NtWUN The gene, whose nucleotide sequence is shown in SEQ ID NO.1 or SEQ ID NO.

2.

2. The claim 1 NtWUN The expression product of the gene has an amino acid sequence as shown in SEQ ID NO.3 or SEQ ID NO.

4.

3. An expression vector comprising the content described in claim 1 NtWUN Genes or fragments thereof.

4. The expression vector according to claim 3, characterized in that, It is a gene editing vector used for plant genetic transformation. NtWUN- Cas or overexpression vector pC2300- NtWUN .

5. The claim 1 NtWUN The use of the gene, the expression product of claim 2, or the expression vector of claim 3 in at least one of the following (1) to (8): (1) Negative regulation of plant epidermal hair development density or preparation of reagents for negative regulation of plant epidermal hair development density; (2) Negative regulation of plant glandular hair development density or preparation of reagents for negative regulation of plant glandular hair development density; (3) Negatively regulate the developmental density of long-stalked and / or short-stalked glandular hairs in plants, or prepare reagents that negatively regulate the developmental density of long-stalked and / or short-stalked glandular hairs in plants. (4) Breeding / identifying varieties / strains with relevant plant glandular hair density traits; (5) Construct transgenic plants with increased or decreased glandular hair density; (6) Enhance plant stress resistance or prepare reagents to enhance plant stress resistance; (7) To improve the aroma quality of plant leaves or to prepare reagents to improve the aroma quality of plant leaves; (8) Regulate the jasmonic acid signaling pathway or prepare reagents to regulate the jasmonic acid signaling pathway.

6. The application according to claim 5, characterized in that, make NtWUN Gene downregulation or silencing significantly increases plant glandular hair density.

7. The application according to claim 5, characterized in that, The plants mentioned include tobacco and Arabidopsis thaliana.

8. The application according to claim 5, characterized in that, The plant's stress resistance includes at least one of insect resistance, drought resistance, and ultraviolet radiation resistance.

9. A method for increasing the density of tobacco glandular trichomes, characterized in that, Includes the following steps: (1) with NtWUN Using the gene-specific fragment ATAACCCGCAGAATGTTGGG as the target site, a gene editing vector for targeted modification of the gene was constructed. (2) The gene-editing vector is transformed into recipient tobacco to enable... NtWUN Gene silencing or downregulation of expression; (3) Select positive tobacco plants for cultivation to obtain plant materials with significantly increased glandular hair density.

Images