Rape grain weight regulation gene NGAL3 based on whole genome screening and breeding application thereof

Abstract

The invention discloses a rape grain weight regulation gene NGAL3 based on whole genome screening and a breeding application thereof, based on the seed size and grain weight phenotypic value of a cabbage type rape germplasm resource, a candidate gene interval is positioned by using GWAS; the method comprises the following steps: selecting large-grain-weight and small-grain-weight extreme phenotypic materials, performing transcriptome sequencing in a critical period of seed development, and screening differential expression genes; and performing cross comparison on the GWAS candidate gene and the differential expression gene to obtain a key gene for jointly regulating and controlling the size and the grain weight of the seed, and performing functional verification on the key gene. The thousand seed weights of the created homozygous three mutant strains L1-sg1-1-4-5 and L2-sg1-4-8-16 are obviously increased by 46% and 29% compared with those of the wild type strains. The invention provides a new target for high-yield rape breeding, and non-transgenic high-grain-weight germplasm can be created through gene editing or beneficial allelic variation of NGAL3 is selected and enriched under the assistance of molecular markers.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering, specifically to a method for screening key genes for seed traits using GWAS-RNA-seq and creating high-grain-weight rapeseed mutants using CRISPR / Cas9. Background Technology

[0002] rape( Brassica napus Rapeseed (L.) is my country's largest oilseed crop, with a vast annual planting area. Seed size and weight are core factors determining rapeseed yield; larger and plumper seeds can increase yield per unit area and reduce field losses by enhancing seedling resistance. However, the thousand-seed weight of current mainstream rapeseed varieties is generally below 4.0 grams, indicating significant room for improvement.

[0003] Traditional breeding relies on phenotypic selection to improve seed traits, but due to the characteristics of multi-gene micro-regulation (involving pathways such as cell expansion and nutrient transport) and environmental interaction effects, the efficiency of single-trait selection is less than 5%, and the breeding cycle is as long as 8-10 years.

[0004] In recent years, genomic technologies have provided new pathways for accelerating genetic analysis: genome-wide association studies (GWAS) can uncover quantitative trait loci (QTLs) regulating grain weight, and RNA sequencing (RNA-seq) can capture expression networks during critical stages of seed development. However, existing studies mostly focus on single-omics methods, and the lack of multi-omics cross-validation leads to high false-positive rates for candidate genes, and functional causality verification has not been performed on most genes. It is worth noting that in Arabidopsis thaliana... NGAL3 The gene (At5g06250) is involved in regulating cell division, but its allelic variation effect and regulatory mechanism on seed size in rapeseed have not been reported. Searches in public databases (NCBI, BRAD) show significant natural variation in the promoter region of the NGAL3 homolog gene (BnaA03 / A10 / C09.NGAL3) in Brassica napus. Although existing technologies, such as patent application CN118360297A which discloses a method for creating high-yielding rapeseed germplasm by editing BnaIAA10 using CRISPR / Cas9, and patent application CN115820912A which uses a combination of RNA-seq, GWAS, and QTL mapping to screen a series of candidate genes associated with traits related to the harvest index of Brassica napus, identifying 47 major candidate genes related to rapeseed seed yield, mainly involving metabolic pathways such as seed development and oil synthesis, have yet to be fully understood. (1) Empirical evidence of gene screening based on genome-transcriptome joint analysis; phenotypic verification of CRISPR / Cas9-mediated gene editing; (2) Clarify the functional evidence of this gene negatively regulating seed size.

[0005] (3) The above-mentioned technological gaps have seriously hindered the progress of molecular design breeding of high-yield rapeseed. Summary of the Invention

[0006] In response to the low breeding efficiency, high false positive rate of candidate genes, and other issues mentioned in the background art regarding high-yield rapeseed breeding, NGAL3 Addressing core issues such as unknown functions, this invention provides a method for screening key genes for seed traits based on multi-omics cross-validation, and for the first time confirms this through gene editing. NGAL3 It has the function of negatively regulating the size of rapeseed seeds.

[0007] The specific plan includes: This invention provides NGAL3 The application of genes and their encoded proteins in regulating rapeseed seed size and grain weight, the aforementioned NGAL3 The gene is from Brassica napus. BnaA10.NGAL3 , BnaA03.NGAL3 and / or BnaC09.NGAL3 ; The gene sequences are shown in SEQ ID NO.1, SEQ ID NO.3, and SEQ ID NO.5, respectively. NGAL3 The amino acid sequences of the protein encoded by the gene are shown in SEQ ID NO.2, SEQ ID NO.4, and SEQ ID NO.6, respectively.

[0008] The present invention also provides NGAL3 The application of genes and their encoded proteins in the preparation of drugs to improve rapeseed seed size and grain weight, the aforementioned NGAL3 The gene is from Brassica napus. BnaA10.NGAL3 , BnaA03.NGAL3 and / or BnaC09.NGAL3 ; The gene sequences are shown in SEQ ID NO.1, SEQ ID NO.3, and SEQ ID NO.5, respectively. NGAL3 The amino acid sequences of the protein encoded by the gene are shown in SEQ ID NO.2, SEQ ID NO.4, and SEQ ID NO.6, respectively. When applying, rapeseed NGAL3 Gene silencing or knockout, or... NGAL3 The expression level of the gene-encoded protein is reduced or absent.

[0009] This invention also provides a method for increasing the size and weight of rapeseed seeds, by increasing the amount of rapeseed seeds... NGAL3 Gene silencing or knockout; The NGAL3 The gene is from Brassica napus. BnaA10.NGAL3 , BnaA03.NGAL3 and / orBnaC09.NGAL3 The gene sequences are shown in SEQ ID NO.1, SEQ ID NO.3, and SEQ ID NO.5, respectively.

[0010] Furthermore, sgRNA encoding the sequence GTCAGTCAACCATTACTCCA was used to target the activity of rapeseed. NGAL3 Gene silencing or knockout.

[0011] The present invention also provides NGAL3 The application of genes and their encoded proteins in rapeseed breeding, through screening for silencing or knockout. NGAL3 Increased-yielding rapeseed lines can be obtained by genetically modifying rapeseed plants, or through selection. NGAL3 Rapeseed plants with low or no expression of the gene-encoded protein obtained increased-yield rapeseed lines. The NGAL3 The gene is from Brassica napus. BnaA10.NGAL3 , BnaA03.NGAL3 and / or BnaC09.NGAL3 ; The gene sequences are shown in SEQ ID NO.1, SEQ ID NO.3, and SEQ ID NO.5, respectively. NGAL3 The amino acid sequences of the protein encoded by the gene are shown in SEQ ID NO.2, SEQ ID NO.4, and SEQ ID NO.6, respectively.

[0012] This invention also provides a drug for increasing rapeseed seed size and grain weight, the active ingredient of which includes a silencing or knockout agent. NGAL3 The sgRNA sequence of the gene, wherein the sgRNA sequence is GTCAGTCAACCATTACTCCA.

[0013] This invention also provides a method for screening key genes that regulate rapeseed seed size and grain weight, comprising the following steps: (1) Based on the seed size and grain weight phenotypic values ​​of rapeseed germplasm resources, GWAS was used to locate candidate gene intervals; (2) Select materials with extreme phenotypes of large and small grain weight, perform transcriptome sequencing during the critical period of seed development, and screen for differentially expressed genes; (3) Cross-compare the GWAS candidate genes in step (1) with the differentially expressed genes in step (2) to obtain the key genes that jointly regulate seed size and grain weight, and verify the function of the key genes.

[0014] Specifically, in step (1), at least 293 core germplasm resources of Brassica napus are used; GWAS used the EMMAX model for genome-wide association analysis, setting the threshold for significant SNPs as P≤10.-5 The candidate gene interval is 100kb upstream and downstream of a significant SNP; The phenotypes of 100-seed size and 1000-seed weight of the germplasm under multiple environments were measured, and the best linear unbiased predictor of the phenotype was calculated.

[0015] Specifically, in step (2), the critical period for seed development is 20 days after flowering; At least three portions of each of the large-particle-weight and small-particle-weight extreme phenotypic materials were selected. The screening criteria for differentially expressed genes were: |log2FC|≥1 and P<0.05.

[0016] In the process of exploring this invention, the exploration steps are as follows: 1. Gene screening and identification First, using the seed size (area per 100 seeds) and seed weight (weight per 1000 seeds) multi-environment phenotypic BLUP values ​​of 293 core germplasms of Brassica napus, genome-wide association analysis (GWAS) was performed using the EMMAX model, with a significant SNP threshold of P≤10. -5 SNPs associated with seed size and weight were located, and genes within a 100kb range upstream and downstream of these SNPs were defined as candidate genes. Furthermore, three samples each of large-grain-weight (LHS) and small-grain-weight (SLS) varieties were selected, and RNA-seq was performed at 20 DAF during the critical seed development stage. Differentially expressed genes (DEGs) were screened based on |log2FC|≥1 and P<0.05. Key candidate genes were identified by cross-matching GWAS candidate genes with DEGs.

[0017] 2. Functional verification and mutant preparation To verify NGAL3 To understand the biological function of the gene, an sgRNA target sequence GTCAGTCAACCATTACTCCA (which can simultaneously target the conserved exon regions of three homologous genes) was designed. A CRISPR / Cas9 vector (pCambia1300-UBQ:Cas9-sgRNA) was constructed and transformed into Westar hypocotyls of Brassica napus via Agrobacterium-mediated transformation. Homozygous triple mutant lines were obtained through hygromycin screening and Sanger sequencing verification, and phenotypic analysis was performed.

[0018] The beneficial effects of this invention are: The mutants of this invention achieve a breakthrough improvement in yield traits compared to the wild type. Observations revealed that, compared to the wild-type Westar, the seed size of the four mutant lines increased, with the two homozygous triple mutant lines L1-sg1-1-4-5 and L2-sg1-4-8-16 showing increases of approximately 37% and 21%, respectively, exhibiting highly significant increases. A similar increasing trend was observed in the seed weight of the mutant lines. This result is the first confirmation that NGAL3 is a negative regulator of rapeseed seed size, and its loss of function can relieve the inhibition of cell expansion, thereby increasing seed volume. Based on this, this invention further proposes an application pathway for the NGAL3 gene in high-yield rapeseed breeding: creating non-transgenic high-grain-weight germplasm through gene editing, or enriching favorable NGAL3 allelic variants using marker-assisted selection (MAS). Attached Figure Description

[0019] Figure 1 Variation and ecotype differences in seed size and weight of 293 Brassica napus accessions. Seed size (A), seed weight (B), and correlation analysis of two traits (C).

[0020] Figure 2 This is the result of a genome-wide association analysis (GWAS) of seed size and weight in Brassica napus. Manhattan plot of GWAS analysis of 100-seed size (A) and 1000-seed weight (B) from 293 core germplasms.

[0021] Figure 3 Clustering heatmap of differentially expressed genes (DEGs) between the Large and heavy seeds (LHS) genotype and the Small and lightweight seeds (SLS) genotype.

[0022] Figure 4 Brassica napus NGAL3 Targeted mutation verification of genes. BnaA03.NGAL3 , BnaA10.NGAL3 and BnaC09.NGAL3 Gene structure (A), sgRNA sequence and mutation of triple mutant lines L1-sg1-1-4-5 and L2-sg1-4-8-16 (B), sgRNA sequence and mutation of double mutant line L3-sg2-3-1-11 (C), sgRNA sequence and mutation of single mutant line L4-sg3-3-4-9 (D).

[0023] Figure 5 Phenotypic analysis of wild-type and mutant lines. Observation of mature seed morphology of wild-type and mutant lines, scale bar = 0.5cm (A); Embryo morphology of mature seeds of WT and four groups of mutant lines, scale bar = 0.1cm (B); Size (C) and grain weight (D) of mature seeds of wild-type and mutant lines.

[0024] Figure 6 The typical cotyledon phenotype (A) and floral organ phenotype (B) of wild-type and mutant lines, the cotyledon area (C) and floral area (D) of WT and mutant lines, and the scanning electron microscopy observation of petal epidermal cells of wild-type and two triple mutants are shown. Scale bar = 100 μm (E). Detailed Implementation

[0025] Example 1: Phenotypic and GWAS Analysis Twenty-three core germplasm accessions of Brassica napus (including spring, semi-winter, and winter ecotypes) were planted in Jiaxing, Zhejiang Province (2021-2022, 2022-2023). After harvesting mature seeds, the Hundred Seed Size (HSS) and Thousand Seed Weight (TSW) were measured using an SC-G seed analyzer. One hundred plump, uniform seeds were taken from each genotype for measurement, with three biological replicates. The average total area of ​​the one hundred seeds was taken as the Hundred Seed Size (HSS) for that variety. For the Thousand Seed Weight, one thousand plump, uniform seeds were taken from each genotype for measurement, with three biological replicates. The average total weight of the one thousand seeds was taken as the Thousand Seed Weight (TSW) for that variety. The measurements revealed a highly significant correlation between seed size and seed weight between the two years of measurements. Figure 1 (A, B)). Phenotypic data analysis over two years showed a highly significant positive correlation between seed size and grain weight (R0). 2 =0.7, P =2.4e-77, Figure 1 (C) Phenotypic BLUP values ​​were calculated using the R package lme4 for subsequent analysis. Based on 4,312,417 high-quality SNPs obtained from population resequencing, GWAS analysis was performed using the EMMAX model, with a significance threshold set. P ≤10 -5 The results identified a total of 69 seed size-related SNPs and 140 seed weight-related SNPs. Figure 2 (A, B) contains 327 candidate genes within a 100kb range upstream and downstream.

[0026] Example 2: RNA-seq combined screening of candidate genes Germplasm with extreme phenotypes was selected from GWAS: large-grain-weight varieties (LHS: R5030, R5033, R5161) and small-grain-weight varieties (SLS: R4281, R4698, R4906). Self-pollinated bags were harvested at 20 DAF (critical seed development period) during full bloom, flash-frozen in liquid nitrogen, and total RNA was extracted. 150bp paired-end sequencing was performed using the Illumina HiSeq X Ten platform. After Trimmomatic filtering of low-quality reads, alignment to the reference genome ZS11.v0 was performed using HISAT2. Figure 3 As shown, differential expression analysis revealed 6,862 differentially expressed genes between LHS and SLS (|log2FC|≥1, P<0.05), among which... BnaA10.NGAL3 The LHS index was significantly reduced by 9.05 times ( P =0.03). Taking the intersection of this with GWAS candidate genes, 23 key genes were finally identified (Table 1), including those located in the ChrA10 associated region. NGAL3 Homologous genes.

[0027] Table 1 Candidate genes identified through cross-screening of RNA-seq and GWAS

[0028] Example 3: NGAL3 Gene mutant preparation and validation Select sgRNA using the online software CRISPR-P (http: / / crispr.hzau.edu.cn / CRISPR / ). Continuate the sgRNA into the pAtU6-M (ampicillin resistance) vector. Kpn I and Sal The AtU6-sgRNA fragment was ligated into the final plant binary vector pCambia1300-UBQ:Cas9-P2A-GFP-rbcS-E9t after double digestion with restriction endonucleases. The plant resistance was hygromycin, and the bacterial resistance was kanamycin.

[0029] The coding sequences corresponding to the three sgRNA sequences used in this experiment are: sgRNA01:GTCAGTCAACCATTACTCCA, sgRNA02:GCTGACGCGTCAACGGAGAA, sgRNA03:GATTCCCGGAGACTCTTTAT.

[0030] The primers used to construct the vector are: BnNGAL3-sgRNA01-F: GATTGTCAGTCAACCATTACTCCA, BnNGAL3-sgRNA01-R:AAACTGGAGTAATGGTTGACTGAC; BnNGAL3-sgRNA02-F: GATTGCTGACGCGTCAACGGAGAA, BnNGAL3-sgRNA02-R: AAACTTCTCCGTTGACGCGTCAGC; BnNGAL3-sgRNA03-F: GATTGATTCCCGGAGACTCTTTAT, BnNGAL3-sgRNA03-R:AAACATAAAGAGTCTCCGGGAATC.

[0031] like Figure 4 (A) shows the gene structure with three homologous copies. sgRNA01 is used for simultaneous knockout. BnaA03.NGAL3 , BnaA10.NGAL3 and BnaC09.NGAL3 sgRNA02 is used for knockout BnaA10.NGAL3 and BnaC09.NGAL3 sgRNA03 is used for knockout BnaA03.NGAL3 .

[0032] First, equal amounts of primers BnaNGAL3-sgRNA01-F and BnaNGAL3-sgRNA01-R, BnaNGAL3-sgRNA02-F and BnaNGAL3-sgRNA02-R, and BnaNGAL3-sgRNA03-F and BnaNGAL3-sgRNA03-R were mixed and annealed to obtain sgRNA oligos; simultaneously, using... Bbs The pAtU6-M vector was digested with restriction endonuclease I, recovered, and ligated with annealed sgRNA oligos to obtain three pAtU6-sgRNA vectors.

[0033] The second step is to use Kpn I and Sal The ligated pAtU6-sgRNA vector was digested with restriction endonuclease I, and the AtU6-sgRNA fragment was recovered; simultaneously, it was... Kpn I and Sal The pCambia1300-UBQ:Cas9-P2A-GFP-rbcS-E9t vector was digested with restriction endonuclease I, recovered, and ligated with AtU6 sgRNA fragments to obtain three final vectors for creating gene-editing mutants.

[0034] The genetically transformed Brassica napus variety used in this experiment was Westar, and the relevant culture medium components are as follows: M0 medium: MS 4.4 g / L, sucrose 10 g / L, agar 8 g / L.

[0035] M1 medium: MS 4.4 g / L, sucrose 30 g / L, agar 8 g / L, AS 100 µM / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, kinetin 0.3 mg / L.

[0036] M2 medium: MS 4.4 g / L, sucrose 30 g / L, agar 8 g / L, 2,4-D 1 mg / L, kinetin 0.3 mg / L, STS 0.02 mM / L, termethin 300 mg / L, hygromycin 25 mg / L.

[0037] M3 medium: MS 4.4 g / L, glucose 10 g / L, agar 8 g / L, zeatin 2 mg / L, IAA 0.1 mg / L, termethin 300 mg / L, hygromycin 25 mg / L.

[0038] M4 medium: MS 4.4 g / L, sucrose 10 g / L, agar 8 g / L.

[0039] Steps for rapeseed tissue culture: (1) Soak the seeds in 75% ethanol solution for 1 min, then disinfect them in 50% sodium hypochlorite solution for 5-8 minutes, and wash them 3 times with sterilized ddH2O.

[0040] (2) Sow the sterilized seeds onto M0 medium, 20-30 seeds per dish, and then place them in a sterile culture box and incubate them in a light-proof incubator at 24°C for 6 days.

[0041] (3) Four days after inoculation, the target Agrobacterium was cultured in LB medium: First, the positive monoclonal colonies on the plate (i.e., Agrobacterium introduced with the gene editing final vector in Example 4) were inoculated into LB liquid medium containing antibiotics and cultured in a shaker at 28°C and 220 rpm for at least 24 h. The bacterial culture was then transferred to fresh LB medium containing antibiotics at a ratio of 1:500 and cultured in a shaker at 28°C and 220 rpm for at least 16 h.

[0042] (4) On the day of infection, take 2 mL of bacterial solution into a 2 mL centrifuge tube and centrifuge at 6000 rpm for 10 min; discard the supernatant, take 2 mL of DM infection solution to resuspend the bacterial cells, and centrifuge at 6000 rpm for 10 min; discard the supernatant again and resuspend the bacterial cells, then add DM infection solution to a final volume of 20 mL.

[0043] (5) Use tweezers and a knife to cut the hypocotyl of the seedling, about 1 cm in length. The whole process is carried out in M1 liquid medium. After immersing the cut hypocotyl in the infection solution in step 4 for 15-20 min, place it on filter paper to absorb the bacterial solution.

[0044] (6) Transfer the hypocotyls from the dried bacterial solution to M1 solid medium and incubate at 24°C in the dark for 2 days.

[0045] (7) After 2 days, transfer to M2 solid culture medium and culture for 18 days under 24℃ / 16h light conditions and 22℃ / 8h dark conditions.

[0046] (8) After 18 days, transfer to M3 solid culture medium and change the culture medium every 14 days until green shoots appear.

[0047] (9) Transfer the explants with good growth and large green leaves in M3 medium to M4 solid medium for rooting.

[0048] Total DNA was extracted from the mutant plant, and a segment of the genome near the target site was amplified by PCR. After sequencing, the mutation status of the target site was identified by comparing it with the target sequence of the wild type.

[0049] Bnngal3 The primers for mutant identification are: BnNGAL3-A03-F:CCCACTCTCCTTCGTATC, BnNGAL3-A03-R:TTACTATACGGTGGAGCAGT; BnNGAL3-A10-F: CTCTCTCTTTCACCTAGCTA, BnNGAL3-A10-R:TTGGAGATACGGAGAAGCAG; BnNGAL3-C09-F:ACCTCTCTCTTTCACCTAAC, BnNGAL3-C09-R:TTGGAGATACGGAGGAGCAT.

[0050] Plant DNA extraction method: Take a small leaf fragment into a 2 mL EP tube, grind it into a fine powder using a grinder, add 400 µL Edwards buffer, incubate at 65°C for 10 min, and centrifuge at 12600 rpm for 5 min. After centrifugation, transfer 300 µL of supernatant to a new 1.5 mL EP tube, add 300 µL isopropanol, mix well, and incubate at room temperature for 10 min. Centrifuge at 12600 rpm for 5 min, discard the supernatant, wash the precipitate once with 75% ethanol, centrifuge at 12600 rpm for 2 min, and finally dissolve it in 40 µL TE buffer. (100 mL Edwards buffer: 20 mL 1M Tris-HCl (pH 7.5); 5 mL 5M NaCl; 5 mL 0.5M EDTA (pH 8.0); 5 mL 10% SDS) PCR identification: PCR amplification is performed using specific primers on a genomic sequence near the target site of the target gene. Amplification is performed separately. BnaA03.NGAL3 , BnaA10.NGAL3 and BnaC09.NGAL3 The sequences of sgRNA and nearby sites in the gene were amplified using the following amplification system: 10 µL Taq Mix, 0.5 µL forward primer (10 µM), 0.5 µL reverse primer (10 µM), 2 µL template DNA, and 7 µL ddH2O. The reaction program was: 95℃ for 3 min; 95℃ for 15 s, 58℃ for 15 s, 72℃ for 15 s, for 38 cycles; 72℃ for 5 min; 4℃ infinity.

[0051] Sequencing result alignment: The sequences returned by the sequencing company are aligned with sequences near the wild-type target site to check for insertions and deletions. Simultaneously, peak plots are compared; a single peak across the entire sequence indicates homozygosity. For example... Figure 4 (B, C, D) are two triple mutants L1 and L2 respectively. Figure 4 (B) BnaA10.NGAL3 BnaC09.NGAL3 Double mutant L3 ( Figure 4 (C) and BnaA03.NGAL3 Single mutant L4 ( Figure 4 (D) sequencing results.

[0052] Example 4: Phenotypic analysis of wild-type and mutant lines Phenotypic observation: Wild-type Westar and four homozygous T2 mutant lines were planted in a net house. Mature T3 generation seeds were harvested, threshed, and air-dried. Phenotypic analysis was performed on seed size and weight.

[0053] Figure 5(A, B, C, D) represent statistical data on seed size, mature embryo phenotype, size of 100 seeds, and weight of 1000 seeds for wild-type WT, triple mutants L1 and L2, double mutant L3, and single mutant L4.

[0054] Figure 6 (A, B, C, D) represent the phenotypes of wild-type WT, triple mutants L1 and L2, double mutant L3, and single mutant L4, as well as statistical data on cotyledon area and flower area.

[0055] Figure 6 (E) Scanning electron microscopy observation of petal epidermal cells of wild-type and two triple mutant lines. Scale bar = 100 μm.

[0056] Observations revealed that, compared to the wild-type Westar, the seed size of the four mutant lines increased, with the two homozygous tri-mutant lines L1-sg1-1-4-5 and L2-sg1-4-8-16 showing increases of approximately 37% and 21%, respectively, which were highly significant. A similar increasing trend was observed in the seed weight of the mutant lines.

[0057] Six days after seed germination, the cotyledon area of ​​all four mutant lines was increased compared to the wild type, with L1-sg1-1-4-5, L2-sg1-4-8-16, and L3-sg2-3-1-11 showing a highly significant increasing trend. Furthermore, the flowers of the mutant lines were significantly larger when the main inflorescence just began to open. Scanning electron microscopy was used to observe the petal epidermal cells of the wild type and the two triple mutant lines. The results showed that the petal epidermal cells of 1-sg1-1-4-5 and L2-sg1-4-8-16 were larger than those of the wild type.

Claims

1. NGAL3 The application of genes and their encoded proteins in regulating rapeseed seed size and grain weight, the aforementioned NGAL3 The gene is from Brassica napus. BnaA10.NGAL3 , BnaA03.NGAL3 and / or BnaC09.NGAL3 ; The gene sequences are shown in SEQ ID NO.1, SEQ ID NO.3, and SEQ ID NO.5, respectively. NGAL3 The amino acid sequences of the protein encoded by the gene are shown in SEQ ID NO.2, SEQ ID NO.4, and SEQ ID NO.6, respectively.

2. NGAL3 The application of genes and their encoded proteins in the preparation of drugs to improve rapeseed seed size and grain weight, the aforementioned NGAL3 The gene is from Brassica napus. BnaA10.NGAL3 , BnaA03.NGAL3 and / or BnaC09.NGAL3 ; The gene sequences are shown in SEQ ID NO.1, SEQ ID NO.3, and SEQ ID NO.5, respectively. NGAL3 The amino acid sequences of the protein encoded by the gene are shown in SEQ ID NO.2, SEQ ID NO.4, and SEQ ID NO.6, respectively. When applying, rapeseed NGAL3 Gene silencing or knockout, or... NGAL3 The expression level of the gene-encoded protein is reduced or absent.

3. A method for improving the size and weight of rapeseed seeds, characterized in that, rapeseed NGAL3 Gene silencing or knockout; The NGAL3 The gene is from Brassica napus. BnaA10.NGAL3 , BnaA03.NGAL3 and / or BnaC09.NGAL3 The gene sequences are shown in SEQ ID NO.1, SEQ ID NO.3, and SEQ ID NO.5, respectively.

4. The method for improving rapeseed seed size and grain weight according to claim 3, characterized in that, The sgRNA encoding the sequence GTCAGTCAACCATTACTCCA was used to target the sgRNA in rapeseed. NGAL3 Gene silencing or knockout.

5. NGAL3 The application of genes and their encoded proteins in rapeseed breeding, through screening for silencing or knockout. NGAL3 Increased-yielding rapeseed lines can be obtained by genetically modifying rapeseed plants, or through selection. NGAL3 Rapeseed plants with low or no expression of the gene-encoded protein obtained increased-yield rapeseed lines. The NGAL3 The gene is from Brassica napus. BnaA10.NGAL3 , BnaA03.NGAL3 and / or BnaC09.NGAL3 ; The gene sequences are shown in SEQ ID NO.1, SEQ ID NO.3, and SEQ ID NO.5, respectively. NGAL3 The amino acid sequences of the protein encoded by the gene are shown in SEQ ID NO.2, SEQ ID NO.4, and SEQ ID NO.6, respectively.

6. A drug for improving the size and weight of rapeseed seeds, characterized in that, Active ingredients include those for silencing or knocking out NGAL3 The sgRNA sequence of the gene, wherein the sgRNA sequence is GTCAGTCAACCATTACTCCA.

7. A method for screening key genes regulating rapeseed seed size and grain weight, characterized in that, Includes the following steps: (1) Based on the seed size and grain weight phenotypic values ​​of rapeseed germplasm resources, GWAS was used to locate candidate gene intervals; (2) Select materials with extreme phenotypes of large and small grain weight, perform transcriptome sequencing during the critical period of seed development, and screen for differentially expressed genes; (3) Cross-compare the GWAS candidate genes in step (1) with the differentially expressed genes in step (2) to obtain the key genes that jointly regulate seed size and grain weight, and verify the function of the key genes.

8. The method for regulating key genes of rapeseed seed size and grain weight according to claim 7, characterized in that, In step (1), at least 293 core germplasm resources of Brassica napus were used; GWAS used the EMMAX model for genome-wide association analysis, setting the threshold for significant SNPs as P≤10. -5 The candidate gene interval is 100kb upstream and downstream of a significant SNP; The phenotypes of 100-seed size and 1000-seed weight of the germplasm under multiple environments were measured, and the best linear unbiased predictor of the phenotype was calculated.

9. The method for regulating key genes of rapeseed seed size and grain weight according to claim 7, characterized in that, In step (2), the critical period for seed development is 20 days after flowering; At least three portions of each of the large-particle-weight and small-particle-weight extreme phenotypic materials were selected. The screening criteria for differentially expressed genes were: |log2FC|≥1 and P<0.05.

Images