Application of PagSCL28a gene in regulation and control of growth and development of poplar

Abstract

The invention discloses application of a PagSCL28a gene in regulation and control of poplar growth and development, belongs to the technical field of agricultural biological genetic engineering, and discloses application of the PagSCL28a gene in regulation and control of poplar growth and development, and the nucleotide sequence of the PagSCL28a gene is shown as SEQ ID NO: 1. The invention also discloses a method for cultivating a transgenic poplar by using the PagSCL28a gene. The method comprises the following steps: S1, cloning the poplar PagSCL28a gene; s2, the PagSCL28a gene is constructed into a plant expression vector, and a recombinant vector is obtained; s3, transforming the recombinant vector obtained in S2 into a poplar tissue culture seedling through an agrobacterium-mediated method, and screening to obtain a transgenic plant. The invention provides a new choice for regulating and controlling the growth and development of the poplar, and provides a key molecular target and a technical means for increasing the yield of poplar wood, optimizing the quality and improving the stress resistance.

Description

Technical Field

[0001] This invention belongs to the field of agricultural bio-genetic engineering technology, specifically involving PagSCL28a Application of genes in regulating the growth and development of poplar trees. Background Technology

[0002] Alternative splicing is a key post-transcriptional regulatory mechanism in eukaryotes, generating diverse transcripts and proteins through variable processing of precursor mRNA, significantly enriching the diversity of the transcriptome and proteome, and playing an important role in multiple processes of plant growth and development. Splicing factors are the core regulatory elements of this mechanism, among which the serine / arginine-rich SR protein family is particularly crucial. They participate in the splicing regulation of precursor mRNA through RNA recognition motifs and serine / arginine enrichment domains, and have been shown to be involved in various biological processes such as seed germination, root growth, and leaf morphogenesis.

[0003] Secondary growth in woody plants, particularly the development of secondary xylem, is central to their radial growth and directly determines the physical and mechanical properties and economic value of the timber. Poplar, as an important fast-growing timber species and a model species for woody plant research, has always been a focus of forestry research in terms of timber quality improvement and biomass enhancement. However, a systematic understanding of the specific regulatory mechanisms of SR protein family members, especially SCL subfamily members, in secondary growth processes such as xylem cell differentiation and secondary cell wall deposition in poplar remains lacking. Existing research largely focuses on the function of SR proteins in herbaceous plants, and the molecular mechanisms by which these proteins regulate secondary xylem development through selective splicing in woody plants are not yet clear. This results in a lack of key gene targets for precise regulation of poplar timber quality and growth traits. Therefore, in-depth analysis of the role of poplar SR protein family members in growth, development, and secondary cell wall formation is of great significance for improving the theoretical system of plant secondary growth regulation and providing new molecular targets for poplar timber quality improvement and sustainable industrial development. Summary of the Invention

[0004] This invention aims to provide PagSCL28a The application of genes in regulating poplar growth and development provides a new option for regulating poplar growth and development, clarifying... PagSCL28a The gene can specifically regulate the development of poplar wood and the thickening of secondary cell walls, providing key molecular targets and technical means for improving poplar wood yield, quality, and stress resistance.

[0005] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows: PagSCL28a The application of genes in regulating the growth and development of poplar trees, the PagSCL28a The nucleotide sequence of the gene is shown in SEQ ID NO:1.

[0006] The present invention also provides as described PagSCL28a Application of genes in regulating the thickening of secondary cell walls in poplar trees.

[0007] Preferably, by adjusting the PagSCL28a The gene expression level inhibits the thickening of the secondary cell wall in poplar.

[0008] Preferably, by overexpressing the PagSCL28a Gene suppression of secondary cell wall thickening in poplar.

[0009] Preferably, by overexpressing the PagSCL28a Gene suppression thickens secondary cell walls, reduces poplar height, stem diameter, and leaf area, and increases lignin deposition in the xylem.

[0010] The present invention also provides a method as described above. PagSCL28a The method for genetically breeding transgenic poplar trees includes the following steps: S1, Cloned Poplar PagSCL28a Gene; S2, will PagSCL28a Genes are constructed into plant expression vectors to obtain recombinant vectors; S3. The recombinant vector obtained in S2 was transformed into poplar tissue culture seedlings using Agrobacterium-mediated transformation, and transgenic plants were obtained by screening.

[0011] Preferably, the cloned poplar tree in S1 PagSCL28a The specific gene manipulation is as follows: Total RNA was extracted from poplar trees, reverse transcribed into cDNA, and used as a template to generate primers. PagSCL28a -F and PagSCL28a -R is used for PCR amplification to obtain... PagSCL28a Gene; The primers PagSCL28a The nucleotide sequence of -F is shown in SEQ ID NO:2, and the primer... PagSCL28a The nucleotide sequence of -R is shown in SEQ ID NO:3.

[0012] This invention also provides an overexpression vector for regulating the growth and development of poplar trees, the overexpression vector comprising the... PagSCL28a Gene.

[0013] The present invention also provides a strain for regulating the growth and development of poplar trees, the strain comprising the overexpression vector described above.

[0014] This invention also provides a method for regulating the quality of poplar wood by changing... PagSCL28a Gene expression levels regulate the elongation of poplar wood fiber cells and the thickening of secondary walls.

[0015] Compared with the prior art, the present invention has the following advantages and technical effects: 1. This invention provides PagSCL28a The application of genes in regulating the growth and development of poplar trees is clearly stated in this invention. PagSCL28a The gene can specifically regulate the development of poplar xylem and the thickening of secondary cell walls. Overexpression of this gene can significantly inhibit the thickening of secondary cell walls, reduce poplar height, stem diameter and leaf area, and increase xylem lignin deposition.

[0016] 2. The PagSCL28a Gene regulation has clear targeting and operability. By constructing overexpression vectors, its expression level can be precisely controlled to achieve targeted improvement of poplar wood quality and growth traits.

[0017] 3. This invention provides key molecular targets and technical means for increasing poplar timber yield, optimizing quality, and improving stress resistance. The transgenic poplars cultivated can meet different forestry production needs and have important practical value for promoting the sustainable development of the poplar industry.

[0018] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description

[0019] Figure 1 for PagSCL28a Analysis of relative expression levels in different tissues of 84K poplar; Figure 2 This refers to the genetic transformation process of 84K poplar, in which... Figure 2 In this context, A represents the callus infection process. Figure 2 In this context, B represents the induction of callus bud differentiation. Figure 2 C in the text represents the screening of resistance rooting medium; Figure 3 for PagSCL28a Identification of overexpressing plants and analysis of transcriptional levels, among which, Figure 3 In the figure, A represents the detection of DNA levels in overexpressing plants. Figure 3 B in the figure represents the detection of RNA levels in overexpressing plants. represent P <0.05, represent P <0.01, represent P <0.001; Figure 4 for PagSCL28a Phenotypic and growth index analysis results of overexpression transgenic lines and WT soil culture for 50 days, among which, Figure 4 In the figure, A represents the morphological comparison result. Figure 4 B in the figure represents the comparison results of leaves and stem segments. Figure 4 C in the figure represents the plant height measurement result. Figure 4 In this context, D represents the diameter measurement result. Figure 4 In this context, E represents the area of ​​leaves 1-8. Figure 5 for PagSCL28a Leaf shape comparison and leaf length-to-width ratio phenotypic diagram between the overexpression transgenic lines and WT lines, among which, Figure 5 In the diagram, A represents a top view of the plant. Figure 5 B in the figure represents the phenotypic diagram of the length-to-width ratio of the fifth unfolded leaf; Figure 5 In this context, C represents the aspect ratio of the fifth unfolded leaf. Figure 6 for PagSCL28a Phenotypic comparison of leaf angle between overexpression transgenic lines and WT lines; Figure 7 for PagSCL28a Scanning electron microscope images of epidermal hairs on the abaxial surface of leaves of the overexpressing transgenic lines and WT; Figure 8 for PagSCL28a Analysis results of stem tissue sections of overexpression lines and wild-type lines, among which, Figure 8 In the diagram, A represents the result of toluidine blue staining in the 5th intersegment. Figure 8 In the diagram, B represents the results of toluidine blue and phloroglucinol-hydrochloric acid staining of segments 9 and 13. Pf, ca, and xy represent phloem fibers, cambium, and xy, respectively. Figure 8 In the figure, C represents the result of duct density analysis. Figure 8 In this context, D represents the radius analysis result. Figure 8 E in the figure represents the result of the xylem width analysis. Detailed Implementation

[0020] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0021] Unless otherwise defined, the technical or scientific terms used in this invention shall have the ordinary meaning as understood by one of ordinary skill in the art to which this invention pertains.

[0022] Source of experimental materials: Agrobacterium resuspension (1000mL): 4.43g MS powder, 30g sucrose, pH=5.6; Co-culture (1000mL): L449 2.4g + MES 0.5g + sucrose 20g + plant gel 3.2g, pH=5.9; Differentiation medium (1000mL): L449 2.4g + MES 0.5g + NAA 0.1mg + 6-BA 0.5mg + sucrose 20g + plant gel 3.2g, pH=5.9; Rooting medium (1000mL): MS 519 2.2g + NAA 0.05mg + IBA 0.02mg + sucrose 20g + agar powder 7.8g, pH=5.9.

[0023] Unless otherwise specified, the materials, reagents, enzymes, competent cells, plasmids, and instruments used in this invention are all conventional experimental materials in the field and can be purchased through commercial channels.

[0024] Example 1 Primer sequence synthesis and sequencing according to PagSCL28a Gene sequence-specific primers were designed for gene cloning, expression analysis, and vector construction. All primer synthesis and plasmid sequencing were outsourced to a biotechnology company, and their accuracy was verified through sequencing.

[0025] PagSCL28a The gene is the nucleotide sequence shown in SEQ ID NO:1.

[0026] SEQ ID NO:1: ATGCCAAGGCACAGAAGCCGGAGCAGAAGCTACAGTCCTGGTCGCCGTAGCCGAACCCCTCCTCGGGG CCGTAAGCGATACGATGACGAAGATCTCCACCGTGACACCCGTTCTTACCGTGACCGTCGCTCTCCTGCTCCATCT GGCTTACTCATTCGCAATCTCCCTCTCGATGCCAGGCCTGAAGATCTTAGGGGGCCATTTGAGAAATTTGGTCCTT TGAAAGATATTTATCTGCCCAAGAATTACTACACTGGGGAACCACGAGGGTTTGGATTTGTGAAGTATCGTTACGG TGAAGATGCAGCTGAAGCAAAAAAACGTATGGACCATAAAATCATTGGTGGACGTGAGATAAGAATTGTCTTTGCC GAGGAGAACAGAAAAACACCTCAAGAAATGCGCAGAACTCCTCGTACAAGTGACCGACATGGAGGCAGCCATGGAG GGAGAACACCACCAAGGTCCCCAAGACATCGATATCGTTCCTACTCACGCTCACCTTCACCTGCCAGGCATGATTC GAGGGATCGCGGTGTGAAGGAGGATTATTGCTCTCCACGGAGATCAAGATCCATTTCACGCTCTCGTTCTCCACGA GATGAGAGGGACTTCCAGGTAGACCAGCGGTCGCTAAGTCCATCGGAGAATGCCCGAAACCCCAAGGAAAGGAACC ATGCATCTCGTGGGTCAAGGACTCCGAGGGCCAATAGCCGTTGTCCATCAAGGTCGCATTCACAATCCCATGGTTC TCGCTAA.

[0027] PagSCL28a Gene cloning Total RNA was extracted from 84K poplar trees, and cDNA was obtained using a reverse transcription kit; amplification was performed using designed specific primers. PagSCL28a The full-length gene sequence was obtained. The PCR product was cloned into the pMDC32 vector to construct an overexpression vector. The correctness of the vector was verified by restriction enzyme digestion and sequencing. The cloning primers were: PagSCL28a -F and PagSCL28a -R.

[0028] Primers PagSCL28a The nucleotide sequence of -F is shown in SEQ ID NO:2, primer PagSCL28a The nucleotide sequence of -R is shown in SEQ ID NO:3.

[0029] SEQ ID NO: 2: ATGCCAAGGCACAGAAGCC.

[0030] SEQ ID NO: 3: TTAGCGAGAACCATGGGATTGTG.

[0031] The amplification system is shown in Table 1 below.

[0032] Table 1 PCR amplification system ; PCR amplification program: 95℃, 3 min, 1 cycle; 95℃, 15 s, 35 cycles; 55℃, 15 s, 35 cycles, 72℃ extension for 1 min, 35 cycles, 72℃ complete extension for 5 min, 1 cycle.

[0033] After PCR amplification, the products need to be separated by agarose gel electrophoresis and recovered by gel excision. Agarose gel electrophoresis separation is as follows: First, weigh 1% agarose and add it to TAE buffer. After heating to dissolve and cooling, add nucleic acid dye (GelRed) and pour into a mold to solidify. Next, mix the PCR products with loading buffer and add them to the gel wells, then load 5 μL of DNA 2000 bp marker. After electrophoresis, observe the gel under a UV transilluminator and record the position and size of the DNA bands. The 759 bp cDNA fragment is excised and recovered, and stored at -20℃ for later use.

[0034] Overexpression vector construction: The Gateway method was used to construct the overexpression vector. This method utilizes specific recombinant sequences (attB, attP, attL, and attR) and a recombinase system to achieve efficient transfer of the target gene from the entry vector to the expression vector. The specific steps are as follows: Gateway adapter sequences include a forward adapter and a reverse adapter. The forward adapter nucleotide sequence is shown in SEQ ID NO:4, and the reverse adapter nucleotide sequence is shown in SEQ ID NO:5.

[0035] SEQ ID NO: 4: GGGGACAAGTTTGTACAAAAAAGCAGGCTCG.

[0036] SEQ ID NO:5: GGGGACCACTTTGTACAAGAAAGCTGGGTC.

[0037] The BP reaction system is shown in Table 2 below.

[0038] Table 2 BP reaction system ; The BP reaction procedure is as follows: PCR products are inserted into the pDONR207 entry vector via a BP (Bacterial Proliferation) reaction to form an entry clone. After incubating the reaction at 25°C for 1 hour, the product is transformed into *E. coli* DH5α competent cells. The correct entry clone plasmid (pDONR207-) is obtained through antibiotic selection and sequencing verification. PagSCL28a ).

[0039] The LR reaction system is shown in Table 3 below.

[0040] Table 3 LR reaction system ; The LR reaction procedure is as follows: The validated entry clone was recombined with the pMDC32 expression vector via the LR (Ligation Reaction) reaction. The LR reaction utilized a mixture of LR Clonase II enzymes. After incubation at 25°C for 1 hour, the product was transformed into *E. coli* DH5α competent cells. Correct pMDC32 expression vectors were obtained through antibiotic selection and sequencing verification. PagSCL28a The overexpression vector is used for subsequent Agrobacterium-mediated transformation and plant genetic transformation experiments.

[0041] Plasmid extraction and sequencing: Positive single colonies were picked and inoculated into LB broth containing the appropriate antibiotic, and cultured overnight at 37°C with shaking. Plasmids were extracted using a plasmid mini-prep kit (purchased from Tiangen Biotech), following the kit's instructions.

[0042] Transformation of Agrobacterium Transformation of Agrobacterium: The extracted correct plasmid was added into Agrobacterium GV3101 competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd., refer to the instruction manual for specific operation).

[0043] Agrobacterium-mediated transformation of Populus aurea var. 84K (1) Preparation of Agrobacterium infection solution: Pick a single colony of Agrobacterium and inoculate it into LB liquid medium containing the corresponding antibiotic. Incubate overnight at 28°C with shaking until the OD reaches 100°C. 600 The value is 0.6-0.8. Centrifuge at 5000 rpm for 10 min and discard the supernatant. Resuspend the bacterial cells in MS liquid medium containing 30 μmol / L acetylsuccinone.

[0044] (2) Leaf pre-culture: Take leaves of sterile seedlings of 4-week-old *Populus silveraefolia* 84K, cut them into small pieces of 0.5cm×0.5cm, inoculate them on co-culture medium, and incubate them in the dark at 25℃ for 2 days.

[0045] (3) Infection and co-culture: Place the pre-cultured leaf pieces into Agrobacterium suspension and infect for 10-15 minutes, gently shaking during the process. After infection, remove the leaves, blot off excess bacterial solution with sterile filter paper, transfer to co-culture medium, and incubate in the dark at 25°C for 2 days.

[0046] (4) Screening culture: The co-cultured leaves were transferred to a differentiation medium containing kanamycin (50 mg / L) and termethin (200 mg / mL). The medium was changed every 2 weeks to screen for resistant shoots.

[0047] (5) Rooting culture: When the resistant shoots grow to 3-5cm, cut them off and inoculate them on a rooting medium containing termethin (200mg / mL).

[0048] PagSCL28a Gene expression pattern analysis: For 84K plants, soil-grown seedlings at a height of 45cm were selected as materials. Healthy soil-grown seedlings were selected as experimental materials, and representative tissues were systematically collected from the terminal bud, young leaves, old leaves, roots, internode 1 (young stem segment), internodes 3, 5, and 7 (middle and upper developing stem segments), and internodes 9, 11, 13, and 15 (mature stem segments). Total RNA was extracted and then transferred to a -80℃ freezer for long-term storage until subsequent experiments.

[0049] DNA extraction and detection: DNA was extracted according to the CTAB method; RNA extraction was performed according to the Biofit RNA extraction kit.

[0050] RNA reverse transcription: The procedure was performed according to the protocol of the Evo M-MLV reverse transcription premixed kit from Aikerui to ensure the quality and integrity of cDNA. The genomic DNA removal reaction system is shown in Table 4.

[0051] Table 4 Genomic DNA Removal Reaction System ; After mixing, the mixture was incubated at 42°C for 3 minutes and then placed on ice. Reverse transcription was then performed, and the reverse transcription system is shown in Table 5.

[0052] Table 5 Reverse Transcription System ; The cells were placed in a PCR instrument for temperature-controlled reaction. The program was set as follows: 37℃ for 15 min, 85℃ for 5 seconds, and cooled to 4℃. The reverse-transcribed cDNA was promptly stored at -20℃.

[0053] Real-time quantitative PCR: Primer design was aided by an online website (https: / / www.primer3plus.com / ), and specificity was verified (BLAST alignment).

[0054] Target gene ( PagSCL28a ) and internal reference gene ( PagUBQ Primer design, nucleotide sequences as shown in SEQ ID NO:6-SEQ ID NO:9.

[0055] PagSCL28a -qPCR-F: SEQ ID NO: 6: 5'-TGACACCCGTTCTTACCGTG-3'.

[0056] PagSCL28a -qPCR-R: SEQ ID NO:7: 5'-TTCAGCTGCATCTTCACCGTA-3'.

[0057] PagUBQ -qPCR-F: SEQ ID NO:8: 5'-GACTTTGACCGGAAAGACCA-3'.

[0058] PagUBQ -qPCR-R: SEQ ID NO:9: 5'-GGAGACGAAGGACAAGGTGA-3'.

[0059] Prepare the PCR reaction mixture: The usual qPCR reaction system is 20 μL, and the specific composition is shown in Table 6 below.

[0060] Table 6 RT-qPCR reaction system ; RT-qPCR amplification program: 95℃, 30s, 1 cycle; 95℃, 10s, 1 cycle; 60℃, 30s, 40 cycles; 95℃ extension for 15s, 40 cycles; Melting curve: 60℃, 60s, 1 cycle; 95℃, 60s, 1 cycle.

[0061] Data collection and analysis: Three biological replicates and four technical replicates were established for each sample, using 2... -ΔΔCt The method was used for relative quantitative analysis.

[0062] Poplar stem tissue sections, experimental protocol as follows: Sectioning and collection: Set the microtome to a section thickness of 50 μm, and carefully collect the sections into centrifuge tubes containing 75% ethanol for subsequent staining and observation.

[0063] Staining and observation: Staining solutions: 0.1% toluidine blue (TBO), 1% phloroglucinol, and 0.1% safranin (Carmine).

[0064] Fiber length was observed using a fiber separation microscope, and ImageJ software was used to process the microscopic images of fibroblasts and measure fiber length.

[0065] The test results are as follows: PagSCL28a Tissue-specific expression pattern analysis, results as follows Figure 1 As shown.

[0066] Depend on Figure 1 It can be seen that, PagSCL28a The expression level of *Populus silveraefolius* 84K was highest in the 5th and 9th internodes, while the expression level was relatively low in the root and the first internode.

[0067] PagSCL28a Screening, identification, and expression analysis of overexpressing plants; genetic transformation process of 84K poplar as follows: Figure 2 As shown.

[0068] Depend on Figure 2 It can be seen that after successfully constructing PagSCL28a Gene overexpression vector 35S:: PagSCL28a Subsequently, transgenic plants were obtained through Agrobacterium-mediated genetic transformation, and positive results were identified by PCR. PagSCL28a Overexpression transgenic lines.

[0069] PCR identification of the DNA level of the transgenic lines was performed, and the results are as follows: Figure 3 A in the text. Further analysis of these 10 overexpressing Pag... PagSCL28a Transcriptional analysis of positive transgenic plants was performed based on these quantitative results, as follows: Figure 3 In the B group, the two strains with the highest expression levels were selected. PagSCL28a -OE#18 and PagSCL28a -OE#24 was used as the subject of subsequent experiments.

[0070] Analysis results of overexpression transgenic plants are as follows Figures 4-7 .

[0071] Depend on Figure 4 It can be seen that the two PagSCL28a Phenotypic differences between overexpression lines and wild-type. Overexpression lines PagSCL28a -OE#18 plants were shorter than wild-type plants. Furthermore, the leaves of overexpressing plants were smaller, with a significant reduction in leaf area starting from the fifth unfolded leaf.

[0072] Depend on Figures 5-6 It can be seen that overexpression PagSCL28a The phenotype of more flat leaves and more perpendicular to the stem can be observed in both top and side views of the plant.

[0073] The third mature leaf was selected, and high-resolution imaging of the epidermal structure on the abaxial surface was performed using scanning electron microscopy (SEM, 15 kV). The results are as follows: Figure 7 Overexpression was found PagSCL28a The epidermal hairs on the terminal leaves of both strains were reduced.

[0074] PagSCL28a -OE transgenic plant section analysis, results as follows Figure 8 .

[0075] Depend on Figure 8 As shown in A, TBO staining indicates that the xylem cell walls of the overexpressing lines are more deeply stained, and the lignin content of the secondary cell walls is relatively increased; phloroglucinol-hydrochloric acid staining shows that the cell walls of wild-type xylem vessel fibroblasts are light red, while the stained areas of the overexpressing lines are more deeply red, and the lignin content of the secondary cell walls is relatively increased. Figure 8 (B in the text); Although xylem cell wall staining changed, the number of vessel molecules (per mm² cross-sectional area) did not differ significantly between OE lines and wild types. Figure 8 (C in the text). The stem cross-sectional radius of the overexpressing lines was significantly smaller than that of the wild type (C in the text). Figure 8 (D in the original text). Further statistical analysis revealed that the xylem width of the overexpressing lines was also reduced compared to the wild type; the xylem width of OE#18 and OE#24 decreased by 11% and 7.3% respectively compared to the wild type. Figure 8 E in ). show PagSCL28a Overexpression may limit secondary growth processes by inhibiting xylem cell expansion.

[0076] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the technical solutions of the present invention, and these modifications or equivalent substitutions cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. The application of the PagSCL28a gene in regulating the growth and development of poplar trees, characterized by, The nucleotide sequence of the PagSCL28a gene is shown in SEQ ID NO:

1.

2. The application according to claim 1, characterized in that, The application is to regulate the thickening of the secondary cell walls of poplar trees.

3. The application according to claim 2, characterized in that, Overexpression of the PagSCL28a gene inhibited the thickening of the secondary cell wall in poplar.

4. The application according to claim 3, characterized in that, Overexpression of the PagSCL28a gene inhibited secondary cell wall thickening, reduced poplar plant height, stem diameter, and leaf area, and increased xylem lignin deposition.

5. A method for cultivating transgenic poplar trees, characterized in that, Using the PagSCL28a gene as described in claim 1, the method includes the following steps: S1. Cloning the poplar PagSCL28a gene; S2. The PagSCL28a gene was constructed into a plant expression vector to obtain a recombinant vector; S3. The recombinant vector obtained in S2 was transformed into poplar tissue culture seedlings using Agrobacterium-mediated transformation, and transgenic plants were obtained by screening.

6. The method according to claim 5, characterized in that, The specific operation for cloning the poplar PagSCL28a gene in S1 is as follows: Total RNA was extracted from poplar trees and reverse transcribed into cDNA. Using cDNA as a template, the PagSCL28a gene was amplified by PCR using primers PagSCL28a-F and PagSCL28a-R. The nucleotide sequence of the primer PagSCL28a-F is shown in SEQ ID NO:2, and the nucleotide sequence of the primer PagSCL28a-R is shown in SEQ ID NO:

3.

7. An overexpression vector for regulating the growth and development of poplar trees, characterized in that, The overexpression vector includes the PagSCL28a gene as described in claim 1.

8. A strain for regulating the growth and development of poplar trees, characterized in that, The strain includes the overexpression vector as described in claim 7.

9. A method for regulating the quality of poplar wood, characterized in that, By altering the expression level of the PagSCL28a gene as described in claim 1, the elongation of poplar wood fiber cells and the thickening of the secondary wall can be regulated.

Images