SNP (Single Nucleotide Polymorphism) molecular marker associated with pig growth traits and application

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker associated with pig growth traits and application. The nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO: 1, and R in the sequence is C or T; one SNP molecular marker site C / T is arranged at the 289bp position of the sequence of the SNP molecular marker. Based on filled high-quality genotype data, an rMVP software package is used for carrying out whole genome association analysis (GWAS) on the character of corrected 100 kg day age (AGE100) of Duroc pigs, one SNP molecular marker site obviously related to the character is screened out, and a new marker resource is provided for molecular breeding of the growth character of the pigs.

Description

Technical Field

[0001] This invention relates to the field of molecular marker technology, specifically to an SNP molecular marker associated with pig growth traits and its application. Background Technology

[0002] With consumers' increasing demand for high-quality pork, the pig industry is placing greater emphasis on production efficiency. As a crucial indicator of pig growth rate and feeding cycle, the age at which pigs reach 100 kg body weight (100kg day age) directly impacts breeding efficiency and production costs. Shortening the 100kg day age not only helps improve feeding efficiency and reduce breeding costs but also significantly enhances the economic benefits of pig farming, thus becoming one of the key goals of modern pig breeding.

[0003] To improve breeding efficiency and accelerate the growth process of pigs to reach 100kg body weight, breeding research has gradually shifted from traditional phenotypic selection to the molecular level in recent years. In particular, the widespread application of marker-assisted selection (MAS) allows for precise assessment of an individual's growth potential based on their genotype information at an early stage, effectively improving the efficiency of growth trait improvement. Several studies have conducted genome-wide association studies (GWAS) on the "age to 100kg body weight" (AGE100) trait, identifying multiple genetic loci and candidate genes significantly associated with this trait. For example, researchers have conducted GWAS studies in Large White pigs, identifying multiple SNP loci associated with growth traits such as AGE100 and backfat thickness, and identifying potential functional genes such as CNTN1, MC4R, and PDZRN4. Researchers also identified a pleiotropic QTL region on chromosome 1 in 5860 Duroc pigs, significantly associated with average daily weight gain and carcass lean meat percentage; these traits are related to AGE100 length. Furthermore, researchers discovered several SNPs closely related to AGE100 in a population of 1026 Large White pigs, providing a reference for breeding decisions. These research findings not only reveal the genetic basis behind AGE100 but also provide theoretical basis and technical support for the discovery of key molecular markers in this invention.

[0004] Although significant progress has been made in elucidating the genetic basis of growth traits in pigs, there is still a lack of stable and effective molecular markers for age control in Duroc pigs under a corrected 100 kg body weight condition, which to some extent restricts the progress of precision breeding for this trait. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of existing technologies and provide a SNP molecular marker associated with pig growth traits and its application. Based on filled-in long weight genotype data, this invention uses the rMVP software package to conduct genome-wide association analysis (GWAS) on the "corrected 100kg body weight age" (AGE100) trait in Duroc pigs, screening out one SNP molecular marker locus that is significantly associated with this trait, providing a new marker resource for molecular breeding of pig growth traits.

[0006] To achieve the above objectives, the technical solution designed by the present invention is as follows: This invention provides a SNP molecular marker associated with pig growth traits, the nucleotide sequence of which is shown in SEQ ID NO: 1; The SNP molecular marker sequence has one SNP molecular marker site C / T (with a degenerate base R) at 289 bp.

[0007] Furthermore, the corrected 100kg age of pigs with the TT genotype at the SNP molecular marker site is shorter than that of pigs with the CC / CT genotype at the same 100kg age.

[0008] The present invention also provides a primer pair for obtaining the aforementioned SNP molecular marker, the nucleotide sequence of which is as follows: Forward primer 1: CACCCCATGCGTGTAAATGA; Reverse primer 1: GGGATCATCCACACTATGCTTTTG.

[0009] The present invention also provides a method for detecting SNP molecular markers associated with pig growth traits, wherein the method uses the primer pairs described above for amplification and sequencing comparison to complete the detection.

[0010] The present invention also provides the application of the aforementioned SNP molecular marker in identifying pig growth traits and screening short-corrected 100kg-day-old pig breeds.

[0011] The present invention also provides the application of the primer pair described above in identifying pig growth traits, screening short-corrected 100kg-day-old pig breeds, and pig growth genetic breeding.

[0012] The present invention also provides a kit for detecting the SNP molecular markers, the kit comprising the primer pairs described above.

[0013] The present invention also provides a method for identifying traits in pigs corrected for 100kg age using the aforementioned kit, comprising the following steps: Detect SNP molecular marker sites on pig chromosome 1, and determine the corrected 100kg age traits of pigs based on the SNP molecular marker sites. Pigs with the TT genotype at the SNP molecular marker site had a shorter corrected 100kg age than pigs with the CC / CT genotype.

[0014] Furthermore, the detection method includes the following steps: (1) Extract DNA from the pigs to be tested; (2) The extracted DNA was amplified by PCR using primer pair Forward primer1 and Reverse primer1; (3) Sequencing analysis of the PCR amplification products to obtain sequencing results; (4) Based on the sequencing results, the genotype is obtained. When the SNP molecular marker site is the TT genotype, the pig's corrected age of 100kg is short. Alternatively, when the SNP molecular marker site is the CC / CT genotype, the corrected 100kg age of pigs is longer.

[0015] The present invention also provides the application of the kit described herein in identifying pig growth traits, screening short-corrected 100kg-day-old pig breeds, and pig growth genetic breeding.

[0016] The beneficial effects of this invention are: 1. This invention utilizes genotyping data from 80K gene chip-filled datasets for genotyping and performs genome-wide association analysis (GWAS) based on SNP molecular markers. This successfully screened SNP molecular marker loci located on chromosome 1 of pigs that are significantly associated with the 100kg-age corrected trait in Duroc pigs. This SNP locus is located in the CPLX4 gene region and can serve as a marker-assisted breeding tool for the 100kg-age corrected trait in Duroc breeding pigs.

[0017] 2. Compared to traditional phenotypic selection methods, this invention utilizes molecular markers to more efficiently and accurately screen for individuals with rapid growth rates. Correcting for shorter-growing-age (100kg) breeding pigs results in faster growth, shorter feeding cycles, improved production efficiency and feed conversion rates, and reduced breeding costs. This technology has significant application prospects in pig breeding practice, not only helping to improve the economic benefits of pig farming enterprises but also contributing to the advancement of pig breeding in my country and accelerating the selection of superior breeds. Attached Figure Description

[0018] Figure 1 Manhattan plot for GWAS analysis; Figure 2 QQ graph for GWAS analysis. Detailed Implementation

[0019] The present invention will now be described in further detail with reference to specific embodiments, so that those skilled in the art can understand it.

[0020] Example 1 Genotyping and Data Processing 1. DNA extraction (1) Collect ear tissue from 3715 Duroc pigs. The collected ear tissue was crushed and placed in a glass homogenizer. An equal volume of cell lysis buffer prepared with 100 mmol / L Tris saturated phenol, 500 mmol / L disodium ethylenediaminetetraacetate (EDTA), 20 mmol / L sodium chloride (NaCl), 10% sodium dodecyl sulfate (SDS), and 20 μg / mL pancreatic RNase was added. Then, 10 ng / mL proteinase K was added, mixed well, and placed in a 65℃ constant temperature water bath for 30 min. (2) Gently shake the centrifuge tube containing the above solution for 15 min, place it in a centrifuge and centrifuge at 12000 rpm for 5 min, then take the supernatant into another centrifuge tube; (3) Add an equal volume of phenol, chloroform and isoamyl alcohol mixed solution (the volume ratio of phenol, chloroform and isoamyl alcohol is 25:24:1), shake to mix, place in a centrifuge and centrifuge at 12000 rpm for 5 min, and then take the supernatant into another centrifuge tube. (4) Add an equal volume of phenol, chloroform and isoamyl alcohol mixed solution (the volume ratio of phenol, chloroform and isoamyl alcohol is 25:24:1), shake to mix, place in a centrifuge and centrifuge at 12000 rpm for 10 min, and take the supernatant into another centrifuge tube. (5) Add 2 volumes of pre-cooled anhydrous ethanol, let stand until the ethanol evaporates, pick out the DNA precipitate and dissolve the DNA in ultrapure water; (6) DNA quality was detected by DNA concentration analyzer and agarose gel electrophoresis to obtain DNA from all Duroc pigs.

[0021] 2. Genotyping test (1) Based on the DNA extracted above, genotyping was performed using a porcine 80k functional site gene chip (liquid phase chip), which contains more than 180,000 SNP molecular marker sites. (2) 140 samples were randomly selected from the above DNA for whole genome resequencing data. Fastpv0.23.2 software was used for quality control, bwa v0.7.18 software was used for comparison, and finally GATK v4.5 software was used for genotyping of the sequencing data.

[0022] 3. Genotype filling Using Beagle v5.4 software, the microarray data was filled with the whole genome resequencing data of 140 Duroc pigs mentioned above as a reference group. SNP molecular marker sites with filling accuracy higher than 0.8 were selected for subsequent analysis.

[0023] Example 2 Genome-wide association analysis of SNP molecular marker sites with traits corrected for 100 kg age in Duroc pigs 1. Phenotypic Definition Corrected age at 100kg weight: The age at 100kg weight is the value obtained after calculating the age at the end of the measurement using the correction formula.

[0024] Phenotypic data were filtered in accordance with NY_T 822-2019 Standard for Testing the Production Performance of Breeding Pigs (Industry Standard), and individuals with phenotypic values ​​at 100kg age of 100-210 days after the end of the test were retained.

[0025] 2. SNP molecular marker quality control Based on the SNP molecular marker loci with filling accuracy higher than 0.8 selected after genotype filling in Example 1, the filling SNP molecular marker loci were quality controlled using PLINK v1.9 software. SNP molecular marker loci with a missing genotype ratio of <10%, an individual missing genotype ratio of <10%, and a minimum allele frequency (MAF) of >5% were retained. Finally, 3317 samples and 12,902,585 SNP molecular marker loci were used for genome-wide association analysis.

[0026] 3. Duroc-corrected genome-wide association analysis of traits at 100 kg age The experimental pig herd used in this genome-wide association analysis was Duroc pigs, comprising 3317 pigs. Based on the corrected 100kg age information recorded by the experimental pig herd, a genome-wide association analysis was performed on SNP molecular markers and Duroc corrected 100kg age traits using the MLM analysis module in the rMVP software package, based on a mixed linear model approach. The specific model is shown below: Y = Xβ + Sa + Zu + e; Where Y: phenotypic vector; X: Fixed-effects design matrix (including gender and measurement season); β: Fixed effects parameter vector; S: Marker effect matrix (containing SNP genotype data); a: Marker effect parameter vector (corresponding to the effect of each SNP in the SNP genotype matrix S); Z: Random effects design matrix (including kinship matrix); u: Random effect parameter vector, u∼N(0,Kσu2), N is a normal distribution, K is the kinship matrix, and σu2 is the variance of the random effect; e: Error vector, N~(0,Iσe2), where I is the identity matrix and σe2 is the variance of the residual.

[0027] Manhattan plots and QQ plots are automatically generated from the data using the rMVP software package, and the Bonferroni method is used to determine the significance threshold of associations, with a threshold of 0.05 / number of valid SNPs.

[0028] The results are as follows Figure 1 As shown, a total of 473 SNPs exceeded the set significance threshold. Among them, a significant peak appeared on chromosome 1, while other chromosomes mainly showed scattered signals. Based on this, this invention focuses on the most significant site (leader SNP) on chromosome 1 as the target for subsequent analysis.

[0029] The results are as follows Figure 2 As shown, the reliability of the GWAS results is further assessed by comparing the quantiles of the probability distributions of the actual and expected -log(P) values. The QQ plot shows the -log(P) values ​​for most SNPs. 10 The p-value was consistent with the expected value, with significant deviations only at the high quantiles, suggesting the presence of a genuine correlation signal. The overall graph did not show a systematic upward trend, indicating the reliability of the GWAS analysis results.

[0030] Table 1. Candidate SNP loci for Duroc pigs at 100 kg age, identified based on GWAS. As shown in Table 1, this embodiment screened out one SNP molecular marker locus that was significantly associated with Duroc's corrected 100kg age trait. This locus is on chromosome 1, at position 161645531.

[0031] Table 2. Genotype frequencies and genotype-corrected phenotypic mean at 100 kg age of candidate SNP loci in Duroc pigs. Note: All genotype frequencies are rounded to two decimal places. The values ​​in parentheses are the mean ± standard deviation of the number of days at 100 kg age for that genotype.

[0032] Further analysis was conducted on the number of individuals with different genotypes at this SNP molecular marker locus and the mean phenotype of the corresponding genotype. The results are shown in Table 2. For the 1:161645531 locus, when the genotype was TT, the corrected number of days to 100 kg in Duroc pigs was lower than that of individuals with other genotypes.

[0033] Example 3 Single-marker analysis of SNP molecular markers associated with pig growth traits In SAS software, a mixed linear model (MLM) was used to perform association analysis between SNP molecular marker sites associated with pig growth traits and Duroc-corrected 100kg age traits.

[0034] The specific model is as follows: in, This represents the corrected 100 kg backfat thickness phenotypic value for the i-th individual; It is the population mean; This is the effect of the i-th genotype (fixed effect); It is a seasonal effect (fixed effect); It is a gender effect (fixed effect); It is a random residual effect.

[0035] The significance of the differences in traits at 100 kg age was analyzed using the t-test, and the results are shown in Tables 3 and 4.

[0036] Table 3. Single-marker association analysis level of SNP molecular markers Table 4.1: Polymorphism of the fragment 161645531 Tables 3 and 4 show that the SNP molecular marker locus (locus 1:161645531) is significantly associated with the corrected 100kg age-day trait. This SNP has three genotypes: CC, CT, and TT. Mixed linear model analysis revealed that genotype has a significant impact on the corrected 100kg age-day trait (T-test, P<0.05). Specifically, there are significant differences in the least squares means among the three genotypes, indicating that the genetic variation of this SNP molecular marker locus has a significant regulatory effect on growth rate. In summary, for the 1:161645531 locus, Duroc pigs with the TT genotype have a lower corrected 100kg age-day count than individuals with other genotypes.

[0037] Example 4 Acquisition of SNP molecular markers associated with pig growth traits 1. Based on the pig Sscrofa version 11.1 reference genome in the Ensembl database, nucleotide sequences upstream and downstream of SNP molecular marker sites were extracted, and primer pairs Forward primer 1 and Reverse primer 1 were designed. Their nucleotide sequences are shown in SEQ ID NO: 2 and SEQ ID NO: 3. Forward primer 1: CACCCCATGCGTGTAAATGA; Reverse primer 1: GGGATCATCCACACTATGCTTTTG.

[0038] 2. Using the primers described above, PCR amplification was performed on the genomic DNA of Duroc pigs to obtain SNP molecular markers associated with pig growth traits. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO: 1. The SNP molecular marker site is located at position 289 of the sequence, R is C / T, corresponding to position 161645531 of chromosome 1 of the pig genome, the corresponding gene is CPLX4, and the polymorphic site is C or T.

[0039] Example 5 This embodiment provides a method for detecting SNP molecular markers associated with pig growth traits. The method uses the primer pair Forward primer 1 and Reverse primer 1 from Example 4 for amplification, and the detection is completed by sequencing comparison.

[0040] Example 6 This embodiment provides a kit for detecting SNP molecular markers associated with pig growth traits, the kit comprising the primer pair Forward primer 1 and Reverse primer 1 from Example 4.

[0041] Example 7 This embodiment provides a method for identifying traits in pigs corrected for 100kg age using the kit from Example 6, including the following steps: Detect SNP molecular marker sites on pig chromosome 1, and determine the corrected 100kg age traits of pigs based on the SNP molecular marker sites. Pigs with the TT genotype at the SNP molecular marker site had a shorter corrected 100kg age than pigs with the CC / CT genotype.

[0042] The detection method includes the following steps: (1) Extract DNA from the pigs to be tested; (2) The extracted DNA was amplified by PCR using primer pair Forward primer1 and Reverse primer1; (3) Sequencing analysis of the PCR amplification products to obtain sequencing results; (4) Based on the sequencing results, the genotype is obtained. When the SNP molecular marker site is the TT genotype, the pig's corrected age of 100kg is short. Alternatively, when the SNP molecular marker site is the CC / CT genotype, the corrected 100kg age of pigs is longer.

[0043] The method for identifying traits in pigs corrected to 100kg age using this embodiment can accurately obtain the genotype of SNP molecular marker loci on chromosome 1 of pigs with high accuracy. Pigs with shorter corrected 100kg ages grow rapidly, have shorter feeding cycles, which is beneficial for improving production efficiency and feed conversion rate, and reducing breeding costs. This technology has significant application prospects in pig breeding practice, not only helping to improve the economic benefits of pig farming enterprises, but also contributing to improving the level of pig breeding in my country and accelerating the selection process of superior breeds.

[0044] All other parts not described in detail are existing technologies. Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A SNP molecular marker associated with pig growth traits, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO: 1; The SNP molecular marker sequence contains one SNP molecular marker site C / T at position 289 bp.

2. The SNP molecular marker according to claim 1, characterized in that: Pigs with the TT genotype at the SNP molecular marker site had a shorter corrected 100kg age than pigs with the CC / CT genotype.

3. A primer pair for obtaining the SNP molecular marker of claim 1, characterized in that: The nucleotide sequences of the primer pair are as follows: Forward primer 1: CACCCCATGCGTGTAAATGA; Reverse primer 1: GGGATCATCCACACTATGCTTTTG.

4. A method for detecting SNP molecular markers associated with pig growth traits, characterized in that: The method uses the primer pair described in claim 3 for amplification, and sequencing comparison to complete the detection.

5. The application of the SNP molecular marker as described in claim 1 in identifying pig growth traits and screening short-corrected 100kg-day-old pig breeds.

6. The application of the primer pair according to claim 3 in identifying pig growth traits, screening short-corrected 100kg-day-old pig breeds, and pig growth genetic breeding.

7. A kit for detecting the SNP molecular marker of claim 1, characterized in that: The kit includes the primer pair as described in claim 3.

8. A method for identifying traits in pigs corrected for 100kg age using the kit described in claim 7, characterized in that: Includes the following steps: Detect SNP molecular marker sites on pig chromosome 1, and determine the corrected 100kg age traits of pigs based on the SNP molecular marker sites. Pigs with the TT genotype at the SNP molecular marker site had a shorter corrected 100kg age than pigs with the CC / CT genotype.

9. The method according to claim 8, characterized in that: The detection method includes the following steps: (1) Extract DNA from the pigs to be tested; (2) The extracted DNA was amplified by PCR using primer pair Forward primer1 and Reverse primer1; (3) Sequencing analysis of the PCR amplification products to obtain sequencing results; (4) Based on the sequencing results, the genotype is obtained. When the SNP molecular marker site is the TT genotype, the pig's corrected age of 100kg is short. Alternatively, when the SNP molecular marker site is the CC / CT genotype, the corrected 100kg age of pigs is longer.

10. The application of the kit according to claim 7 in identifying pig growth traits, screening short-corrected 100kg-day-old pig breeds, and pig growth genetic breeding.

Images