Genetically engineered bacterium for high-yield production of beta-ionone and application of genetically engineered bacterium

Abstract

The invention relates to the technical field of genetic engineering, and discloses a genetically engineered bacterium for producing beta-ionone at high yield and application of the genetically engineered bacterium. A synthetic biological plasmid modularization technology is adopted, coding genes of carotenoid cleavage dioxygenase NtCCD1 in tobacco are excavated, and specific soluble protein tags including a thioredoxin tag, a maltose binding protein tag and a glutathione transferase tag are screened, so that the content of the carotenoid cleavage dioxygenase NtCCD1 in the tobacco is determined. The NtCCD1 is subjected to single-point mutation modification of mutation of 431st-site histidine into tyrosine, lysine or glutamine, and the fermentation enzyme and the gene engineering bacterium which can efficiently catalyze splitting decomposition of beta-carotene in tobacco to produce beta-ionone are constructed. The biosynthesis of the tobacco aroma component beta-ionone is realized, and the method has high efficiency.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a genetically engineered bacterium that produces high levels of β-ionone and its applications. Background Technology

[0002] β-Ionone is an important neutral aroma component derived from carotenoid degradation products. It possesses a slightly cypress-like violet aroma, is elegant, and exhibits good compatibility with other aromatic molecules. It has excellent modifying, harmonizing, sweetening, and flavoring properties, and is widely used in food and tobacco flavorings.

[0003] Currently, the commonly used methods for preparing β-ionone mainly include three types: natural extraction, chemical synthesis, and biosynthesis. Natural extraction primarily obtains it from plant essential oils, but the yield is low and expensive. Chemical synthesis mainly uses citral and acetone as raw materials, condensing them to obtain pseudoionone, and then rearranging the ions to obtain various isomers of ionone. This method is difficult to synthesize β-ionone in a targeted manner and the process is relatively complex. The biosynthesis of β-ionone mainly uses β-carotene as a precursor, and is generated by the targeted cleavage of the C=C bonds at positions 9 and 10 of β-carotene by carotenoid cleavage dioxygenases. Carotenoid cleavage dioxygenases are characterized by a wide range of substrates, different cleavage sites, and diverse products. Currently, the catalytic efficiency of carotenoid cleavage dioxygenases for β-ionone production reported in existing technologies is relatively low. Therefore, screening for carotenoid cleavage dioxygenases with high specificity and catalytic activity is crucial for the biosynthesis of β-ionone.

[0004] Carotenoid degradation products are an important source of neutral aroma in tobacco. Constructing highly efficient enzyme proteins and their expression strains for the degradation of carotenoids in tobacco, and applying them to tobacco substrate fermentation to obtain β-ionone, a key aroma component of tobacco, has become a hot research topic in the tobacco industry. However, existing dioxygenases for the cleavage of carotenoids in tobacco have low catalytic efficiency, making them difficult to apply effectively in the bio-fermentation production of β-ionone, a key aroma component of tobacco.

[0005] In the prior art, such as the invention patent with publication number CN118421658A, a carotenoid cleaving dioxygenase and its application are disclosed. This involves modifying the carotenoid dioxygenase CCD1 derived from osmanthus flowers and expressing it in a strain of Rhodotorula glutinis to obtain a carotenoid dioxygenase, which is then applied to tobacco fermentation to increase the content of carotenoid degradation products in the tobacco leaves. However, this patent CN118421658A has the following drawbacks: (1) The carotenoid dioxygenase CCD1 derived from osmanthus has a low efficiency in catalyzing the production of β-ionone in tobacco; (2) Due to the low catalytic efficiency, the above enzymes can only be used for the fermentation and flavoring of tobacco, and cannot be used in the fermentation production of tobacco β-ionone flavoring. Summary of the Invention

[0006] To achieve efficient production of β-ionone, the natural aroma component of tobacco, and more specifically, to construct a carotenoid cleavage dioxygenase with high specificity and catalytic activity in tobacco and its expression strain, this invention provides a genetically engineered bacterium that produces high levels of β-ionone, along with its construction method and application.

[0007] The specific technical solution of this invention is as follows: In a first aspect, the present invention provides a genetically engineered bacterium that produces high levels of β-ionone, wherein the genome of the genetically engineered bacterium includes a mevalonic acid synthesis module, a β-carotene synthesis module, and a β-ionone synthesis module, wherein: The mevalonic acid synthesis module is used to introduce the mevalonic acid pathway into the genetically engineered bacteria. The β-carotene synthesis module is used to introduce a β-carotene synthesis pathway into the genetically engineered bacteria. The β-ionone synthesis module is used to introduce a β-ionone synthesis pathway into the genetically engineered bacteria; the β-ionone synthesis module connects a soluble protein tag to the gene encoding the carotenoid cleavage dioxygenase NtCCD1, and then inserts an Amp... R +pMB1 vector obtained; The soluble protein tag is selected from one of the following: thioredoxin tag, maltose-binding protein tag, and glutathione transferase tag.

[0008] This invention constructs a highly efficient expression vector and its expression strain for NtCCD1 by fusing a thioredoxin tag, a maltose-binding protein tag, and a glutathione transferase tag into the gene encoding the carotenoid cleavage dioxygenase NtCCD1. This vector is then applied to fermentation culture in a medium containing tobacco biomass to effectively enhance the catalytic ability of tobacco to cleave β-carotene to produce β-ionone.

[0009] The high-efficiency expression vector for NtCCD1, namely the β-ionone synthesis module, is an Amp vector carrying a soluble protein tag and the encoding gene for NtCCD1. R The +pMB1 vector introduces a β-ionone synthesis pathway into the genetically engineered bacteria. This pathway, due to the action of specific soluble protein tags, including thioredoxin tags, maltose-binding protein tags, and glutathione transferase tags, enables the genetically engineered bacteria to efficiently express NtCCD1 during fermentation.

[0010] Thioredoxin A (TrxA), maltose-binding protein (MBP), and glutathione S-transferase (GST) are soluble protein tags screened by the inventors that are suitable for the efficient expression of NtCCD1 provided in this invention. The nucleotide sequence of the GST tag is shown in SEQ ID NO.3, the nucleotide sequence of the TrxA tag is shown in SEQ ID NO.4, and the nucleotide sequence of the MBP tag is shown in SEQ ID NO.5.

[0011] As a preferred embodiment of the present invention, the soluble protein tag is a maltose-binding protein tag.

[0012] Compared to thioredoxin and glutathione transferase tags, when the maltose-binding protein tag is co-inserted with the NtCCD1 coding gene into Amp... R The genetically engineered bacteria constructed by transforming the pMB1 vector into E. coli have a more efficient ability to express NtCCD1, which is reflected in a higher yield of β-ionone.

[0013] As a preferred embodiment of the present invention, the amino acid sequence of the carotene cleavage dioxygenase NtCCD1 is shown in SEQ ID No. 2.

[0014] The protease represented by the amino acid sequence shown in SEQ ID No. 2 is carotenoid cleavage dioxygenase NtCCD1, which originates from the carotenoid cleavage dioxygenase NtCCD1 of *Nicotiana tomentosiformis*. NtCCD1 is a highly efficient carotenoid cleavage dioxygenase found by the inventors in tobacco that catalyzes the cleavage of β-carotene to produce β-ionone. The inventors have discovered in experiments that NtCCD1 exhibits high specificity and high catalytic activity in catalyzing the conversion of β-carotene to β-ionone in tobacco. Therefore, this invention uses it as the basis for constructing a genetically engineered bacterium that produces high yields of β-ionone with a natural tobacco aroma.

[0015] Further preferably, the nucleotide sequence of the gene encoding the carotenoid cleavage dioxygenase NtCCD1 is shown in SEQ ID No. 1.

[0016] As another preferred embodiment of the present invention, the carotene cleaving dioxygenase is obtained by a single-point mutation at any of the following sites in the amino acid sequence shown in SEQ ID No. 2: The histidine (His) at position 431 is mutated to tyrosine (Tyr); The histidine (His) at position 431 is mutated to lysine (Lys); The histidine at position 431 (His) is mutated to glutamine (Gln).

[0017] More active carotenoid cleavage dioxygenases possess a higher ability to catalyze the cleavage of β-carotene to produce β-ionone. This invention obtains a single-point-mutated carotenoid cleavage dioxygenase mutant by mutating the amino acid sequence shown in SEQ ID No. 2 at position 431 (histidine to tyrosine, lysine, or glutamine). This mutant can improve the catalytic activity of the wild-type enzyme shown in SEQ ID No. 2, resulting in genetically engineered bacteria with higher β-ionone yield.

[0018] However, when histidine at position 431 was mutated to alanine (Ala) or glycine (Gly), the production of β-ionone actually decreased.

[0019] In a preferred embodiment of the present invention, the gene encoding the soluble protein tag and the carotenoid cleavage dioxygenase NtCCD1 is regulated by the Ptac promoter.

[0020] As a preferred embodiment of the present invention, the method for constructing the mevalonic acid synthesis module is as follows: The genes encoding acetyl-CoA thiolase EcatoB, 3-hydroxy-3-methylglutaryl-CoA synthase SchmgS, 3-hydroxy-3-methylglutaryl-CoA reductase SchmgR, mevalonate kinase ScMK, mevalonate phosphate kinase Scpmk, phosphomethyl valerate decarboxylase ScPMD, isoprene pyrophosphate isomerase EcIDI, and geranyl diphosphate synthase EcispA were inserted into Chl. R After adding the p15A vector, an expression plasmid for the mevalonic acid pathway was obtained, and the expression plasmid was then transferred into the genetically engineered bacteria.

[0021] In a preferred embodiment of the present invention, EcatoB is E. coli acetoacetyl-CoAthiolase, an acetyl-CoA thiolytic enzyme derived from *E. coli*; SchmgS is S. cerevisiae HMG-CoA synthase, a 3-hydroxy-3-methylglutaryl-CoA synthase derived from *Saccharomyces cerevisiae*; SchmgR is S. cerevisiae HMG-CoA reductase, a 3-hydroxy-3-methylglutaryl-CoA reductase derived from *Saccharomyces cerevisiae*; ScMK is S. cerevisiae mevalonate kinase, a mevalonate kinase derived from *Saccharomyces cerevisiae*; Scpmk is S. cerevisiae mevalonate kinase, a mevalonate phosphate kinase derived from *Saccharomyces cerevisiae*; ScPMD is S. cerevisiae phosphomevalonate decarboxylase, a phosphomevalonate decarboxylase derived from *Saccharomyces cerevisiae*; and EcIDI is E. coli isopentenyl diphosphate. isomerase is an isoprene pyrophosphate isomerase derived from Escherichia coli; EcispA is E. coli geranyl diphosphate synthase derived from Escherichia coli.

[0022] Specifically, as a preferred embodiment of the present invention, the nucleotide sequence of the gene encoding EcatoB is shown in SEQ ID No. 6; the nucleotide sequence of the gene encoding SchmgS is shown in SEQ ID No. 7; the nucleotide sequence of the gene encoding SchmgR is shown in SEQ ID No. 8; the nucleotide sequence of the gene encoding ScMK is shown in SEQ ID No. 9; the nucleotide sequence of the gene encoding Scpmk is shown in SEQ ID No. 10; the nucleotide sequence of the gene encoding ScPMD is shown in SEQ ID No. 11; the nucleotide sequence of the gene encoding EcIdi is shown in SEQ ID No. 12; and the nucleotide sequence of the gene encoding EcispA is shown in SEQ ID No. 17 of the sequence listing.

[0023] As a preferred embodiment of the present invention, the coding genes for EcatoB, SchmgS, SchmgR, and EcispA are regulated by the Plac promoter; the coding genes for ScMK, Scpmk, ScPMD, and EcIDI are regulated by the Ptrc promoter.

[0024] As a preferred embodiment of the present invention, the method for constructing the β-carotene synthesis pathway is as follows: The genes encoding gerany pyrophosphate synthase PvCrtE, lycopene cyclase PvCrtY, phytoene desaturase PaCrtI, and phytoene synthase LpCrtB were inserted into Spec. R After adding the CloDF13 vector, an expression plasmid for the β-carotene pathway was obtained, and the expression plasmid was then transferred into the genetically engineered bacteria.

[0025] In a preferred embodiment of the present invention, PvCrtE is Pseudescherichia vulneris Geranylgeranyl diphosphate synthase, a geranyl pyrophosphate synthase derived from Pseudescherichia vulneris; PvCrtY is Pseudescherichia vulneris lycopene cyclase, a lycopene cyclase derived from Pseudescherichia vulneris; PaCrtI is Pantoea agglomerans Phytoene desaturase, a phytoene desaturase derived from Pantoea agglomerans; and LpCrtB is Lamprocystis purpurea phytoene synthase, a phytoene synthase derived from Lamprocystis purpurea.

[0026] Specifically, as a preferred embodiment of the present invention, the nucleotide sequence of the gene encoding PvCrtE is shown in SEQ ID No. 13; the nucleotide sequence of the gene encoding PvCrtY is shown in SEQ ID No. 14; the nucleotide sequence of the gene encoding PaCrtI is shown in SEQ ID No. 15; and the nucleotide sequence of the gene encoding LpCrtB is shown in SEQ ID No. 16.

[0027] As a preferred embodiment of the present invention, the encoding genes of PvCrtE, PvCrtY, PaCrtI, and LpCrtB are regulated by the Plac promoter.

[0028] Secondly, the present invention provides the application of the above-mentioned genetically engineered bacteria in the fermentation production of β-ionone.

[0029] As a preferred embodiment of the application, the culture medium used for fermentation contains tobacco biomass.

[0030] For example, in culture media containing waste tobacco dust, or in culture media containing tobacco extracts or hydrolysates, the aforementioned genetically engineered bacteria can efficiently catalyze the cleavage of β-carotene to produce β-ionone. Experiments have shown that shake-flask fermentation in a culture medium containing tobacco biomass can achieve a β-ionone yield of up to 28.17 mg / L.

[0031] Compared with the prior art, the present invention has the following technical effects: (1) This invention employs modular plasmid technology from synthetic biology. By mining the encoding gene of NtCCD1, a carotenoid cleavage dioxygenase in tobacco, and screening specific soluble protein tags, including thioredoxin tags, maltose-binding protein tags, and glutathione transferase tags, the constructed genetically engineered bacteria efficiently express NtCCD1 during fermentation. Furthermore, the genetically engineered bacteria constructed above are used as aroma-producing genetically engineered bacteria to achieve the biosynthesis of β-ionone, a component of tobacco aroma, with high efficiency.

[0032] (2) The present invention also utilizes mutation modification technology to modify NtCCD1 by single-point mutation of histidine at position 431 to tyrosine, lysine or glutamine, to obtain a carotenoid cleavage dioxygenase mutant with higher activity, thereby improving the ability of the constructed aroma-producing genetically engineered bacteria to catalyze the cleavage of β-carotene to produce β-ionone.

[0033] (3) The mevalonic acid synthesis module, β-carotene synthesis module and β-ionone synthesis module constructed in this invention have the characteristics of strong product specificity, simple separation process and low cost. They have high yield and can be applied to the tobacco-flavored β-ionone fragrance manufacturing industry. They have a broad application prospect in industry. Attached Figure Description

[0034] Figure 1 This is a schematic diagram of the carrier plasmid structure of a β-ionone synthesis module, a β-carotene synthesis module, and a mevalonic acid synthesis module according to the present invention; wherein, Figure A is a schematic diagram of the carrier plasmid of the β-ionone synthesis module, Figure B is a schematic diagram of the carrier plasmid of the β-carotene synthesis module, and Figure C is a schematic diagram of the carrier plasmid of the mevalonic acid synthesis module. Detailed Implementation

[0035] The present invention will be further described below with reference to embodiments. Those skilled in the art will be able to implement the present invention based on these descriptions. Furthermore, the embodiments of the present invention described below are generally only some, not all, of the embodiments of the present invention. Therefore, all other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort should fall within the scope of protection of the present invention.

[0036] In one embodiment, the present invention employs genetic engineering techniques to construct a genetically engineered bacterium that produces high levels of β-ionone. The genome of this genetically engineered bacterium includes a mevalonic acid synthesis module, a β-carotene synthesis module, and a β-ionone synthesis module, wherein: The mevalonic acid synthesis module is used to introduce the mevalonic acid pathway into the genetically engineered bacteria. The β-carotene synthesis module is used to introduce a β-carotene synthesis pathway into the genetically engineered bacteria. The β-ionone synthesis module is used to introduce a β-ionone synthesis pathway into the genetically engineered bacteria; the β-ionone synthesis module connects a soluble protein tag to the gene encoding the carotenoid cleavage dioxygenase NtCCD1, and then inserts an Amp... R +pMB1 vector obtained; The soluble protein tag is selected from one of the following: thioredoxin tag, maltose-binding protein tag, and glutathione transferase tag.

[0037] This invention constructs a highly efficient expression vector and its expression strain for NtCCD1 by fusing a thioredoxin tag, a maltose-binding protein tag, and a glutathione transferase tag into the gene encoding the carotenoid cleavage dioxygenase NtCCD1. This vector is then applied to fermentation culture in a medium containing tobacco biomass to effectively enhance the catalytic ability of tobacco to cleave β-carotene to produce β-ionone.

[0038] The high-efficiency expression vector for NtCCD1, namely the β-ionone synthesis module, is an Amp vector carrying a soluble protein tag and the encoding gene for NtCCD1. R The pMB1 vector introduces a β-ionone synthesis pathway into the genetically engineered bacteria. This pathway, due to the action of specific soluble protein tags, including thioredoxin, maltose-binding protein, and glutathione transferase tags, enables the genetically engineered bacteria to efficiently express NtCCD1 during fermentation. Taking glutathione transferase as an example of a soluble protein tag... Figure 1 Figure A in the diagram shows a schematic diagram of a plasmid serving as a module for the synthesis of β-ionone.

[0039] Thioredoxin A (TrxA), maltose-binding protein (MBP), and glutathione S-transferase (GST) are soluble protein tags screened by the inventors that are suitable for the efficient expression of NtCCD1 provided in this invention. The nucleotide sequence of the GST tag is shown in SEQ ID NO.3, the nucleotide sequence of the TrxA tag is shown in SEQ ID NO.4, and the nucleotide sequence of the MBP tag is shown in SEQ ID NO.5.

[0040] In one embodiment, the soluble protein tag is a maltose-binding protein tag.

[0041] Compared to thioredoxin and glutathione transferase tags, when the maltose-binding protein tag is co-inserted with the NtCCD1 coding gene into Amp... R The genetically engineered bacteria constructed by transforming the pMB1 vector into E. coli have a more efficient ability to express NtCCD1, which is reflected in a higher yield of β-ionone.

[0042] In one embodiment, the amino acid sequence of the carotene cleavage dioxygenase NtCCD1 is shown in SEQ ID No. 2.

[0043] The protease represented by the amino acid sequence shown in SEQ ID No. 2 is carotenoid cleavage dioxygenase NtCCD1, which originates from the carotenoid cleavage dioxygenase NtCCD1 of *Nicotiana tomentosiformis*. NtCCD1 is a highly efficient carotenoid cleavage dioxygenase found by the inventors in tobacco that catalyzes the cleavage of β-carotene to produce β-ionone. The inventors have discovered in experiments that NtCCD1 exhibits high specificity and high catalytic activity in catalyzing the conversion of β-carotene to β-ionone in tobacco. Therefore, this invention uses it as the basis for constructing a genetically engineered bacterium that produces high yields of β-ionone with a natural tobacco aroma.

[0044] Specifically, the nucleotide sequence of the gene encoding the carotenoid cleavage dioxygenase NtCCD1 is shown in SEQ ID No. 1.

[0045] In one embodiment, the carotene-cleaving dioxygenase is obtained by a single-point mutation at any of the following sites in the amino acid sequence shown in SEQ ID No. 2: The histidine (His) at position 431 is mutated to tyrosine (Tyr); The histidine (His) at position 431 is mutated to lysine (Lys); The histidine at position 431 (His) is mutated to glutamine (Gln).

[0046] More active carotenoid cleavage dioxygenases possess a higher ability to catalyze the cleavage of β-carotene to produce β-ionone. This invention obtains a single-point-mutated carotenoid cleavage dioxygenase mutant by mutating the amino acid sequence shown in SEQ ID No. 2 at position 431 (histidine to tyrosine, lysine, or glutamine). This mutant can improve the catalytic activity of the wild-type enzyme shown in SEQ ID No. 2, resulting in genetically engineered bacteria with higher β-ionone yield.

[0047] In one embodiment, the gene encoding the soluble protein tag and the carotenoid cleavage dioxygenase NtCCD1 is regulated by the Ptac promoter.

[0048] In one embodiment, the mevalonic acid synthesis module is constructed as follows: The genes encoding acetyl-CoA thiolase EcatoB, 3-hydroxy-3-methylglutaryl-CoA synthase SchmgS, 3-hydroxy-3-methylglutaryl-CoA reductase SchmgR, mevalonate kinase ScMK, mevalonate phosphate kinase Scpmk, phosphomethyl valerate decarboxylase ScPMD, isoprene pyrophosphate isomerase EcIDI, and geranyl diphosphate synthase EcispA were inserted into Chl. R After adding the p15A vector, an expression plasmid for the mevalonate pathway was obtained, and this expression plasmid was then transformed into the genetically engineered bacteria. Figure 1 Figure C in the diagram shows a schematic diagram of the plasmid serving as the mevalonic acid synthesis module.

[0049] Specifically, EcatoB is E. coli acetoacetyl-CoA thiolase, an acetyl-CoA thiolase from *E. coli*; SchmgS is S. cerevisiae HMG-CoA synthase, a 3-hydroxy-3-methylglutaryl-CoA synthase from *Saccharomyces cerevisiae*; SchmgR is S. cerevisiae HMG-CoA reductase, a 3-hydroxy-3-methylglutaryl-CoA reductase from *Saccharomyces cerevisiae*; ScMK is S. cerevisiae mevalonate kinase, a mevalonate kinase from *Saccharomyces cerevisiae*; Scpmk is S. cerevisiae mevalonate kinase, a mevalonate phosphate kinase from *Saccharomyces cerevisiae*; ScPMD is S. cerevisiae phosphomevalonate decarboxylase, a phosphomevalonate decarboxylase from *Saccharomyces cerevisiae*; and EcIDI is E. coli isopentenyl diphosphate. isomerase is an isoprene pyrophosphate isomerase derived from Escherichia coli; EcispA is E. coli geranyl diphosphate synthase derived from Escherichia coli.

[0050] Specifically, as a preferred embodiment of the present invention, the nucleotide sequence of the gene encoding EcatoB is shown in SEQ ID No. 6; the nucleotide sequence of the gene encoding SchmgS is shown in SEQ ID No. 7; the nucleotide sequence of the gene encoding SchmgR is shown in SEQ ID No. 8; the nucleotide sequence of the gene encoding ScMK is shown in SEQ ID No. 9; the nucleotide sequence of the gene encoding Scpmk is shown in SEQ ID No. 10; the nucleotide sequence of the gene encoding ScPMD is shown in SEQ ID No. 11; the nucleotide sequence of the gene encoding EcIdi is shown in SEQ ID No. 12; and the nucleotide sequence of the gene encoding EcispA is shown in SEQ ID No. 17 of the sequence listing.

[0051] In one embodiment, the genes encoding EcatoB, SchmgS, SchmgR, and EcispA are regulated by the Plac promoter; the genes encoding ScMK, Scpmk, ScPMD, and EcIDI are regulated by the Ptrc promoter.

[0052] In one embodiment, the β-carotene synthesis pathway is constructed as follows: The genes encoding gerany pyrophosphate synthase PvCrtE, lycopene cyclase PvCrtY, phytoene desaturase PaCrtI, and phytoene synthase LpCrtB were inserted into Spec. R After adding the CloDF13 vector, an expression plasmid for the β-carotene pathway was obtained, and this plasmid was then transformed into the genetically engineered bacteria. Figure 1 Figure B in the diagram shows a schematic diagram of a plasmid serving as a module for β-carotene synthesis.

[0053] Specifically, PvCrtE is Pseudescherichia vulneris Geranylgeranyl diphosphate synthase, a geranyl pyrophosphate synthase derived from *Pseudescherichiavulneris*; PvCrtY is Pseudescherichiavulneris lycopene cyclase, a lycopene cyclase derived from *Pseudescherichiavulneris*; PaCrtI is Pantoea agglomerans Phytoene desaturase, a phytoene desaturase derived from *Pantoea agglomerans*; and LpCrtB is Lamprocystis purpurea phytoene synthase, a phytoene synthase derived from *Pantoea purpurea*.

[0054] Specifically, the nucleotide sequence of the gene encoding PvCrtE is shown in SEQ ID No. 13; the nucleotide sequence of the gene encoding PvCrtY is shown in SEQ ID No. 14; the nucleotide sequence of the gene encoding PaCrtI is shown in SEQ ID No. 15; and the nucleotide sequence of the gene encoding LpCrtB is shown in SEQ ID No. 16.

[0055] In one embodiment, the coding genes for PvCrtE, PvCrtY, PaCrtI, and LpCrtB are regulated by the Plac promoter.

[0056] In this embodiment of the invention, the experimental reagents were as follows: DNA Maker (1000, 5000, 10000) was purchased from Tiangen Biotech (Beijing) Co., Ltd.; tryptone and yeast extract were purchased from Oxoid Corporation, USA; gel extraction kit and mini plasmid extraction kit were purchased from Tiangen Biotech (Beijing) Co., Ltd.; seamless cloning kit was purchased from Nanjing Novizan Biotechnology Co., Ltd.; gene and primer synthesis and sequencing were performed by Shanghai Sangon Biotech Co., Ltd.; β-ionone (purity ≥98%) control was purchased from Shanghai Aladdin Co., Ltd.; other routine biochemical reagents were domestically produced analytical grade.

[0057] In this embodiment of the invention, regarding reagent preparation: (1) Lysobroth (LB) medium Weigh 10 g tryptone, 5 g yeast extract, and 10 g sodium chloride, dissolve in distilled water, and bring the volume to 1 L (adjust the pH to 7.0-7.5 with sodium hydroxide). Sterilize at 121°C for 20 min. When preparing LB solid medium, add 20 g / L agar powder before autoclaving.

[0058] (2) SOC medium Weigh 34 g of SOC solid powder, dissolve it in distilled water, and bring the volume to 1 L. Autoclave at 121℃ for 20 min, dispense 1 mL into each tube, and store at -80℃ for later use.

[0059] (3) 2×YT fermentation medium (containing 10% glycerol) Weigh out 16 g tryptone, 10 g yeast extract, 10 g sodium chloride, and 100 g glycerol, and dissolve them in 900 mL of deionized water. Add distilled water to dissolve the remaining solution and bring the volume to 1 L (adjust the pH to 7.0 with sodium hydroxide). Sterilize at 121°C for 20 min.

[0060] (4) Preparation of commonly used antibiotics Weigh an appropriate amount of antibiotic powder and prepare a stock solution according to the following antibiotic formula (chloramphenicol 34 mg / L, spectinomycin hydrochloride 50 mg / L, ampicillin 100 mg / L). After filtration and sterilization, store at -20℃ for later use. The final concentration when used is 0.1%.

[0061] In this embodiment of the invention, regarding the experimental method: (1) Extraction of Escherichia coli plasmids The extraction of E. coli plasmids was performed according to the instructions of the Tiangen plasmid extraction kit.

[0062] (2) Heat shock transformation of Escherichia coli plasmids E. coli competent cells were purchased from Qingke Biotechnology. The heat shock transformation steps are as follows: 1) Remove competent cells from a -80°C freezer and immediately place them on ice to thaw; 2) Add an appropriate volume of plasmid DNA to competent cells, gently thaw, and place on ice for 5 minutes; 3) Place competent cells in a 42°C water bath for 45 seconds, then immediately place them on ice for 3-5 minutes; 4) Add 1 mL of SOC medium (preheated), then incubate at 37°C in a shaker for 0.5-1 h to rejuvenate; 5) Spread the bacterial solution evenly on the corresponding antibiotic plate and incubate at 37°C until single colonies grow.

[0063] (3) Plasmid construction Based on the design of upstream and downstream primers for the NtCCD1 encoding gene with the nucleotide sequence shown in SEQ ID No. 1, PCR was performed. The PCR reaction system was prepared in accordance with the instructions for KOD high-fidelity PCR enzyme. After PCR was completed, agarose gel electrophoresis was performed.

[0064] 1) Agarose gel electrophoresis a) Preparation of agarose gel Weigh 0.9 g of agarose into a beaker, pour in 100 mL of 1×TAE solution, add 5 μL of 10× nucleic acid dye, mix well, and heat in a microwave oven until completely dissolved. Then shake well, pour into an electrophoresis plate, insert a comb with an appropriate pore size, and allow it to solidify at room temperature.

[0065] b) Sample preparation Add an appropriate amount of 10×DNA loading buffer to the PCR reaction solution and mix well.

[0066] c) Sample loading Carefully remove the comb from the electrophoresis plate, then place the agarose gel into the electrophoresis tank and add an appropriate amount of the prepared sample to each well.

[0067] d) Gel electrophoresis and imaging The electrophoresis tank voltage was set to 180 V and electrophoresis was performed for about 20 minutes. Then, the agarose gel was placed in a gel imaging system for observation and photographic recording.

[0068] 2) DNA recycling The agarose gel recovery procedure was performed according to the Tiangen gel recovery kit. After DNA recovery was completed, the purity and concentration of DNA were determined using a micro spectrophotometer.

[0069] 3) Plasmid assembly Based on the recovered DNA concentration, calculate the volume of the added gene fragment and plasmid backbone fragment to be used, add 2× seamless cloning assembly reagent, react at 50℃ for 5-15 min, then incubate on ice for 5 min, and perform plasmid transformation.

[0070] In this embodiment of the invention, the genotype information of the constructed plasmids is shown in Table 1. The original plasmid Chl... R +p15A, Spec R +CloDF13、Amp R +pMB1 can be obtained using existing technologies.

[0071] Table 1

[0072] In this embodiment of the invention, the PCR reaction procedure is as follows: preheating at 95°C for 3 minutes; denaturation at 94°C for 30 seconds, annealing at 57°C for 30 seconds, annealing at 72°C for 2 minutes, for a total of 30 cycles; extension at 72°C for 6 minutes; and storage at 4°C. The PCR amplification system is shown in Table 2.

[0073] Table 2 System components Volume (μL) water 23.4 template 1.0 forward primer 0.3 reverse primer 0.3 KOD Dye Mix 25 Total volume 50 water 23.4 Example 1 The following method was used to construct a genetically engineered bacterium that produces high levels of β-ionone: (1) Construction of mevalonic acid synthesis module: The coding genes for EcatoB, SchmgS, SchmgR, ScMK, Scpmk, ScPMD, EcIdi, and EcispA were inserted into Chl R In p15A, the coding genes for EcatoB, SchmgS, SchmgR, and EcispA were regulated by the Plac promoter, and the coding genes for ScMK, Scpmk, ScPMD, and EcIDI were regulated by the Ptrc promoter, thus constructing plasmid 1, the mevalonate synthesis module. Figure 1Figure C in the diagram shows a schematic diagram of the plasmid used as the mevalonic acid synthesis module constructed in this step.

[0074] Specifically, the nucleotide sequences of the genes encoding EcatoB, SchmgS, SchmgR, ScMK, Scpmk, ScPMD, EcIdi, and EcispA are shown in SEQ ID No. 6, SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 9, SEQ ID No. 10, SEQ ID No. 11, SEQ ID No. 12, and SEQ ID No. 17, respectively.

[0075] (2) Construction of β-carotene synthesis module: The coding genes of PvCrtE, PvCrtY, PaCrtI, and LpCrtB were inserted into plasmid 2 (Spec). R In plasmid +CloDF13), the encoding genes of PvCrtE, PvCrtY, PaCrtI, and LpCrtB were regulated by the Plac promoter to construct plasmid 2, namely the β-carotene synthesis module. Figure 1 Figure B in the diagram shows a schematic diagram of the plasmid used as the β-carotene synthesis module constructed in this step.

[0076] Specifically, the nucleotide sequences of the genes encoding PvCrtE, PvCrtY, PaCrtI, and LpCrtB are shown in SEQ ID No. 13, SEQ ID No. 14, SEQ ID No. 15, and SEQ ID No. 16, respectively.

[0077] (3) Construction of β-ionone synthesis module: The GST tag was linked to the gene encoding the carotenoid cleavage dioxygenase NtCCD1, and then inserted into Amp R The pMB1 vector was used, and the gene encoding the GST tag and the carotenoid cleavage dioxygenase NtCCD1 was regulated by the Ptac promoter to construct plasmid 3, namely the β-ionone synthesis module. Figure 1 Figure A in the diagram shows a schematic diagram of the plasmid used as the β-ionone synthesis module constructed in this step.

[0078] Specifically, the amino acid sequence of NtCCD1 is shown in SEQ ID No. 2, the nucleotide sequence of its encoding gene is shown in SEQ ID No. 1, and the nucleotide sequence of the GST tag is shown in SEQ ID No. 3.

[0079] (4) Constructing a β-ionone synthesis module: The mevalonate synthesis module vector plasmid obtained in step (1), the β-carotene synthesis module vector plasmid obtained in step (2), and the β-carotene synthesis module vector plasmid described in step (3) are co-transformed into Escherichia coli (E. coli DH5α) to obtain a β-ionone synthesis genetically engineered strain.

[0080] Example 2 A genetically engineered bacterium producing high levels of β-ionone was constructed. The method differed from that in Example 1 in that the GST tag was replaced with an MBP tag in step (3), and the nucleotide sequence of the MBP tag is shown in SEQ ID NO.5. The other steps were the same as in Example 1.

[0081] The plasmid obtained in step (3) of this embodiment is plasmid 4.

[0082] Example 3 A genetically engineered bacterium producing high levels of β-ionone was constructed. The method differed from that in Example 1 in that the GST tag was replaced with a TrxA tag in step (3), and the nucleotide sequence of the TrxA tag is shown in SEQ ID NO.4 of the sequence listing. The other steps were the same as in Example 1.

[0083] The plasmid obtained in step (3) of this embodiment is plasmid 5.

[0084] Example 4 The method for constructing a genetically engineered bacterium that produces high levels of β-ionone differs from that in Example 1 in that the β-carotene synthesis module vector plasmid transformed into E. coli DH5α in step (4) is a mutated plasmid. The mutation involves changing histidine (His) at position 431 of the wild-type enzyme, as shown in SEQ ID No. 2, to tyrosine (Tyr). The specific steps are as follows: (1) Construct a mevalonic acid synthesis module, using the same method as in Example 1.

[0085] (2) Construct a β-carotene synthesis module, using the same method as in Example 1.

[0086] (3) Construction of β-ionone synthesis module: Using plasmid 3 obtained in Example 1 as a template, and primer pairs H431Y_F and H431Y_R, and primer pairs Backbone_R and Backbone_F in Table 3 were used for PCR amplification and ligation to obtain mutant plasmid 7. Mutant plasmid 1 carries a GST tag initiated by the Ptac promoter and the coding gene of the NtCCD1 mutant. The mutant is obtained by mutating histidine (His) at position 431 of the wild-type enzyme shown in SEQ ID No. 2 to tyrosine (Tyr). Mutant plasmid 1 was used as the β-carotene synthesis module.

[0087] (4) Constructing a β-ionone synthesis module: The mevalonate synthesis module vector plasmid obtained in step (1), the β-carotene synthesis module vector plasmid obtained in step (2), and the β-carotene synthesis module vector plasmid described in step (3) are co-transformed into Escherichia coli (E. coli DH5α) to obtain a β-ionone synthesis genetically engineered strain.

[0088] Table 3 Primer name Primer sequence H431Y _F TGGGACGATTCTGAACTATATGGCAAAGATTACCGGTATTGTC H431Y _R GTTCAGAATCGTCCCATATACATA H431L _F TGGGACGATTCTGAACCTGATGGCAAAGATTACCGGTATTGTC H431Q _F TGGGACGATTCTGAACCAAATGGCAAAGATTACCGGTATTGTC H431A _F TGGGACGATTCTGAACGCGATGGCAAAGATTACCGGTATTGTC H431G _F TGGGACGATTCTGAACGGTATGGCAAAGATTACCGGTATTGTC Backbone_R cgctgtaggtatctcagttcgg Backbone_F tgagatacctacagcgtgagct Example 5 A genetically engineered bacterium producing high levels of β-ionone was constructed. The method differed from Example 1 in that the β-carotene synthesis module vector plasmid transformed into E. coli DH5α in step (4) was a mutated plasmid 8. The mutation involved changing histidine (His) at position 431 of the wild-type enzyme, as shown in SEQ ID No. 2, to lysine (Lys). The construction steps are as follows: The specific steps are the same as in Example 4, except that the primers used in step (3) are the primer pairs H431L_F and H431Y_R, and primer pairs Backbone_R and Backbone_F in Table 3.

[0089] Example 6 A genetically engineered bacterium producing high levels of β-ionone was constructed. The method differed from Example 1 in that the β-carotene synthesis module vector plasmid transformed into E. coli DH5α in step (4) was a mutated plasmid 9. The mutation involved replacing histidine (His) at position 431 of the wild-type enzyme, as shown in SEQ ID No. 2, with glutamine (Gln). The construction steps are as follows: The specific steps are the same as in Example 4, except that the primers used in step (3) are H431Q_F and H431Y_R, primer pair Backbone_R and Backbone_F from Table 3.

[0090] Comparative Example 1 A genetically engineered bacterium producing β-ionone was constructed. The method differed from that in Example 1 in that the GST tag was replaced with a Sumo tag in step (3). The amino acid sequence of the Sumo tag is shown in SEQ ID NO.18, and the resulting plasmid is plasmid 6. The other steps were the same as in Example 1.

[0091] Comparative Example 2 A genetically engineered bacterium producing high levels of β-ionone was constructed. The method differed from Example 1 in that the β-carotene synthesis module vector plasmid transformed into E. coli DH5α in step (4) was a mutated plasmid 10. The mutation involved changing histidine (His) at position 431 of the wild-type enzyme, as shown in SEQ ID No. 2, to alanine (Ala). The construction steps are as follows: The specific steps are the same as in Example 4, except that the primers used in step (3) are H431A_F and H431Y_R, primer pair Backbone_R and Backbone_F from Table 3.

[0092] Comparative Example 3 A genetically engineered bacterium producing high levels of β-ionone was constructed. The method differed from Example 1 in that the β-carotene synthesis module vector plasmid transformed into E. coli DH5α in step (4) was a mutated plasmid 11. The mutation involved changing histidine (His) at position 431 of the wild-type enzyme, as shown in SEQ ID No. 2, to glycine (Gly). The construction steps are as follows: The specific steps are the same as in Example 4, except that the primers used in step (3) are H431G_F and H431Y_R, primer pair Backbone_R and Backbone_F from Table 3.

[0093] Performance Characterization (1) The genetically engineered bacteria constructed in Examples 1 to 6 and Comparative Examples 1 to 3 were activated, and single colonies were inoculated into LB test tubes and cultured overnight at 37°C and 200 rpm for 12 hours to prepare seed culture. The seed culture was inoculated into 10 mL of fermentation medium containing tobacco extract at an inoculation rate of 2% (v / v) and cultured at 37°C and 250 rpm for 48 hours to obtain fermentation broth. After sterilization by filtration through a 0.45 μm filter membrane, the content of β-ionone in the fermentation broth was detected by gas chromatography-mass spectrometry. The results are shown in Table 4.

[0094] The fermentation medium containing tobacco extract consists of 100 g of tobacco extract, 10 g of sodium chloride, and distilled water to a final volume of 1 L.

[0095] Table 4 Group Content (mg / L) Example 1 12.15 Example 2 16.32 Example 3 14.13 Example 4 28.17 Example 5 24.52 Example 6 22.98 Comparative Example 1 8.43 Comparative Example 2 12.43 Comparative Example 3 10.15 As shown in Table 4, this invention employs modular plasmid technology from synthetic biology. By mining the encoding gene of NtCCD1, a carotenoid cleavage dioxygenase in tobacco, and screening specific soluble protein tags, including thioredoxin, maltose-binding protein, and glutathione transferase tags, and by modifying NtCCD1 through a single-point mutation at position 431 (histidine to tyrosine, lysine, or glutamine), a fermentation enzyme and genetically engineered bacteria capable of efficiently catalyzing the cleavage of β-carotene in tobacco to produce β-ionone were constructed. This genetically engineered bacteria, as aroma-producing genetically engineered bacteria, achieves the biosynthesis of β-ionone, a component of tobacco aroma, with high efficiency. As shown in Examples 1 to 6, the yield of tobacco aroma β-ionone can reach 28.17 mg / L.

[0096] Comparative analysis of Example 1 and Comparative Examples 1, 2, and 3 shows that fusing thioredoxin, maltose-binding protein, and glutathione transferase tags into the encoding gene of carotenoid cleavage dioxygenase NtCCD1, as well as single-point mutations of histidine at position 431 of NtCCD1 to tyrosine, lysine, or glutamine, are significant for effectively enhancing the catalytic ability of tobacco to cleave β-carotene to produce β-ionone. Furthermore, it is evident that not all mutations have a positive effect; different soluble protein tags of NtCCD1 have varying effects on promoting NtCCD1 expression and increasing β-ionone production.

[0097] A comparative analysis of Examples 1 and 2 shows that the soluble protein tag is preferably a maltose-binding protein tag. When the maltose-binding protein tag and the NtCCD1 coding gene are co-inserted into Amp... R The genetically engineered bacteria constructed by transferring the pMB1 vector into E. coli have a more efficient ability to express NtCCD1 and a higher yield of β-ionone.

[0098] (2) The genetically engineered bacteria constructed in Examples 1 to 6 and Comparative Examples 1 to 3 were activated, and single colonies were inoculated into LB test tubes and cultured overnight at 37°C and 200 rpm for 12 hours to prepare seed culture. The seed culture was inoculated into 10 mL of tobacco dust substrate medium at a volume ratio of 2% and cultured at 37°C and 250 rpm for 48 hours to obtain fermentation broth. The fermentation broth was filtered through a 0.45 μm filter membrane for sterilization, and the content of β-ionone in the fermentation broth was detected by gas chromatography-mass spectrometry. The results are shown in Table 5.

[0099] The composition of the tobacco dust substrate culture medium is as follows: 50 g of waste tobacco biomass hydrolysate, 10 g of xylose, 5 g of glucose, 10 g of sodium chloride, and 20 g of glycerol, dissolved in distilled water and brought to a final volume of 1 L.

[0100] Table 5 Group Content (mg / L) Example 1 8.87 Example 2 11.21 Example 3 10.30 Example 4 20.53 Example 5 17.92 Example 6 17.81 Comparative Example 1 6.15 Comparative Example 2 9.01 Comparative Example 3 8.38 As shown in Table 5, the genetically engineered bacteria constructed in this invention can be effectively applied to the treatment of waste tobacco dust, turning waste into treasure, and has good application prospects.

[0101] Unless otherwise specified, the raw materials and equipment used in this invention are all commonly used in the field; unless otherwise specified, the methods used in this invention are all conventional methods in the field.

[0102] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Any simple modifications, alterations, and equivalent transformations made to the above embodiments based on the technical essence of the present invention shall still fall within the protection scope of the present invention.

Claims

1. A genetically engineered bacterium that produces high levels of β-ionone, characterized in that: The genome of the genetically engineered bacteria includes a mevalonic acid synthesis module, a β-carotene synthesis module, and a β-ionone synthesis module, wherein: The mevalonic acid synthesis module is used to introduce the mevalonic acid pathway into the genetically engineered bacteria. The β-carotene synthesis module is used to introduce a β-carotene synthesis pathway into the genetically engineered bacteria. The β-ionone synthesis module is used to introduce a β-ionone synthesis pathway into the genetically engineered bacteria; the β-ionone synthesis module connects a soluble protein tag to the gene encoding the carotenoid cleavage dioxygenase NtCCD1, and then inserts an Amp... R +pMB1 vector obtained; The soluble protein tag is selected from one of the following: thioredoxin tag, maltose-binding protein tag, and glutathione transferase tag.

2. The genetically engineered bacterium for high β-ionone production as described in claim 1, characterized in that: The soluble protein tag is a maltose-binding protein tag.

3. The genetically engineered bacterium producing high levels of β-ionone as described in claim 1, characterized in that: The amino acid sequence of the carotene cleavage dioxygenase NtCCD1 is shown in SEQ ID No.

2.

4. A genetically engineered bacterium producing high levels of β-ionone as described in claims 1 or 3, characterized in that: The nucleotide sequence of the gene encoding the carotenoid cleavage dioxygenase NtCCD1 is shown in SEQ ID No.

1.

5. The genetically engineered bacterium producing high levels of β-ionone as described in claim 1, characterized in that: The carotene-cleaving dioxygenase is obtained by a single-point mutation at any of the following sites in the amino acid sequence shown in SEQ ID No. 2: The histidine at position 431 is mutated to tyrosine; Histidine at position 431 is mutated to lysine; The histidine at position 431 is mutated to glutamine.

6. The genetically engineered bacterium for high β-ionone production as described in claim 1, characterized in that: The gene encoding the soluble protein tag and the carotenoid cleavage dioxygenase NtCCD1 is regulated by the Ptac promoter.

7. The genetically engineered bacterium for high β-ionone production as described in claim 1, characterized in that: The method for constructing the mevalonic acid synthesis module is as follows: The genes encoding acetyl-CoA thiolase, 3-hydroxy-3-methylglutaryl-CoA synthase, 3-hydroxy-3-methylglutaryl-CoA reductase, mevalonate kinase, mevalonate phosphate kinase, methyl valerate decarboxylase, isoprene pyrophosphate isomerase, and geranyl diphosphate synthase were inserted into Chl. R After adding the p15A vector, an expression plasmid for the mevalonic acid pathway was obtained, and the expression plasmid was then transferred into the genetically engineered bacteria.

8. The genetically engineered bacterium for high β-ionone production as described in claim 1, characterized in that: The method for constructing the β-carotene synthesis pathway is as follows: The genes encoding gerany-based pyrophosphate synthase, lycopene cyclase, phytopene desaturase, and phytopene synthase were inserted into Spec. R After adding the CloDF13 vector, an expression plasmid for the β-carotene pathway was obtained, and the expression plasmid was then transferred into the genetically engineered bacteria.

9. The use of the genetically engineered bacteria as described in any one of claims 1 to 8 in the fermentation production of β-ionone.

10. The application as described in claim 9, characterized in that: The culture medium used for fermentation contains tobacco biomass.

Images