A high-throughput screening method for single-domain antibodies

By combining phage library construction and single-cell emulsification technology, and utilizing magnetic beads to capture single-domain antibodies and nucleic acid sequences, along with a workflow, a highly efficient screening method for single-domain antibodies has been achieved. This solves the technical problems in existing technologies, realizes a highly efficient single-domain antibody screening method, and improves the screening efficiency and accuracy of single-domain antibodies.

CN120944873BActive Publication Date: 2026-03-24BIOINTRON BIOLOGICAL INC
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511477419.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-10-16
Publication Date
2026-03-24
Estimated Expiration
2045-10-16

AI Technical Summary

Technical Problem

Existing alpaca single-domain antibody screening methods suffer from insufficient phage screening throughput and efficiency, resulting in a small number of antibody sequences and many repetitive sequences, making it difficult to meet the needs of high-throughput screening.

Method used

By combining phage library construction and single-cell emulsification technology, single-domain antibodies and nucleic acid sequences are captured by magnetic beads, and then combined with flow cytometry and NGS sequencing, efficient screening of single-domain antibodies is achieved.

Benefits of technology

It improves the efficiency and accuracy of single-domain antibody screening, obtains more positive single-domain antibody sequences, reduces repetitive sequences, and meets the needs of high-throughput screening.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120944873B_ABST
    Figure CN120944873B_ABST
Patent Text Reader

Abstract

The present application belongs to the field of biotechnology, and particularly relates to a high-throughput screening method of single-domain antibody. The method provided by the present application mainly comprises the following steps: constructing a phage library of single-domain antibody, and realizing high-throughput bacterial encapsulation through emulsification technology; capturing single-domain antibody and antibody mRNA in emulsified microdroplets through designed magnetic beads; performing flow sorting on the single-domain antibody on the magnetic beads after reverse transcription of the mRNA on the magnetic beads; obtaining positive magnetic beads through sorting, then amplifying the single-domain antibody sequence through PCR and performing NGS sequencing; finally, verifying the activity of the antibody through high-throughput expression after sequence analysis. The screening method provided by the present application effectively improves the phage screening efficiency of single-domain antibody, provides a solid foundation for the large-scale screening of single-domain antibody, and is conducive to further expanding the application range of single-domain antibody.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a high-throughput screening method for single-domain antibodies. Background Technology

[0002] Alpacas, belonging to the camel family, naturally possess single-heavy chain antibodies lacking the light chain. The heavy chain lacks the CH1 region, and the variable region of the heavy chain is called a single-domain antibody, with a molecular weight of 15 kDa. Therefore, alpaca single-domain antibodies are characterized by small molecular weight, long CDR3 length, and the absence of a light chain, making them widely used in the development of various types of drugs, including bispecific therapeutic antibodies, CARs for cell therapy, and nucleic acid drugs. Currently, the development of alpaca single-domain antibodies mainly utilizes phage display technology. The antibody sequence is amplified using PCR, then constructed into a phagemid vector and fused with the PIII protein on the phage surface for expression, finally displayed on the phage surface. After multiple rounds of antigen screening and enrichment, single-clone phages are selected, and positive phages are obtained through ELISA, followed by first-generation sequencing to obtain the single-domain antibody sequence.

[0003] Traditional methods for screening antibodies using phages involve displaying the antibody on the phage surface. However, during antigen screening, the large size of phages and the abundance of surface proteins inevitably lead to non-specific binding issues. Furthermore, phage screening requires selecting numerous single clones, resulting in a large workload and a limited number of antibody sequences. As the enrichment increases, the selected positive phages may generate many repetitive sequences after first-generation sequencing, further reducing the number of sequences obtained through screening.

[0004] In summary, existing alpaca single-domain antibodies, lacking light chains, can be screened directly using phage display or yeast display platforms. However, their screening throughput and efficiency cannot meet the needs of single-domain antibody development, making the development of a high-throughput screening method for single-domain antibodies crucial. Summary of the Invention

[0005] To address the aforementioned challenges, this invention provides a method for screening single-domain antibodies. By combining phage library construction and single-cell emulsification technology, phage screening and single-cell sequencing are integrated, solving the non-specific binding problem in phage screening and improving the efficiency of phage screening.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] A high-throughput screening method for single-domain antibodies includes antigen preparation and immunization, phage library construction, single-domain antibody panning, and antibody sequence expression verification. The single-domain antibody panning is achieved through single-cell emulsification technology, in which magnetic beads simultaneously capture single-domain antibodies and their nucleic acid sequences in emulsified oil droplets. After reverse transcription, the magnetic beads are sorted by flow cytometry to obtain positive magnetic beads. The positive magnetic beads are then targeted amplified to obtain single-domain antibody DNA, and the antibody DNA is then sequenced by NGS to obtain the single-domain antibody sequence.

[0008] The screening process for the single-domain antibodies includes the following steps:

[0009] S1. Magnetic bead preparation: DNA probes complementary to the mRNA sequences of antigen proteins and single-domain antibodies are labeled with biotin to further prepare magnetic beads containing antigen proteins and DNA probes.

[0010] S2. Emulsification of magnetic beads: E. coli and the magnetic beads obtained in step S1 are mixed and emulsified to obtain emulsified oil droplets;

[0011] S3. Magnetic beads capture antibodies and nucleic acids: The emulsified oil droplets obtained in step S2 are repeatedly frozen and thawed to lyse them into single-domain antibodies and antibody mRNA sequences. Then, the antigen proteins on the magnetic beads are used to capture the single-domain antibodies, while the DNA probes on the magnetic beads can capture the mRNA sequences. After washing, the magnetic beads are recovered.

[0012] S4, mRNA reverse transcription: The magnetic beads recovered in step S3 are reverse transcribed to obtain reverse transcription magnetic beads;

[0013] S5. Flow cytometry sorting of positive magnetic beads: The reverse transcription magnetic beads obtained in step S4 are sorted by flow cytometry to separate fluorescent positive magnetic beads.

[0014] S6. Targeted antibody sequence verification: Perform PCR amplification and sequencing on the fluorescent positive magnetic beads sorted in step S5, and then perform sequence assembly and analysis.

[0015] Preferably, the sequence of the DNA probe described in step S1 is shown in SEQ ID NO.1.

[0016] GGAGGGAAGGTAAATATTGA (SEQ ID NO. 1).

[0017] Preferably, the microbial bacteria mentioned in step S2 are one of Escherichia coli, Bacillus subtilis, and Bifidobacterium.

[0018] Preferably, the repeated freeze-thaw process in step S3 is as follows: the emulsified oil droplets obtained in step S2 are frozen at -80 to -70°C for 20 to 25 minutes, and then thawed at 35 to 37°C for 3 to 6 minutes, with the oil droplets being repeatedly frozen and thawed 4 to 7 times. In the actual capture process, the freeze-thaw conditions must be strictly controlled to ensure that the magnetic beads capture single-domain antibodies and mRNA sequences simultaneously.

[0019] Preferably, the specific process of step S4 is as follows: after collecting the magnetic beads recovered in step S3, reverse transcription is performed to convert the antibody mRNA into cDNA, and then fluorescent secondary antibody-labeled magnetic beads are added to it.

[0020] Preferably, the fluorescent secondary antibody is labeled with one of anti-flag APC, anti-flag PE, or anti-flag AF488.

[0021] Preferably, the sequence splicing in step S6 uses one of the following software: SPAdes, Unicycler, or MaSuRCA.

[0022] The present invention also provides the application of single-domain antibodies screened by the high-throughput screening method in the preparation of antigen activity detection reagents.

[0023] The amplified single-domain antibody sequences were gel-extracted and the target fragments were recovered for NGS sequencing. After sequencing, the sequences were assembled and analyzed to obtain single-domain antibody sequences. Then, single-domain antibody sequences were selected and expressed using a mammalian cell expression system. After purification, they were used for in vitro functional assays.

[0024] Compared with the prior art, the technical advantages of the present invention are as follows: By combining phage library construction technology and single-cell technology, the present invention avoids enriching protein antigens with the whole phage, but directly uses single-domain antibody screening. At the same time, combined with NGS sequencing, all positive single-domain antibody sequences can be obtained, which successfully helps high-throughput screening of single-domain antibodies and significantly improves the screening efficiency of single-domain antibodies. Attached Figure Description

[0025] Figure 1 This is an image showing the effect of emulsified oil droplets;

[0026] Figure 2 This is a graph showing the results of an antigen binding assay.

[0027] Figure 3 This is a graph showing the results of a cell binding assay. Detailed Implementation

[0028] The present invention will be further explained below with reference to specific embodiments. However, it should be noted that the following embodiments are only used to explain the present invention and cannot be used to limit the present invention. All technical solutions that are the same as or similar to the present invention are within the protection scope of the present invention. Where specific techniques or conditions are not specified in this embodiment, they shall be operated in accordance with conventional technical methods and instrument manuals in the art; where the manufacturers of reagents or instruments are not specified, they are all conventional products that can be obtained commercially.

[0029] Example 1: A high-throughput screening method for single-domain antibodies

[0030] The screening method includes the following process:

[0031] S1. Preparation of antigen:

[0032] Based on the protein sequence information of Human PD-L1 (UniProtKB: Q15116), amino acid sequences expressing the extracellular region of Leu 25-Gln167 were screened out. Human Fc-tag and Histag tags were fused to the C-terminus of the screened amino acid sequences, respectively, and named them human PD-L1-Fc tag protein and human PD-L1-his tag protein. These two proteins were used in the subsequent alpaca immunization and screening verification process.

[0033] S2, Alpaca's Immunity:

[0034] Alpacas were immunized four times using the tagged proteins (human PD-L1-Fc tag protein and human PD-L1-histag protein) obtained in step S1: For the first immunization, human PD-L1-Fc tag protein was emulsified with Freund's complete adjuvant and injected at multiple subcutaneous lymph nodes in the neck; for the second immunization, human PD-L1-Fc tag protein was emulsified with Freund's incomplete adjuvant and injected at multiple subcutaneous lymph nodes in the neck; for the third and fourth immunizations, human PD-L1-histag protein was emulsified with Freund's incomplete adjuvant and injected at multiple subcutaneous lymph nodes in the neck. Each immunization was spaced two weeks apart. Serum titers were measured seven days after each immunization. After the second immunization, 50 mL of blood was collected each time to separate PBMCs (peripheral blood mononuclear cells). 1 mL of Trizol reagent was added to 1E7 (1×10⁷) PBMCs, and the cells were stored at -80°C.

[0035] S3. Construction of the phage library:

[0036] Total RNA was extracted from PBMCs preserved in step S2 using Trizol. The RNA was then reverse transcribed into cDNA using oligo(dT) (using the SMARTcribe Reverse Transcript kit, TaKaRa, 639536). Nested PCR was performed twice. The primers for the first round of PCR (reaction conditions shown in Tables 1 and 2) were designed for the antibody signal peptide and CH2 regions, amplifying bands of approximately 1000 bp and 750 bp respectively (the amplified fragment size was approximately 750 bp due to the natural lack of the CH1 domain in the alpaca single-domain antibody). The target fragment (approximately 750 bp) obtained from the first round of PCR was gel-extracted and used as a template for the second round of PCR. The primers for the second round of PCR were designed for the FR1 and FR4 regions, amplifying the target fragment size of approximately 400 bp. A single-domain antibody gene fragment (i.e., the product obtained from the second round of PCR) was inserted into a phagemid vector (i.e., the pComb vector) and fused with the PIII protein on the vector for expression. The constructed pComb vector library was electroporated into TG1 electroporated competent cells (SS320 strain), and the cells were collected to obtain a PD-L1 phage antibody library. Fifty single clones were selected for first-generation sequencing to verify the diversity and correct insertion rate of the library. The pComb vector used contains an amber terminator between the inserted fragment and the PIII protein; therefore, it can induce the expression of single-domain antibodies with Flag and his Taq in SS320 bacteria.

[0037] The first round of PCR reaction system and procedure are shown in Tables 1 and 2.

[0038] Table 1. First-round PCR target fragment amplification system

[0039]

[0040] Table 2. First-round PCR amplification procedure

[0041]

[0042] The second round of PCR reaction system and procedure are shown in Tables 3 and 4.

[0043] Table 3. Second-round target fragment amplification system

[0044]

[0045] Table 4. Second-round PCR amplification procedure

[0046]

[0047] Subsequent experiments were then conducted using both conventional methods and the high-throughput screening method of this invention, as detailed below:

[0048] The standard procedure is as follows:

[0049] The synchronously packaged phage library (i.e., the PD-L1 immunophage antibody library obtained in step S3) was subjected to solid-phase panning: PD-L1-his antigen was diluted with PBS into 5 mL immunotubes and incubated overnight at 4°C by rotation coating; phage and blank immunotubes were blocked; immunotubes coated with PD-L1-his were blocked; after blocking, the supernatant from the blocked phage tubes was added to the PD-L1-his immunotubes and incubated by rotation at room temperature for 1 h, then the supernatant was removed, and the cell pellet was washed 8 times with PBST, followed by 2 washes with PBS; trypsin containing 0.25% EDTA was added to elute the bound phage. After the eluted phages infected (i.e., the PD-L1 immunophage antibody library prepared above), a second round of panning of the phage library was prepared, using the same method as the first round of panning.

[0050] Monoclonal screening: The day before, 600 μL of 2YT medium (containing 12 µg / mL tetracycline and 50 µg / mL ampicillin) was added to a 96-well deep-well plate. Monoclonal clones selected in the second round of solid-phase panning were selected and cultured overnight at 220 rpm and 37°C in a shaker. The bacteria were then centrifuged overnight at 4000 rpm for 5 min. 100 µL of the supernatant was used to detect positive clones using ELISA. The results are shown in Table 5 below.

[0051] The ELISA method detection process is as follows:

[0052] (1) Coating: The day before, add 100 μL of PD-L1-his at 1 μg / mL to each well of a 96-well ELISA plate and coat overnight at 4°C;

[0053] (2) Washing: On the second day, remove the supernatant and wash the plate 3 times with 200 μL / well of PBST;

[0054] (3) Blocking: Block with 1% BSA blocking solution at 200 μL / well for 1 h at room temperature.

[0055] (4) Sample preparation: The day before, add 600 μL of 2YT medium (12 µg / mL tetracycline, 50 µg / mL ampicillin) to a 96-well deep-well plate. Select single clones from the second round of solid-phase panning and the third round of cell panning, and culture overnight in a shaker at 220 rpm and 37°C. Centrifuge the overnight bacteria at 4000 rpm for 5 min. Add 100 µL / well of the supernatant sample to the corresponding well plate using a multichannel pipette and incubate at room temperature for 1 h.

[0056] (5) Add secondary antibody: Dilute sufficient secondary antibody, add 100µL / well to the corresponding 96-well microplate, and incubate at room temperature for 1 hour.

[0057] (6) Color development: Add 100µL of TMB at room temperature, incubate at room temperature for 5 min.

[0058] (7) Termination of reaction: Add 100µL of stop solution to terminate the reaction.

[0059] Table 5. BSA and PDL1 test results

[0060]

[0061] As shown in the table above, 96 clones were selected for initial ELISA screening. When the conventional method was used, when the two plates were coated with BSA (bovine serum albumin, equivalent to negative control) and PD-L1-his protein respectively, one clone in the BSA group was found to have non-specific binding (H4), while the positive clone in the PD-L1 group was sent for sequencing and 18 sequences were obtained, but many repetitive sequences were found.

[0062] The specific process of the high-throughput screening method of the present invention is as follows:

[0063] S4. Preparation of magnetic beads: Human PD-L1 protein was randomly labeled with biotin using Thermo's biotin labeling reagent (EZ-Link™ Sulfo-NHS-LC-Biotin, A39257); DNA sequences with 5' end biotin were synthesized at GenScript (the DNA sequence must be complementary to the mRNA sequence of the single-domain antibody); the biotin-labeled human PD-L1-biotin and biotin-DNA were mixed at a molar ratio of 1:1 and incubated with streptavidin magnetic beads for 1 hour; excess protein and DNA fragments were washed away with PBS solution to obtain magnetic beads labeled with human-PD-L1 protein and DNA probe; the labeled magnetic beads were blocked with 3% BSA PBS solution for 1 hour to prevent non-specific adsorption of protein onto the surface of the magnetic beads.

[0064] S5, E. coli and magnetic beads emulsification:

[0065] After infecting SS320 bacteria with the constructed phage library (i.e., the PD-L1 immune phage antibody library obtained in step S3), 1 mM IPTG was added at 37°C to induce single-domain antibody expression for 2 h, resulting in expressed SS320 bacteria. Then, 95 μL of the magnetic beads labeled in step S4 and 2E7 (2 × 10⁻⁶) were added to a 2 mL EP tube. 7After expression, the SS320 strain was emulsified with 600 μL of mineral oil (Sigma) containing 7% ABILEM90 (v / v) and a 2.8 mm steel bead (containing the magnetic bead and the SS320 strain) in a homogenizer until emulsified to the desired consistency. Figure 1 The desired state is achieved by obtaining emulsified oil droplets.

[0066] S6. Magnetic beads capture antibodies and nucleic acids:

[0067] The emulsified oil droplets obtained in step S5 were repeatedly frozen and thawed 5 times to lyse the SS320 bacterial cells and release single-domain antibodies and nucleic acids: each freeze-thaw cycle was performed at -80°C for 20 min and thawed at 37°C for 5 min. After the oil droplets were repeatedly frozen and thawed 5 times, they were incubated at 37°C for 30 min to allow the antigen proteins on the magnetic beads to capture the single-domain antibodies, while the DNA on the magnetic beads could capture the mRNA sequence. After incubation, add 500 μL of glycerol, vortex and mix well, centrifuge at 13000 rpm for 1 min, discard the upper oil layer, add 500 μL of demulsifier (10 mM Tris–HCl (pH 7.4), 1% v / v Triton-X 100, 1% SDS, 100 mM NaCl, 1 mM EDTA), vortex and mix well, centrifuge at 13000 rpm for 5 min, place the tube on a magnetic rack, remove the oil and aqueous phases, and wash the magnetic beads 3 times with PBST (0.1% Tween 20).

[0068] S7, mRNA reverse transcription:

[0069] The magnetic beads recovered in step S6 were first reverse transcribed before being used for subsequent flow cytometry sorting to prevent degradation of the captured mRNA. Reverse transcription was performed using a Takara reverse transcription kit at 37°C for 30 min, after which the magnetic beads were recovered and washed once with PBS. Considering that 42°C might cause denaturation of the PD-L1 protein, a transcriptase (Cat: 2641A) with transcriptional activity at 37°C was selected.

[0070] S8, Flow Cytometry Positive Magnetic Beads:

[0071] Add anti-flag fluorescent antibody (anti-flag APC antibody Cat: 637308) to the magnetic beads after reverse transcription in step S7, incubate at 4°C for 40 min, and wash three times with 2% FBS PBS solution. Then, sort using a Melody flow cytometer, selecting the APC channel to sort fluorescently positive magnetic beads, and transfer the positive magnetic beads to 1.5 mL EP tubes. 21481 fluorescently positive magnetic beads were obtained.

[0072] S9, Targeted Amplification Antibody Sequence

[0073] PCR mix (Takara) and specific single-domain antibody primers (SEQ ID NO.2: GTAGGCAATAGGTATTTCAT; SEQ ID NO.3: TCATCGTCGTCCTTGTAGTC) were added to the fluorescent positive magnetic beads obtained in step S8. The single-domain antibody sequence was amplified on a PCR instrument. After gel extraction to obtain the target fragment, the amplified single-domain antibody sequence was sequenced using BGI's library construction kit (long read sequencing kit, FCSPE300) on a BGI sequencer (MGISEQ-2000). After sequencing, the single-domain antibody sequence was obtained through sequence assembly and analysis.

[0074] Experimental Example 1: Validation of Antibody Sequence Expression

[0075] Ten single-domain antibody sequences were randomly selected from the sequencing library, as shown in SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, and SEQ ID NO.13, respectively. These sequences were expressed using a mammalian cell expression system and purified for in vitro functional assays.

[0076] 1. Antigen Binding Assay: The antigen binding activity of 10 antibodies was detected by ELISA. The specific steps are as follows: The ELISA plate was coated with 2 μg / mL Human PD-L1 / his protein and incubated overnight at 4°C; washed twice with 0.05% PBST, then blocked with 1% BSA at room temperature for 2 h; after blocking, washed three times with 0.05% PBST, and 5-fold diluted 10 antibodies (maximum 100 nM), horseradish peroxidase Anti-HEL VHH Human IgG1 FC Isotype, and positive control (Atebio) were added respectively, and incubated at room temperature for 1 h respectively; washed twice with 0.05% PBST, and then Anti-human IgG (Fc specific) HRP (purchased from Sigma, catalog number A0170, diluted 1:10000 before use) was added to each, and incubated at room temperature for 30 min; 0.05% PBST was used to further enhance the antigen binding activity. Wash twice with PBST, add Beyotime TMB colorimetric solution, react at room temperature for 10 min, then add Beyotime TMB stop solution to immediately stop the reaction, and read OD450 immediately.

[0077] Antigen binding test results as follows Figure 2 As shown: It can be seen that the positive rate of the 10 antibodies in this invention is 100% (10 / 10).

[0078] 2. Cell binding assay: The binding activity of the 10 antibodies obtained above with cells overexpressing human PD-L1 was detected by FACS. The specific steps are as follows:

[0079] (1) CHO-K1 cells overexpressing human PD-L1 protein were seeded into 96-well plates at a ratio of 3E5 cells per well;

[0080] (2) Wash the cells once with PBS solution containing 2% FBS;

[0081] (3) Dilute the antibody to two concentrations (100 nM and 10 nM) and horseradish peroxidase Anti-HEL VHHHuman IgG1 FC Isotype (negative control) respectively, and incubate at room temperature for 30 min;

[0082] (4) Wash three times with PBS solution containing 2% FBS, then add Anti-human IgG (Fc specific) APC fluorescent secondary antibody and incubate at room temperature for 30 min; wash three times with 2% FBS PBS solution; and detect using flow cytometry.

[0083] Antigen binding test results as follows Figure 3 As shown: the positivity rate of the 10 antibodies was 100% (10 / 10).

[0084] It should be noted that although the above embodiments have been described, those skilled in the art can make other changes and modifications to these embodiments once they learn the basic inventive concept. Therefore, the above description is only an embodiment of the present invention and does not limit the scope of patent protection of the present invention. Any equivalent structural or procedural transformations made using the present invention specification, or direct or indirect applications in other related technical fields, are similarly included within the scope of patent protection of the present invention.

Claims

1. A single-domain antibody against Human PD-L1, characterized in that, The amino acid sequence of the anti-Human PD-L1 single-domain antibody is shown in SEQ ID NO.

4.

2. The application of the anti-Human PD-L1 single-domain antibody as described in claim 1 in the preparation of antigen activity detection reagents.

Citation Information

Patent Citations

  • Anti-CD3 nano antibody capable of activating T cell activity as well as preparation method and application of anti-CD3 nano antibody

    CN119661713A

  • High throughput sequencing of paired VH and VL transcripts from b cells secreting antigen-specific antibodies

    US20160319348A1