Visual detection reagent based on RPA-CRISPR-Cas12a system for cyprinid type II herpesvirus and application of visual detection reagent

By designing primers and crRNA using the RPA-CRISPR-Cas12a system and combining them with fluorescence detection, a rapid, simple, and low-cost CyHV-2 detection method was achieved, solving the problems of complexity and high cost of existing detection methods and making it suitable for field applications.

CN120945130APending Publication Date: 2025-11-14NANCHANG UNIV +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511231167.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-30
Publication Date
2025-11-14

AI Technical Summary

Technical Problem

Existing CyHV-2 detection methods are complex to operate, time-consuming, costly, and unsuitable for rapid on-site detection.

Method used

A detection method based on the RPA-CRISPR-Cas12a system was adopted, using specific primers and crRNA, combined with fluorescence detection, to achieve rapid and simple detection through RPA amplification and CRISPR-Cas12a recognition.

Benefits of technology

The detection time is reduced to 1 hour, the sensitivity can reach 1.6 copies/μl, the accuracy is high, the cost is low, and it is suitable for grassroots laboratories and on-site testing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120945130A_ABST
    Figure CN120945130A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of molecular diagnosis, and particularly relates to a visual detection reagent for cyprinid type II herpesvirus based on an RPA-CRISPR-cas12a system and application of the visual detection reagent. By designing primers and screening corresponding crRNA, efficient amplification of RPA and high-specificity recognition of a CRISPR-Cas12a system are combined to realize detection of extremely low-content cyprinid type II herpesvirus nucleic acid, the detection limit can be as low as 1.6 copies / microliter, and compared with a traditional detection method, the detection method disclosed by the invention does not need expensive instruments and equipment and complex reagents, and has the advantages of simplicity, convenience, rapidness and convenience in operation, and can be widely applied to detection of cyprinid type II herpesvirus nucleic acid. The detection cost is reduced, and large-scale popularization and application are facilitated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular diagnostic technology, specifically relating to a visual detection reagent for cyprinid type II herpesvirus based on the RPA-CRISPR-cas12a system and its application. Background Technology

[0002] Cyprinid herpesvirus 2 (CyHV-2) is a highly pathogenic virus affecting cyprinid fish, causing severe disease and significant economic losses to aquaculture. Currently, detection methods for CyHV-2 mainly include traditional PCR, quantitative real-time PCR, and nucleic acid sequencing. However, these methods have limitations. Traditional PCR is complex, requiring specialized personnel and expensive equipment, and has a long detection time; while quantitative real-time PCR is highly sensitive, it has stringent experimental conditions, is susceptible to interference, and is costly; nucleic acid sequencing requires specialized sequencing equipment and complex data analysis processes, making it unsuitable for rapid on-site detection. Therefore, developing a rapid, sensitive, simple, and low-cost method for detecting CyHV-2 is of significant practical importance.

[0003] Recombinase polymerase amplification (RPA) is a novel isothermal nucleic acid amplification technology that can rapidly amplify nucleic acids at room temperature, offering advantages such as fast reaction speed and simple operation. The CRISPR-Cas12a system is a novel gene editing and nucleic acid detection technology with high specificity and sensitivity. CN202410458213.2 discloses a probe set and kit for rapid and visual detection of decapod iridovirus type I using recombinase polymerase isothermal amplification technology, demonstrating high specificity and sensitivity. CN202410268353.3 discloses a method using recombinase polymerase amplification combined with CRISPR-Cas12a technology, employing both RPA amplification and Cas12a recognition for dual-specific detection of turbot rhabdovirus. This method exhibits high specificity and sensitivity down to 8.7 copies / µl, significantly higher than conventional PCR, allowing detection of turbot rhabdovirus during the incubation period, thus enabling prevention and control of turbot rhabdovirus disease. However, specific detection methods for CyHV-2 are yet to be developed. Summary of the Invention

[0004] The purpose of this invention is to provide a visual detection reagent and application for cyprinid type II herpesvirus based on the RPA-CRISPR-cas12a system, in order to solve the problems of existing detection methods such as complex operation, long detection time, high cost, and unsuitability for rapid on-site detection.

[0005] In a first aspect, the present invention provides a reagent for detecting cyprinid herpesvirus type II, the reagent comprising primers and crRNA, the primers comprising an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer being selected from: 1F:5'-GGTGGCGGTTACTATTACAGACCTTCGCTGC-3' (SEQ ID NO:1) 2F:5'-GCATGTCTCAGGGTATCTCGCGGCTGTACAA-3' (SEQ ID NO:2) 3F:5'-GCATGTCTCAGGGTATCTCGCGGCTGTACAA-3' (SEQ ID NO:3) 4F:5'-ACTATTACAATTTCAAACACAACAAGGGCCA-3' (SEQ ID NO:4) Any one of them; The nucleotide sequence of the downstream primer is selected from: 1R:5'-TTTCATGCTGTCCACCTGCGCCTTTGAAGCC-3' (SEQ ID NO:5) 2R:5'-TTTCATGCCAAAGTCCATAGAGTCCATAAAG-3' (SEQ ID NO:6) 3R:5'-TCATGCCAAAGTCCATAGAGTCCATAAAGAG-3' (SEQ ID NO:7) 4R: 5'-CGATGTGGGGTTGGCTTCTGTGGATTTGATG-3' (SEQ ID NO: 8); Any one of them; The nucleotide sequence of the crRNA is selected from: crRNA1: UAAUUUCUACUAAGUGUAGAUGGCUCUAUGAUGGACGAGGCGGA (SEQ ID NO:9) crRNA2: UAAUUUCUACUAAGUGUAGAUGACAGCAUCAGCGUCCUCUUGGU (SEQ ID NO:10) crRNA3: UAAUUUCUACUAAGUGUAGAUAAACACAACAAGGGCCAAUUGGA (SEQ ID NO:11) crRNA4: UAAUUUCUACUAAGUGUAGAUGCAUGAAAUCCAUCCACCGACUC (SEQ ID NO:12) Any one of them.

[0006] In a preferred embodiment, the present invention discloses a reagent for detecting Cyprinid herpesvirus type II based on RPA and CRISPR-Cas12a, the reagent comprising primers and crRNA, wherein the nucleotide sequences of the primers and crRNA are shown below: RPA3-F:5'-GCATGTCTCAGGGTATCTCGCGGCTGTACAA-3' (SEQ ID NO:3) RPA3-R:5'-TCATGCCAAAGTCCATAGAGTCCATAAAGAG-3' (SEQ ID NO:7) crRNA3: UAAUUUCUACUAAGUGUAGAU AAACACAACAAGGGCCAAUUGGA (SEQ ID NO: 11).

[0007] In a second aspect, the present invention provides a probe for detecting cyprinid herpesvirus type II, wherein the probe is a single-stranded DNA with one end labeled with the fluorescent group FAM and the other end labeled with the fluorescent quencher group BHQ1. In a preferred embodiment, the nucleotide sequence of the single-stranded DNA is: 5'-FAM-TTTATTT-BHQ1-3' (SEQ ID NO:13)

[0008] A third aspect of the present invention provides a kit for detecting cyprinid herpesvirus type II, the kit comprising the primers and crRNA described in the first aspect of the present invention and the probe described in the second aspect of the present invention.

[0009] In a preferred embodiment, the present invention provides a kit for detecting cyprinid herpesvirus type II, the kit comprising primers and crRNA, wherein the nucleotide sequences of the primers and crRNA are as follows: RPA3-F:5'-GCATGTCTCAGGGTATCTCGCGGCTGTACAA-3' (SEQ ID NO:3) RPA3-R:5'-TCATGCCAAAGTCCATAGAGTCCATAAAGAG-3' (SEQ ID NO:7) crRNA3: UAAUUUCUACUAAGUGUAGAU AAACACAACAAGGGCCAAUUGGA (SEQ ID NO: 11).

[0010] In one embodiment, the kit further includes: Cas12a protein, cyprinid type II herpesvirus plasmid standard, reaction buffer, magnesium acetate solution, and negative control; In one embodiment, the reaction buffer comprises 10×HOLMES Buffer and RPA Buffer.

[0011] In a fourth aspect, the present invention provides the application of a cyprinid type II herpesvirus detection reagent / kit in the detection of cyprinid type II herpesvirus.

[0012] A fifth aspect of the present invention provides a method for visually detecting cyprinid herpesvirus type II, comprising the following steps: (1): Extract DNA from the sample to be tested; (2): Using the DNA obtained in step (1) as a template, the DNA is bound to a specific RPA primer pair for amplification reaction to obtain the amplification product; (3): The obtained amplification product is added to the CRISPR-Cas system for reaction; (4): Use a visual instrument to detect and observe the reaction product, and interpret the observation results. If a fluorescent signal can be detected when the reaction product is detected by a visual detection instrument, it indicates that the sample contains cyprinid type II herpesvirus. If no fluorescent signal is detected, it does not contain cyprinid type II herpesvirus. Beneficial effects

[0013] (1) The entire testing process can be completed within 1 hour, which greatly shortens the testing time and improves the testing efficiency, making it suitable for the needs of rapid on-site testing.

[0014] (2) Combining the high efficiency of RPA amplification and the high specificity of CRISPR-Cas12a system, it is possible to detect extremely low levels of cyprinid type II herpesvirus nucleic acid, with a detection limit as low as 1.6 copies / μl.

[0015] (3) By designing specific primers and crRNA, it is possible to accurately distinguish cyprinid type II herpesvirus from other related viruses, avoid cross-reaction, and improve the accuracy of detection.

[0016] (4) Compared with traditional detection methods, the detection method of the present invention does not require expensive instruments and complex reagents, which reduces the detection cost and is conducive to large-scale promotion and application. No complicated instruments and equipment are required; only a simple constant temperature device and fluorescence detection device are needed to complete the detection. The operation steps are simple and easy to master, making it suitable for use in grassroots laboratories and on-site testing. Attached Figure Description

[0017] Figure 1 This is a diagram showing the results of RPA primer amplification according to the present invention.

[0018] Figure 2 This is a graph showing the crRNA screening results of this invention.

[0019] Figure 3 This is a graph showing the optimization results of RPA reaction time based on the present invention.

[0020] Figure 4 This is a graph showing the optimization results of the RPA reaction temperature according to the present invention.

[0021] Figure 5 This is a graph showing the results of the optimization of crRNA concentration according to the present invention.

[0022] Figure 6-7 This is a graph showing the sensitivity detection results of the detection method of the present invention.

[0023] Figure 8-9 This is a diagram showing the specific detection results of the detection method of the present invention. Detailed Implementation

[0024] The present invention will be further described below with reference to specific embodiments.

[0025] Example 1 Sample Collection and Nucleic Acid Extraction

[0026] 1.1. Collection of suspected samples: Collect tissue samples, such as gills, liver, and spleen, from cyprinid fish suspected of being infected with Cyprinid herpesvirus type II.

[0027] 1.2 Extraction of total DNA from samples (based on TaKaRa kit, CAS No. 9002-93-10): (1) Place the tissue into a 2ml centrifuge tube and cut it into small pieces; (2) Add 180 μL Buffer GL, 20 μL Prok and 10 μL RNase A to centrifuge tubes respectively, and incubate in a water bath at 56℃ for 2-3 hours. During this period, the tubes can be removed and shaken or aspirated to accelerate lysis. (3) Centrifuge at 12000g for 3 minutes, and transfer the supernatant to a new centrifuge tube; (4) Add 200 μL Buffer GB and 200 μL anhydrous ethanol, and mix well by pipetting; (5) Transfer the solution to the adsorption column, centrifuge at 12000g for 2 min, and discard the waste liquid; (6) Add 500 μL Buffer WA, 12000 g, centrifuge for 1 min, and discard the waste liquid; (7) Add 500 μL Buffer WB, 12000 g, centrifuge for 1 min, and discard the waste liquid; (8) Repeat (7); (9) Transfer the adsorption column to the collection tube, centrifuge at 12000g for 2 min, and blow air for 2 min; (10) Place the collection tube into a new 1.5ml centrifuge tube, add 50μL of Elution Buffer, let stand for 5min, then centrifuge at 12000g for 2min to obtain total DNA.

[0028] 1.3 Construction of Standard Positive Plasmids: Using the obtained total DNA as a template, positive plasmids meeting the requirements were prepared using the designed upstream primer (GGCTTAAACAACGCGCAAGG) and downstream primer (GAATGAATGTATGATGCCCT). The plasmid concentration was measured using NanoDrop, and the copy number was calculated using the following formula:

[0029] Example 2: Establishment of RPA-Cas12a detection method

[0030] 2.1 Detection was performed using the RPA nucleic acid amplification kit.

[0031] RPA amplification system (50 μL): Prepare 29.5 μL of buffer, 2.4 μL each of forward and reverse primers (10 μmol / L), and 11.2 μL of enzyme-free water. Transfer the mixture to the basic reaction unit, ensuring the lyophilized powder in the basic reaction unit of the RPA nucleic acid amplification kit is fully reconstituted. Add 2.5 μL of 280 mM MgOAc to the inside of the reaction unit cap, then add 2 μL of DNA template. Centrifuge briefly and incubate at 39°C for 20 min. After RPA amplification, perform 5 μL of the amplification product on a 1% agarose gel electrophoresis to confirm the amplification results.

[0032] 2.2 CRISPR-Cas12a fluorescence detection system (20 μL): The reaction mixture consisted of: 2 μL of 10×HOLMES Buffer, 1 μL of Cas 12a protein (1 μmol / L), 1 μL of crRNA (1 μmol / L), 0.8 μL of ssDNA (10 μmol / L), 5 μL of RPA amplification product, and enzyme-free water to a final volume of 20 μL. The prepared reaction tube was briefly centrifuged to mix, placed in a real-time fluorescence quantitative PCR instrument, and reacted at 36℃ for 40 min. The fluorescence value was measured, and the amplification curve was observed.

[0033] Example 3: Screening of RPA primers and crRNA

[0034] 3.1 RPA Primer Screening

[0035] Four forward primers and four reverse primers were designed according to the RPA primer design standard. The primer sequences are shown in SEQ ID NO: 1-8. 1F:5'-GGTGGCGGTTACTATTACAGACCTTCGCTGC-3' (SEQ ID NO:1) 2F:5'-GCATGTCTCAGGGTATCTCGCGGCTGTACAA-3' (SEQ ID NO:2) 3F:5'-GCATGTCTCAGGGTATCTCGCGGCTGTACAA-3' (SEQ ID NO:3) 4F:5'-ACTATTACAATTTCAAACACAACAAGGGCCA-3' (SEQ ID NO:4) The nucleotide sequence of the downstream primer is selected from: 1R:5'-TTTCATGCTGTCCACCTGCGCCTTTGAAGCC-3'(SEQ ID NO:5) 2R:5'-TTTCATGCCAAAGTCCATAGAGTCCATAAAG-3'(SEQ ID NO:6) 3R:5'-TCATGCCAAAGTCCATAGAGTCCATAAAGAG-3'(SEQ ID NO:7) 4R:5'-CGATGTGGGGTTGGCTTCTGTGGATTTGATG-3' (SEQ ID NO:8) (2) Total DNA extracted from tissues was used as a template for RPA primer screening, where the length of F1 / R1 was 294 bp, the length of F2 / R2 was 287 bp, the length of F3 / R3 was 285 bp, and the length of F4 / R4 was 185 bp; (3) After the reaction, the RPA product was extracted with phenol:chloroform:isoamyl alcohol (25:24:1) extraction buffer, and the RPA amplification results were analyzed by 1% agarose gel electrophoresis. The results are as follows: Figure 1 As shown, the amplification product bands corresponding to the four primers F1 / R1, F2 / R2, F3 / R3, and F4 / R4 are all single and in the correct position.

[0036] 3.2 Screening of crRNA (1) All cyhv-II ORF72 sequences were downloaded from NCBI, and the constant region of cyhv-II ORF72 was analyzed by MEGA-X. Four crRNAs were designed according to the design requirements of crRNA, and four crRNAs (SEQ ID NO:9-12) were selected based on the results in 3.1; crRNA1: UAAUUUCUACUAAGUGUAGAUGGCUCUAUGAUGGACGAGGCGGA (SEQ ID NO:9) crRNA2: UAAUUUCUACUAAGUGUAGAUGACAGCAUCAGCGUCCUCUUGGU (SEQ ID NO:10) crRNA3: UAAUUUCUACUAAGUGUAGAUAAACACAACAAGGGCCAAUUGGA (SEQ ID NO:11) crRNA4: UAAUUUCUACUAAGUGUAGAUGCAUGAAAUCCAUCCACCGACUC (SEQ ID NO:12) (2) Add crRNA and the corresponding RPA primers to the corresponding CRISPR reaction systems respectively; (3) Record the fluorescence curve using a real-time fluorescence quantitative instrument, and analyze it after the reaction is complete. The results are as follows: Figure 2 As shown, the combination of F3 / R3 + crRNA3 exhibits the highest cleavage efficiency.

[0037] Example 4: Optimization of each reaction

[0038] 4.1 RPA reaction time optimization: Six different incubation times were set (5 min, 10 min, 15 min, 20 min, 25 min, and 30 min). After the reaction, the RPA products from different incubation times were extracted using a phenol:chloroform:isoamyl alcohol (25:24:1) extraction buffer, and then analyzed by 1% agarose gel electrophoresis. The reaction results are shown below. Figure 3 As shown, a band appeared at 15 min, so the reaction was optimized to a time of 15 min.

[0039] 4.2. Optimization of RPA reaction temperature: Six reaction temperatures were also set (36℃, 37℃, 38℃, 39℃, and 40℃). After the RPA reaction was completed at each temperature, the RPA product was extracted with phenol:chloroform:isoamyl alcohol (25:24:1) extraction buffer, and then analyzed by 1% agarose gel electrophoresis. The reaction results are shown below. Figure 4As shown, the reaction already produced bright bands at 36℃, so the reaction temperature of 36℃ was chosen as the result of temperature optimization.

[0040] 4.3. Optimization of crRNA concentration: Four reaction concentrations (25 nM, 59 nM, 75 nM, and 100 nM) were set up, and each concentration was simultaneously added to the CRISPR-Cas12a fluorescence detection system described in point 2.2 of Example 2. The reaction was carried out at 36°C for 40 min; the results are as follows. Figure 5 As shown.

[0041] Example 5 Sensitivity Detection

[0042] The positive plasmid of cyhv-II was serially diluted 10-fold. 4 10 3 10 2 10 1 10 0 10 -1 A total of 6 gradients were used, with enzyme-free water as a blank control, and the detection was performed using the method established in point 2 of Example 2. The results are as follows: Figure 6-7 As shown, except for the negative control, all virus-positive samples at each dilution were detected as positive, indicating that the detection sensitivity of the method of the present invention can reach 1.6 copies / μl.

[0043] Example 6 Specificity Experiment

[0044] Using the cyhv-II positive sample nucleic acid, GCRV-I, GCRV-II, SVCV, WSSV, and Saprolegnia nucleic acid extracted in Example 1 as templates, and enzyme-free water as a blank control, the method established in Example 2 was used for detection to verify the specificity of the detection method. The results are as follows: Figure 8-9 The method of the present invention shown can specifically detect that there is no interference between cyhv-Ⅱ and other templates.

[0045] The above description, in conjunction with specific embodiments, provides a further detailed explanation of the present invention. It should not be construed that the specific implementation of the present invention is limited to these descriptions. For those skilled in the art, several simple deductions or substitutions can be made without departing from the concept of the present invention, and all such deductions or substitutions should be considered to fall within the scope of protection defined by the claims submitted herein.

Claims

1. A reagent for detecting type II herpesvirus of cyprinids based on RPA and CRISPR-Cas12a, characterized in that, The reagents include primers and crRNA, wherein the nucleotide sequences of the primers and crRNA are shown below: RPA3-F:5'-GCATGTCTCAGGGTATCTCGCGGCTGTACAA-3' (SEQ ID NO:4) RPA3-R:5'-TCATGCCAAAGTCCATAGAGTCCATAAAGAG-3' (SEQ ID NO:8) crRNA3: UAAUUUCUACUAAGUGUAGAU AAACACAAGGGCCAAUGGA (SEQ ID NO:11)。 2. A fluorescent detection kit for detecting cyprinid herpesvirus type II based on RPA and CRISPR-Cas12a, characterized in that: The kit includes the primers and crRNA as described in claim 1, and also includes RPA Buffer, HOLMES Buffer, Cas12a protein, ssDNA fluorescence quenching probe, and magnesium acetate solution.

3. The reagent kit according to claim 2, characterized in that, The kit also includes a standard for cyprinid type II herpesvirus plasmid and a negative control.

4. The reagent kit according to claim 2, characterized in that, The ssDNA fluorescence quenching probe is a single-stranded DNA with one end labeled with the fluorescent group FAM and the other end labeled with the fluorescence quenching group BHQ1.

5. The reagent kit according to claim 3, characterized in that, The sequence of the ssDNA fluorescence quenching probe is as follows: 5'-FAM-TTTATTT-BHQ1-3' (SEQ ID NO:13).

6. The use of the reagent of claim 1 and the kit of claims 2-5 in the detection of cyprinid herpesvirus type II.

7. A method for visually detecting type II herpesvirus of the Cyprinidaceae family, comprising the following steps: (1) Extract DNA from the sample to be tested; (2) Using the DNA obtained in step (1) as a template, the DNA is bound to a specific RPA primer pair to carry out an amplification reaction to obtain the amplification product; (3) The obtained amplification product is added to the CRISPR-Cas system for reaction; (4) Use a visual instrument to detect and observe the reaction product, and interpret the observation results. If a fluorescent signal can be detected when the reaction product is detected by a visual detection instrument, it indicates that there is cyprinid type II herpesvirus in the sample to be tested. If no fluorescent signal is detected, it does not contain cyprinid type II herpesvirus.

Citation Information

Patent Citations

  • Kit and method for detecting paralichthys olivaceus rhabdovirus based on RPA CRISPR Cas12a system

    CN117925915A

  • Primer probe group for detecting type I tetrapod iridovirus and rapid visual detection kit

    CN118272582A