Beauveria bassiana TYW001 and application thereof

Abstract

The invention belongs to the technical field of biological control, and particularly relates to beauveria bassiana TYW001 and application thereof. The invention provides beauveria bassiana TYW001, the Latin name of the beauveria bassiana TYW001 is Beauveria bassiana, the beauveria bassiana TYW001 is preserved in China General Microbiological Culture Collection Center, the address is No.3, No.1 yard, Beichen West Road, Chaoyang District, Beijing, the preservation date is July 30, 2025, and the preservation number is CGMCC NO.42149. The strain not only can resist high temperature and drought, but also can resist high temperature and drought, but also can resist high temperature and drought, can resist high temperature and drought, can resist high temperature and drought, can resist high temperature and drought, can resist high temperature and drought, can resist high temperature and drought, can resist high temperature and drought, can resist high temperature and can resist high temperature the soybean megalurothrips can be effectively prevented and treated; moreover, the beauveria bassiana TYW001 can enhance the predation effect of the orius minutus on the megalurothrips megalurothrips, and a reliable green prevention and control technology is provided for prevention and control of the megalurothrips megalurothrips.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological control, and particularly relates to a Beauveria bassiana TYW001 and application thereof. BACKGROUND

[0002] The bean thrips is also known as common bean thrips and bean flower thrips, and is an important pest of legume crops. The bean thrips has a wide host range and can harm legume crops such as cowpea, lentil, red bean, green bean and peanut, and also harm crops and weeds such as potato, eggplant, radish, sunflower, sponge gourd, corn, mango and navel orange. The bean thrips has great harmfulness to cowpea in particular. The thrips hides in the flower, growth point, bean pod or leaf back of the plant, and sucks the sap and pollen of the plant. During the feeding process, the thrips stings and sucks the sap of the leaves, flowers or fruits of the host plant with a file-sucking mouthpart, and the harmed leaves are shriveled or deformed, the harmed growth points are withered and development is stopped, and the severely harmed growth points are necrotic and dry, resulting in the death of the plant; a large number of thrips harm the flowers, causing the surface of the flowers to be scalded and then rotted and dropped, thereby affecting the yield; after the bean pods grow, the thrips transfer to the bean pods in large numbers, causing the top and end surfaces of the bean pods to be suberized due to the file-sucking, resulting in the "black head" and "black tail" phenomenon, and seriously affecting the quality and commodity value of the cowpea.

[0003] Cowpea is one of the main vegetable varieties, and belongs to an indeterminate inflorescence, that is, the flowers and fruits are in the same period. The bean thrips is the most important pest of cowpea, and has fast reproduction and large quantity, leading to the frequent spraying of chemical pesticides by vegetable farmers, and causing the cowpea to be prone to pesticide overdose. In recent years, the special action of reducing pesticides and controlling pesticide residues for the health of cowpea and other agricultural products has been carried out, and the use of biological pesticides to control the bean thrips is vigorously advocated. Since the bean thrips likes to hide in flowers to cause harm, the thrips are difficult to be contacted by natural enemies and pesticides, and the thrips are more likely to contact and be infected by the spore powder of a pathogenic fungus. Therefore, the use of the pathogenic fungus is an important microorganism for effectively replacing chemical pesticides to control the bean thrips.

[0004] Since the bean thrips likes a high-temperature and dry environment, current insect pathogenic fungi are not resistant to high temperature and drought. Therefore, a strain resistant to high temperature and drought must be screened from a high-temperature and dry area, so as to effectively control the harm of the bean thrips.

[0005] Based on this, the present application is proposed. SUMMARY

[0006] In view of this, the present application aims to provide a strain, i.e., Beauveria bassiana TYW001, which can effectively control the bean thrips.

[0007] In order to achieve the above-mentioned application purposes, the present application provides the following technical solutions.

[0008] The application provides a Beauveria bassiana, which is named as Beauveria bassiana TYW001, is preserved in the China General Microbiological Culture Collection Center (CGMCC) located at No. 1, Xibaheyanli 3, Chaoyang District, Beijing, and has a preservation number of CGMCC NO.42149 and a preservation date of July 30, 2025.

[0009] The application also provides application of the Beauveria bassiana TYW001 in prevention and treatment of bean leafhoppers.

[0010] The application also provides a preparation for preventing and treating bean leafhoppers, which comprises the Beauveria bassiana TYW001.

[0011] Preferably, the concentration of the Beauveria bassiana TYW001 in the preparation is 1.0x10 5 ~ 1.0x10 7 / mL.

[0012] Preferably, the dosage form of the preparation comprises a suspension agent and a wettable powder.

[0013] The application also provides a method for preventing and treating bean leafhoppers, which comprises the step of spraying the preparation for preventing and treating bean leafhoppers in a field.

[0014] Preferably, the spraying amount of the preparation is 50-70 kg / acre.

[0015] Preferably, the concentration of the Beauveria bassiana TYW001 in the preparation is 1.0x10 5 ~ 1.0x10 7 / mL.

[0016] Preferably, the method further comprises the step of putting small flower beetles in the field.

[0017] Preferably, the putting amount of the small flower beetles is 800-1200 heads / acre.

[0018] Beneficial effects:

[0019] The application provides a Beauveria bassiana TYW001, which is screened from soil and insect bodies in a cowpea base in Yizhao Bay in Sanya, can resist high temperature and drought, and can effectively prevent and treat bean leafhoppers.

[0020] This invention prepares Beauveria bassiana TYW001 into a formulation that can effectively control bean thrips. Furthermore, Beauveria bassiana TYW001 can enhance the predation of small flower bugs on bean thrips, and the predation effect increases with increasing density. Therefore, the combined use of Beauveria bassiana TYW001 and small flower bugs provides a reliable green control technology for the prevention and control of bean thrips. Attached Figure Description

[0021] Figure 1 The indoor control efficacy of Beauveria bassiana TYW001 against adult bean thrips is shown in the figure. C1 in the figure represents a concentration of 1.0 × 10⁻⁶. 5 A formulation for controlling soybean thrips at concentrations of 1.0 × 10⁶ cells / mL, C2 being a concentration of 1.0 × 10⁶ cells / mL. 6 A formulation for controlling soybean thrips at concentrations of 1.0 × 10⁶ cells / mL, with C3 being a concentration of 1.0 × 10⁶ cells / mL. 7 A formulation for controlling soybean thrips (number per mL);

[0022] Figure 2 The figure shows the indoor control effect of strain X against adult soybean thrips. C1 in the figure represents a concentration of 1.0 × 10⁻⁶. 5 A formulation for controlling soybean thrips at concentrations of 1.0 × 10⁶ cells / mL, C2 being a concentration of 1.0 × 10⁶ cells / mL. 6 A formulation for controlling soybean thrips at concentrations of 1.0 × 10⁶ cells / mL, with C3 being a concentration of 1.0 × 10⁶ cells / mL. 7 A formulation for controlling soybean thrips (number per mL);

[0023] Figure 3 The indoor control effect of strain Y on adult soybean thrips is shown in the figure. C1 in the figure represents a concentration of 1.0 × 10⁻⁶. 5 A formulation for controlling soybean thrips at concentrations of 1.0 × 10⁶ cells / mL, C2 being a concentration of 1.0 × 10⁶ cells / mL. 6 A formulation for controlling soybean thrips at concentrations of 1.0 × 10⁶ cells / mL, with C3 being a concentration of 1.0 × 10⁶ cells / mL. 7 A formulation for controlling soybean thrips (number per mL);

[0024] Figure 4 The toxicity of Beauveria bassiana TYW001 to adult soybean thrips;

[0025] Figure 5 The control effect of Beauveria bassiana TYW001 on adult soybean thrips under different wavelengths of ultraviolet light was investigated.

[0026] Figure 6 The control effect of Beauveria bassiana TYW001 on adult soybean thrips at different temperatures;

[0027] Figure 7 The field control effect of Beauveria bassiana TYW001 on soybean thrips is shown in the figure. C1 in the figure represents a concentration of 1.0 × 10⁻⁶. 5A preparation for controlling bean leafhoppers, C2 is a preparation for controlling bean leafhoppers with a concentration of 1.0*10 6 A preparation for controlling bean leafhoppers, C3 is a preparation for controlling bean leafhoppers with a concentration of 1.0*10 7 A preparation for controlling bean leafhoppers, C3 is a preparation for controlling bean leafhoppers with a concentration of 1.0*10

[0028] Figure 8 The prevention and treatment effect of the small flower bug and Beauveria bassiana TYW001 on bean leafhoppers.

[0029] Preservation instruction

[0030] A kind of Beauveria bassiana TYW001, the Latin name of the Beauveria bassiana TYW001 is Beauveria bassiana, is preserved in China General Microbiological Culture Collection Center, address is Beijing City Chaoyang District Beichen West Road No. 1, preservation date is July 30, 2025, preservation number is: CGMCC NO.42149. Specific embodiments

[0031] The application provides a kind of Beauveria bassiana TYW001, the Latin name of the Beauveria bassiana TYW001 is Beauveria bassiana, is preserved in China General Microbiological Culture Collection Center, address is Beijing City Chaoyang District Beichen West Road No. 1, preservation date is July 30, 2025, preservation number is: CGMCC NO.42149.

[0032] The application also provides the application of the Beauveria bassiana TYW001 in controlling bean leafhoppers.

[0033] The application also provides a preparation for controlling bean leafhoppers, which comprises the Beauveria bassiana TYW001.

[0034] In the application, the concentration of the Beauveria bassiana TYW001 in the preparation is 1.0*10 5 ~1.0*10 7 / mL, preferably 1.0*10 6 / mL.

[0035] In the application, the dosage form of the preparation includes suspension and wettable powder.

[0036] The application also provides a method for controlling bean leafhoppers, comprising the following steps: spraying the preparation for controlling bean leafhoppers in a field.

[0037] In the present application, the spraying amount of the preparation is 50-70 kg / acre, preferably 55-65 kg / acre, and more preferably 60 kg / acre.

[0038] In the present application, the concentration of Beauveria bassiana TYW001 in the preparation is 1.0 x 10 5 -1.0 x 10 7 / mL, preferably 1.0 x 10 6 / mL.

[0039] In the present application, the method further comprises the step of releasing Orius similis in the field.

[0040] In the present application, the releasing amount of the Orius similis is 800-1200 heads / acre, preferably 900-1100 heads / acre, and more preferably 1000 heads / acre.

[0041] The technical solutions provided by the present application will be described in detail below in conjunction with the examples, but they should not be understood as limiting the scope of protection of the present application.

[0042] In the examples and experimental examples of the present application, the thrips test insects were collected from the cowpea test field of the Haikou Plant Protection Station in Hainan Province and identified as Megalurothrips usitatus. The insects were bred in the laboratory for several generations to obtain consistent adult insects for indoor biological test experiments. The test insects were bred on kidney beans in candy jars (2 L). Five layers of paper towels and three layers of filter paper were used to pad the bottom of the candy jar. Two kidney beans were placed in each jar, and the jars were sealed with paper towels and gauze and fastened with rubber bands. The kidney beans were soaked and washed with dishwashing liquid before use, and then rinsed with distilled water to remove the residual dishwashing liquid. After drying, they were ready for use. Every other day, the kidney beans in the adult insect jars were removed and replaced with two new kidney beans. The removed kidney beans were placed in another new candy jar to allow the eggs to hatch. The test insect breeding conditions were as follows: temperature 26°C, humidity 75%, and light L:D = 16:8.

[0043] Example 1

[0044] The strain was isolated and purified from the soil of the cowpea field in Yizhao Bay, Sanya, using the large wax moth attraction method and active screening technology. The specific steps are as follows:

[0045] (1) Utilize the sensitivity of large wax moth larvae to insect pathogenic fungi, allowing the fungi to infect the large wax moth and cause its death: First, place the large wax moth larvae in the soil in a warm and humid environment. The larvae will be infected by the insect pathogenic fungi, which will invade the body through the body surface. The fungi will reproduce and release toxins in the larvae, eventually causing their death. Place the dead large wax moth larvae in PDA medium for culture. After the mycelium grows, isolate the cells to obtain pure spores, which are then expanded to obtain Beauveria bassiana conidium powder.

[0046] (2) the conidia of Beauveria bassiana are inoculated into the thrips, the thrips infected and killed by the Beauveria bassiana are placed on PDA medium (potato 200 g, glucose 20 g, agar 15 g, distilled water 1000 mL) and cultured in a mold incubator at 27°C; after 3 days of culture, a spore suspension of the Beauveria bassiana is prepared with sterile water, shaken well, and a drop of the spore suspension is taken for microscopic examination; under a 10x objective, the concentration of the spore solution is adjusted to 10 spores per field of view; 200 μL of the solution is taken and uniformly applied to a 2.0% water agar plate, which is placed in a mold incubator at 27°C and cultured for 8 hours; after the spores germinate, a single spore is picked up with a pick needle to obtain the purified Beauveria bassiana; the purified Beauveria bassiana is subjected to molecular biology identification, and the purified Beauveria bassiana is finally identified as Beauveria bassiana TYW001, and the gene sequence is shown as SEQ ID No. 1; the purified Beauveria bassiana is placed in a mold incubator at 27°C and cultured for 15 days for thrips inoculation.

[0047] wherein SEQ ID No. 1 is: TTTCCTTCCAGCTTTGATATGCTTAAGTTCAGCGGGTAGTCCTACCTGATTCGAGGTCAACGTTCAGAAGTTGGGTGTTTTACGGCGTGGCCGCGTCGGGGTTCCGGTGCGAGCTGTATTACTGCGCAGAGGTCGCCGCGGACGGGCCGCCACTCCATTTCAGGGCCGGCGGTGTGCTGCCGGTCCCCAACGCCGACCCCCCCAAGGGGAGGTCGAGGGTTGAAATGACGCTCGAACAGGCATGCCCGCCAGAATGCTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGGATTCTGCAATTCACATTACTTATCGCGTTTCGCTGCGTTCTTCATCGATGCCAGAGCCAAGAGATCCGTTGTTGAAAGTTTTGATTCATTTGTTTTGCCTTGCGGCGTATTCAGAAGATGCTGGAATACAAGAGTTTGAGGTCCCCGGCGGGCCGCTGGTCCAGTCCGCGTCCGGGCTGGGGCGAGTCCGCCGAAGCAACGATAGGTAGGTTCACAGAAGGGTTAGGGAGTTGAAAACTCGGTAATGATCCCTCCGCAGGCCCCCCCCTTACGGAA.

[0048] Example 2 A preparation for preventing and treating thrips

[0049] Take the 15-day-old Beauveria bassiana PDA plate in Example 1, bend a sterile 200 mL syringe tip, and gently scrape 1 / 4 of the plate with the bent syringe tip to place the spore powder in a 50 mL centrifuge tube containing 5 mL of 0.1% Tween-80; vortex the liquid in the centrifuge tube to make it uniform, then use a 1 mL syringe to suck the liquid into a 1 mL syringe with glass wool to filter out the mycelium and medium fragments so that only fungal spores are left in the liquid, obtaining a spore suspension; if spore blockage is found during the process, the glass wool should be replaced in time;

[0050] Place a cover glass on the counting chamber of a clean and dry hemocytometer, shake the spore suspension well, use a pipette to suck an appropriate amount of spore suspension, and drop it on the edge of the cover glass. The spore suspension will slowly infiltrate on its own to prevent air bubbles. Use a blotting paper to absorb the excess spore suspension outside the cover glass. Let it stand for 5 minutes, then place the hemocytometer under an optical microscope and count under a 40x lens. According to the calculation formula of the hemocytometer, the concentration of the spore suspension is obtained, and it is quantitatively diluted with 0.1% Tween-80 to a concentration of 1.0 x 10 7 spores / mL, i.e. a preparation for controlling Aulacothorax pasadenae with a concentration of 1.0 x 10 7 spores / mL is obtained.

[0051] Then use the 1.0 x 10 7 spores / mL spore suspension to prepare a 1.0 x 10 6 spores / mL and a 1.0 x 10 5 spores / mL Beauveria bassiana spore suspension, i.e. a preparation for controlling Aulacothorax pasadenae with a concentration of 1.0 x 10 6 spores / mL and 1.0 x 10 5 spores / mL is obtained.

[0052] The calculation formula of the hemocytometer is:

[0053]

[0054] N is the total number of spores in 80 small squares in the formula.

[0055] Experimental Example 1: Indoor biological test

[0056] The thrips adults were quickly poured into different concentrations of Beauveria bassiana spore suspension, soaked for 15s, poured on filter paper, the water was absorbed, then the live insects were picked into 9cm culture dishes with agar and bean leaves by a small brush, avoiding mechanical damage, sealed with sealing film to prevent the test insects from crawling out of the culture dish (the lid of the culture dish was pre-made with a hole about 5cm in diameter, and the hole was sealed with a paper towel for ventilation); 30 thrips were placed in one culture dish as one treatment, with 4 replicates for each treatment; the thrips inoculated with Beauveria bassiana were placed in a clean culture box under the same conditions for feeding; the thrips adults were placed in another clean culture box under the same conditions for feeding as the control group. Continuous observation was made for 10 days, the number of dead insects was recorded at regular time every day, and the dead insects were picked out in time to observe and microscopically examine the dead insects in a culture dish with moist filter paper, and whether they were infected with Beauveria bassiana was recorded;

[0057] The results of the control effect of the bean thrips are shown in Figures 1-3 ;

[0058] The results show that the TYW001 strain has good lethal effect on the adults of the bean thrips, and can be used as a strain for field test.

[0059] Example 2: Analysis of in vitro virulence and pathogenicity of effective strains

[0060] The cumulative corrected mortality rate was calculated by Abbott's formula, with the inoculation time (days) or the logarithmic value of the spore suspension concentration (1.0x10 7 2 The virulence regression equation (y=0.4091x+2.8525, R 7 =0.9405) was obtained by probability value analysis method using excel, and the median lethal concentration LC50 and the median lethal time LT50 were calculated to analyze the virulence of the strain; Tukey's multiple comparison method was used in SPSS17.0 for significant difference analysis;

[0061] The Abbott formula is:

[0062]

[0063] When the probability value y=5, the time x=5.25, i.e. the median lethal time of Beauveria bassiana TYW001 on the adults of the bean thrips is 5.25 days at a concentration of 10 7 Figure 4 .

[0064] Example 3: Determination of UV resistance and high temperature resistance

[0065] 1000 μL of TYW001 liquid culture was taken in a sterile 1.5 mL centrifuge tube, the mycelium was filtered, and spore suspension was prepared using 0.05% Tween 80. After mixing, it was poured onto PDA medium at a height of 0.35 m, and irradiated with two wavelengths of ultraviolet light (360 nm and 253.7 nm) for 30 min and 60 min, respectively. After treatment, the spores were washed with 0.05% Tween 80. The concentration of all spore suspensions was adjusted to 10 7 spores / mL, and after treatment, they were stored in a -80°C refrigerator for use in bioassay (Reference Example 1). The Beauveria bassiana purchased from Taobao was used as a control CK, and the results are shown in Figure 5

[0066] 1000 μL of TYW001 liquid culture was taken in a sterile 1.5 mL centrifuge tube, the mycelium was filtered, and spore suspension was prepared using 0.05% Tween 80. The centrifuge tube was placed in a water bath, and incubated at different temperatures (30°C, 40°C, 45°C) for 4 h, 8 h, and 12 h, respectively. Untreated spore suspension was used as a control. The concentration of all spore suspensions was adjusted to 10 7 spores / mL, and after treatment, they were stored in a -80°C refrigerator for use in bioassay (Reference Example 1). The Beauveria bassiana purchased from Taobao was used as a control CK, and the results are shown in Figure 6

[0067] The results showed that the high temperature resistance and ultraviolet resistance of TYW001 strain were significantly higher than those of the control strain. Even after 1 h of 360 nm treatment, the insecticidal effect of TYW001 strain could still reach about 80%, which was about twice that of the control strain. After 12 h of high temperature treatment at 40°C, the insecticidal effect of TYW001 could still reach about 80%, which was twice that of the control strain. Therefore, the TYW001 strain had significant stress resistance.

[0068] Experimental Example 4 Field Experiment

[0069] Five treatments were set up in the test: water negative control, 1.0 x 10 5 spores / mL of the preparation for controlling C. maculatus, 1.0 x 10 6 spores / mL of the preparation for controlling C. maculatus, 1.0 x 10 7 spores / mL of the preparation for controlling C. maculatus, and 1000-fold dilution of Aigulais, each treatment was repeated 3 times, a total of 15 plots. A 7 m long cowpea row was set as one plot, and each plot was randomly arranged in groups. Back-mounted electric sprayers were used to spray according to the above-mentioned order of the five treatments, the amount of liquid was 60 kg / acre; the application was completed before 10 o'clock in the morning.

[0070] ​​The number of thrips adult insect pests of 10 flowers on the cowpea plants of 5 m in the middle part was randomly investigated once before the application and at 3 d, 5 d, 7 d, 9 d and 11 d after the application in the morning; the insect pest reduction rate was calculated by using excel, and the correction control effect was carried out; the Tukey multiple comparison method was used in SPSS 17.0, and the results are shown in Table 1. Figure 7

[0071] The calculation formula of the insect pest reduction rate is as follows:

[0072]

[0073] The results show that the Beauveria prevention and control effect on cowpea thrips is obvious, and from the whole, the high-concentration Beauveria spore liquid is more stable in the prevention and control of cowpea thrips, has a fast killing speed and a longer drug effect period; the 10 7 thrips thrips can be treated by using the 10 7 thrips thrips can be treated by using the 10 Figure 7 .

[0074] Example 5

[0075] The thrips nymphs inoculated with the Beauveria were put into a culture dish, and then the small flower bug adult was put in, and the predation behavior of the small flower bug was observed; the results show that the predation effect of the small flower bug on the infected thrips nymphs is significantly enhanced, so the Beauveria bassiana TYW001 can enhance the predation effect of the small flower bug on the cowpea thrips, and the predation effect is enhanced with the increase of the density, as shown in Table 3. Figure 8

[0076] It can be known from the above examples that the present application provides the Beauveria bassiana TYW001 and the application thereof, the strain can not only resist high temperature and drought, but also effectively prevent and control the cowpea thrips; and the Beauveria bassiana TYW001 can enhance the predation effect of the small flower bug on the cowpea thrips, and provides a reliable green prevention and control technology for the prevention and control of the cowpea thrips.

[0077] The above only describes the preferred embodiments of the present application, and it should be noted that some improvements and refinements can be made by those skilled in the art without departing from the principles of the present application, and these improvements and refinements should also be regarded as the protection scope of the present application.​​

Claims

1. A Beauveria bassiana TYW001 strain, characterized in that, The Latin name of the *Beauveria bassiana* TYW001 is *Beauveria bassiana*, which is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is July 30, 2025, and the accession number is CGMCC NO.42149.

2. The application of Beauveria bassiana TYW001 as described in claim 1 in the control of soybean thrips.

3. A preparation for controlling soybean thrips, characterized in that, The formulation comprises Beauveria bassiana TYW001 as described in claim 1.

4. The formulation according to claim 3, characterized in that, The concentration of Beauveria bassiana TYW001 in the formulation is 1.0 × 10⁻⁶. 5 ~1.0×10 7 per mL.

5. The formulation according to claim 4, characterized in that, The dosage forms of the formulation include suspensions and wettable powders.

6. A method for controlling bean thrips, characterized in that, The method includes the following steps: spraying the preparation for controlling soybean thrips according to any one of claims 3 to 5 onto the field.

7. The method according to claim 6, characterized in that, The application rate of the formulation is 50-70 kg / mu.

8. The method according to claim 7, characterized in that, In the formulation, the concentration of Beauveria bassiana TYW001 is 1.0 × 10⁻⁶. 5 ~1.0×10 7 per mL.

9. The method according to claim 8, characterized in that, The method also includes the step of releasing small flower bugs into the field.

10. The method according to claim 9, characterized in that, The release rate of the small flower bugs is 800-1200 per mu.

Images