Gossypium barbadense verticillium wilt-resistant SNP molecular marker and application thereof

Abstract

The invention discloses a sea island cotton SNP (Single Nucleotide Polymorphism) molecular marker and application thereof, and relates to the technical field of cotton molecular breeding, and the key points of the technical scheme are as follows: the SNP molecular marker is GbMA03G0171SNP; the nucleotide sequence of the GbMA03G0171SNP molecular marker is as shown in SEQ ID No.1, the polymorphic site of the GbMA03G0171SNP molecular marker is located at the 2195th site of the sequence as shown in SEQ ID No.1, and the polymorphism of the GbMA03G0171SNP molecular marker is A / T.

Description

Technical Field

[0001] This invention relates to the field of molecular breeding technology, and more specifically, to a molecular marker for resistance to Verticillium wilt in island cotton and its application. Background Technology

[0002] Verticillium wilt is a soil-borne vascular fungal disease of plants. Due to its wide distribution, difficulty in eradication after infection, strong pathogenicity, long survival time of sclerotia, and wide host range, it is often referred to as the "cancer" of cotton. The wilt pathogen belongs to the Deuteromycetes, with significant differences in pathogenicity among strains. It is mainly caused by *Verticillium dahliae* and *Verticillium chrysogenum*, and has a wide host range, making it difficult to control.

[0003] Research on Verticillium wilt-resistant cotton is not only crucial for the stable development of the cotton industry, but also closely related to national food security, ecological environmental protection, technological progress, and the improvement of farmers' living standards. Traditional methods of Verticillium wilt control mainly rely on pesticides, which are not only costly but also cause environmental pollution. The cultivation and promotion of Verticillium wilt-resistant cotton can effectively control the occurrence of the disease, increase cotton yield and quality, reduce disease control costs, ensure national cotton supply, and meet the demand for cotton raw materials for national economic development. Verticillium wilt has become one of the key factors restricting the steady development of my country's cotton industry; therefore, identifying key resistance genes, analyzing resistance mechanisms, and cultivating disease-resistant varieties are urgent problems to be solved.

[0004] Verticillium wilt in cotton is one of the targets of cotton disease resistance breeding. The application of molecular marker technology provides an efficient and precise technical means for rapid screening of resistance genes and variety improvement. Traditional cotton Verticillium wilt breeding relies on phenotypic identification, which requires waiting for cotton to grow to a specific growth stage and inoculating with the pathogen before observing the disease manifestation. This method is also easily affected by environmental interference and is inefficient. In contrast, molecular marker-assisted selection (MAS) rapidly and accurately identifies disease-resistant genotypes at the seedling stage or early generations by screening for molecular markers closely linked to disease resistance traits, thus avoiding environmental influences and shortening the breeding cycle. Summary of the Invention

[0005] To address the shortcomings of existing technologies, the present invention aims to provide a SNP molecular marker for sea island cotton, wherein the SNP molecular marker is GbM_A03G0171SNP; the nucleotide sequence of the GbM_A03G0171SNP molecular marker is shown in SEQ ID.1, and the polymorphic site is located at position 2195 of the sequence shown in SEQ ID.1, with a polymorphism of A / T.

[0006] Furthermore, the application of the SNP molecular markers in detecting SNP marker polymorphisms or genotypes in the genome of sea island cotton in identifying or assisting in the identification of resistance to Verticillium wilt in sea island cotton also falls within the scope of protection of this invention.

[0007] Furthermore, the substance used to detect SNP marker polymorphisms or genotypes in the genome of sea island cotton includes:

[0008] 1) Primers used to amplify DNA fragments containing the SNP marker;

[0009] 2) PCR reagents containing 1);

[0010] 3) Kits containing 1) or 2).

[0011] Furthermore, the primer sequences are as shown in SEQ ID.2-4.

[0012] A product, wherein the product is any of the substances described above for detecting SNP marker polymorphisms or genotypes in the genome of *Cotton Island*, the product comprising at least one of the following functions:

[0013] (1) To identify or assist in the identification of resistance of island cotton to Verticillium wilt;

[0014] (2) Breeding of island cotton resistant to Verticillium wilt;

[0015] (3) Compare the resistance of island cotton to Verticillium wilt;

[0016] (4) Select and breed island cotton that is resistant to Verticillium wilt.

[0017] A method for identifying or assisting in the identification of resistance to Verticillium wilt in sea island cotton, the method comprising: detecting the polymorphism or genotype of the above-mentioned SNP markers in the genome of the sea island cotton to be tested, and determining the resistance of the cotton to Verticillium wilt based on the polymorphism or genotype.

[0018] A method for breeding sea island cotton, the method comprising: detecting the polymorphism or genotype of the above-mentioned SNP markers in the genome of the sea island cotton to be tested; selecting cotton with the SNP locus of type AA in the genome of the sea island cotton to be tested as a parent; and selecting cotton with the SNP locus of type AA in the genome in each generation of breeding.

[0019] Furthermore, in the above breeding method, the method for detecting SNP marker polymorphisms or genotypes in the genome of the sea island cotton to be tested includes:

[0020] A: The polymorphism or genotype of the above SNP markers in the genome of sea island cotton was detected by sequencing;

[0021] B: Use the substances described above for detecting SNP marker polymorphism or genotype to perform PCR on the genomic DNA of the sea island cotton to be tested, and then perform genotyping on the products.

[0022] This invention also provides an application of the GbM_A03G0171 gene in the cultivation of plants resistant to Verticillium wilt. By silencing or overexpressing the GbM_A03G0171 gene, plants resistant to Verticillium wilt can be obtained.

[0023] In summary, the present invention has the following beneficial effects: The present invention develops a molecular marker and gene that can closely correlate with the trait index of resistance to Verticillium wilt in island cotton breeding materials, which can help shorten the breeding cycle. Secondly, it can be detected throughout the entire life cycle of the plant and is not affected by the external environment. It can not only effectively detect the locus gene of the target trait and accurately analyze the genetic composition of individual plants in the population, but also shorten the time for constructing linkage genetic maps of new populations. This is conducive to the purposeful selection and utilization of superior materials, thereby achieving the aggregation of excellent agronomic traits in the same material. Attached Figure Description

[0024] Figure 1 This is a CDS sequence alignment diagram of the SNP site polymorphism of the GbM_A03G0171 gene of the present invention;

[0025] Figure 2 This is a diagram showing the protein sequence alignment results at the SNP marker of the GbM_A03G0171 gene in this invention;

[0026] Figure 3 This is a box plot showing the significant differences in the stalk disease index of SNP sites in sea island cotton resource materials according to the present invention;

[0027] Figure 4 This is a gel image of PCR amplification typing of SNP molecular markers for identifying sea island cotton resource materials according to the present invention;

[0028] Figure 5 This invention is a box plot showing the significant differences in SNP locus typing and pedicle finger differentiation.

[0029] Figure 6 This is the result of the functional verification of the GbM_A03G0171 gene in this invention. A: Disease development 21 days after infection with *Verticillium wilt*, the causal agent of *Arabidopsis thaliana*; Mock is the blank control; V991 is *Arabidopsis thaliana* inoculated with *Dalbergia odorifera*; Col is wild-type *Arabidopsis thaliana*; OE2 is the GbM_A03G0171 gene overexpression line; B: Comparison of expression levels before and after inoculation between wild-type and GbM_A03G0171 overexpression lines; C: TRV::GhPDS albino phenotype; D: qRT-PCR detection of GbM_A03G0171 expression levels in TRV::00 (control plant) and TRV::GbM_A03G0171 (gene-silenced plant); E: TRV::00 phenotype; F: TRV::GbM_A03G0171 phenotype. Detailed Implementation

[0030] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0031] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0032] Example 1: Localization of Verticillium wilt resistance gene and determination of SNP sites in sea island cotton

[0033] 213 F-type cotton varieties derived from PimaS-7 and 5917 5:6 The RIL population and 353 domestic and international sea island cotton varieties (lines) served as experimental materials. All of the aforementioned sea island cotton germplasm resources were collected, preserved, and provided by the Xinjiang Key Laboratory of Crop Biotechnology Breeding, College of Agriculture, Xinjiang Agricultural University.

[0034] This invention clones the interacting gene GbM_A03G0171 obtained through yeast single-hybrid screening, and its nucleotide sequence is shown in SEQ ID.1. Sequence alignment revealed a gene polymorphism at positions 2098534-2103866 on chromosome A03 in the P90_HEBAU sea island cotton database. The SNP molecular marker is located at the physical location GbM_A03G0171 in the genome, at base position 2195 of the gene sequence, with a polymorphism of A / T. This SNP site is named GbM_A03G0171SNP.

[0035] 1.1 Primer design for detecting GbM_A03G0171SNP

[0036] The cds sequence of the GbM_A03G0171 gene was extracted using Cotton FGD. SNP primers were designed at the target site using Primer 3 with the following design parameters: primer annealing temperature of 49℃ and amplification length of 600bp. GbM_A03G0171SNP-F1: GCTGGAGTAATAACTGTCAGGAAAT (SEQ ID.2);

[0037] GbM_A03G0171SNP-F2: GCTGGAGTAATAACTGTCAGGAAAA (SEQ ID.3);

[0038] GbM_A03G0171SNP-R:ACACGCCAAAATGCAAAGCT (SEQ ID.4).

[0039] The primers described above include two upstream primers and one downstream primer. The upstream primer GbM_A03G0171SNP-F1 is used to amplify the case where the nucleotide at physical position A03:2195 of *Cotton Island Nephrolepis extinction* is T, and the upstream primer GbM_A03G0171SNP-F2 is used to amplify the case where the nucleotide at physical position D11:A03:2195 of *Cotton Island Nephrolepis extinction* is A. The downstream primer GbM_A03G0171SNP-R is a universal primer.

[0040] Example 2: SNP molecular marker primer validation and population validation

[0041] 2.1 Verification Method

[0042] 2.11 DNA Extraction: DNA was extracted from 213 F cells using the CTAB method. 5:6 Genomic DNA was extracted from the young leaves of RIL populations and 353 domestic and foreign island cotton resource varieties.

[0043] 2.12 PCR amplification: Genomic DNA from the same material was amplified using primers for GbM_A03G0171SNP.

[0044] 2.13 The PCR products were detected by 1% agarose gel electrophoresis.

[0045] The DNA extraction method in step 2.11 is as follows:

[0046] (1) First, heat the DNA lysis buffer (containing 3% β-mercaptoethanol, Table 1) to 65°C in a water bath.

[0047] (2) Fresh cotton leaves were placed in a 2ml centrifuge tube containing small steel balls. The collected samples were quickly frozen in liquid nitrogen and then crushed into powder using a tissue grinder.

[0048] (3) Add 800 μl of lysis buffer to the centrifuge tube containing the sample, mix thoroughly, and then heat in a water bath at 65°C for 1 hour. Take out the centrifuge tube every 10 minutes and mix thoroughly to allow for complete lysis reaction.

[0049] (4) After water bath, add 800 μl of chloroform:isoamyl alcohol (V / V, 24:1) mixture to the centrifuge tube for extraction. Invert the centrifuge tube to mix for 10 min to form an emulsion. Place it in a refrigerated centrifuge at a preset temperature of 4℃ and centrifuge at 12000 rpm / min for 10 min.

[0050] (5) Take 600 μL of supernatant and add 0.6 times the volume of isopropanol (pre-cooled at -20℃), let stand at 4℃ for 30 min, mix thoroughly until white flocculent DNA precipitates from the tube wall, and centrifuge at 12000 rpm / min for 10 min.

[0051] (6) Discard the supernatant and keep the white DNA flakes at the bottom of the centrifuge tube. Add 300 μL of 75% alcohol (pre-cooled at -20°C). Use a pipette to repeatedly blow and wash the flakes. After removing the 75% alcohol, add the same volume of anhydrous ethanol to wash once more. Open the centrifuge tube and air dry the residual alcohol in a clean bench.

[0052] (7) Add 200ul of sterile ddH2O and shake to dissolve the DNA. Use a UV-Micro Spectrophotometer (Nano Drop2000) to detect the concentration and quality of the extracted genomic DNA. The OD260 / 280 ratio is between 1.8 and 2.2, and there is no protein or visible impurity contamination.

[0053] (8) Dilute the DNA stock solution to 200 ng / ul as a working solution for subsequent use.

[0054] Table 1 Composition of DNA lysis buffer

[0055]

[0056] The PCR amplification system and amplification program for step 2.12 are shown in Tables 2 and 3:

[0057] Table 2 PCR amplification system

[0058]

[0059] Table 3 PCR amplification program

[0060]

[0061] 2.2 Validation of SNP molecular markers for Verticillium wilt

[0062] Based on whole-genome sequencing results, 53 accessions with the AA genotype and 153 accessions with the TT genotype were screened from 566 Sea Island cotton materials (Table 5). A significant difference analysis was performed on the disease index of the AA and TT genotypes. Figure 3 It was found that the TT genotype makes plants more susceptible to Verticillium wilt.

[0063] The method for identifying the disease index of stalk cutting in the field of island cotton materials is as follows: In the late stage of cotton boll opening, stalk cuttings were performed on 15cm above the ground from 10 consecutive plants selected from 213 F5:6RIL populations and 353 domestic and foreign island cotton resource varieties. The stalks were graded using a 5-level system, and the disease index was calculated.

[0064] Statistical analysis method: Calculate the incidence rate and disease index based on the survey data.

[0065] Incidence rate = Number of infected plants / Total number of plants;

[0066] Disease index = ∑(number of diseased plants × representative value) / (total number of plants × representative value of the most severe disease level) × 100%.

[0067] Table 4 Disease Index Grading Standards

[0068]

[0069] Table 5 SNP locus typing index

[0070]

[0071]

[0072]

[0073] The DNA of the 566 Sea Island cotton materials (i.e., 213 F5:6RIL populations and 353 domestic and foreign Sea Island cotton resource varieties) was directly amplified using SNP primers. Then, the 566 Sea Island cotton resource materials were verified by 1% agarose gel electrophoresis. A total of 18 AA genotypes and 37 TT genotypes were screened out. The agarose gel electrophoresis results were compared with the whole genome sequencing data, and the results were consistent, indicating that the SNP locus GbM_A03G0171SNP of the present invention can screen or identify Sea Island cotton materials resistant to Verticillium wilt with high accuracy.

[0074] Example 3: Functional Verification of the GbM_A03G0171 Gene

[0075] Arabidopsis thaliana were transformed with GbM_A03G0171 gene overexpression, and the overexpressing Arabidopsis thaliana were selected to the T2 generation. Simultaneously, wild-type Arabidopsis thaliana and the T2 generation GbM_A03G0171 gene-overexpressing Arabidopsis thaliana were inoculated with Verticillium wilt (…). Figure 6 Overexpression of the GbM_A03G0171 gene, compared to the wild type, reduced the resistance of Arabidopsis thaliana to Verticillium wilt. At 21 days, the number of diseased leaves in transgenic Arabidopsis was significantly higher than that in the wild type. qPCR results showed that the expression level of the GbM_A03G0171 gene decreased in both wild-type and transgenic Arabidopsis after inoculation. Figure 6 -B).

[0076] Furthermore, this invention uses VIGS technology to investigate the role of the GbM_A03G0171 gene in the resistance response to Verticillium wilt in island cotton. This gene was silenced in the island cotton variety DC146, and when the albinism phenotype appeared (…). Figure 6-C), the gene silencing efficiency of TRV::00 and TRV::GbM_A03G0171 plants was analyzed using qPCR technology. The results showed that GbM_A03G0171 was successfully silenced ( Figure 6 -D). When plants were inoculated with Verticillium dahliae strain V991, cotton plants with TRV:00 showed more severe leaf wilting and yellowing than those with TRV:GbM_A03G0171 on day 25 post-inoculation.

[0077] Verticillium wilt is a major disease affecting mature cotton plants in island cotton, severely impacting yield and reducing fiber quality. Due to the complex genetic patterns of Verticillium wilt and the lack of standardized identification methods, traditional breeding practices have been slow. Therefore, identifying key resistance gene loci in cotton and cultivating resistant varieties is crucial for controlling Verticillium wilt. This invention utilizes a low-cost, high-throughput SNP genotyping system based on conventional PCR-gel electrophoresis. By designing specific primers, it achieves rapid and accurate detection of SNP loci related to Verticillium wilt resistance in island cotton, providing core parents for disease-resistant breeding. The SNP molecular markers of this invention can help shorten the breeding cycle. Furthermore, they can be detected throughout the plant's lifespan and are unaffected by external environmental factors. This not only effectively detects the target trait's gene loci and accurately analyzes the genetic composition of individual plants in a population but also shortens the time required to construct linkage genetic maps for new populations. This facilitates the targeted selection and utilization of superior materials, thereby achieving the aggregation of excellent agronomic traits within the same material.

[0078] This specific embodiment is merely an explanation of the present invention and is not intended to limit the invention. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but such modifications are protected by patent law as long as they are within the scope of the claims of the present invention.

Claims

1. A SNP molecular marker for sea island cotton, characterized in that, The SNP molecular marker is GbM_A03G0171SNP; the nucleotide sequence of the GbM_A03G0171SNP molecular marker is shown in SEQ ID.1, and the polymorphic site is located at position 2195 of the sequence shown in SEQ ID.1, with a polymorphism of A / T.

2. An application of SNP molecular markers in sea island cotton, characterized in that, The application of the SNP molecular markers described in claim 1 in detecting SNP marker polymorphisms or genotypes in the genome of sea island cotton in identifying or assisting in the identification of resistance to Verticillium wilt in sea island cotton.

3. The application according to claim 2, characterized in that, The substance includes: 1) Primers used to amplify DNA fragments containing the SNP marker; 2) PCR reagents containing 1); 3) Kits containing 1) or 2).

4. The application according to claim 3, characterized in that, The primer sequences are shown in SEQ ID.2-4 in sequence.

5. A product characterized in that, The product is the substance described in any one of claims 1-4 for detecting SNP marker polymorphisms or genotypes in the genome of cotton sea island, and the product includes at least one of the following functions: (1) To identify or assist in the identification of resistance of island cotton to Verticillium wilt; (2) Breeding of island cotton resistant to Verticillium wilt; (3) Compare the resistance of island cotton to Verticillium wilt; (4) Select and breed island cotton that is resistant to Verticillium wilt.

6. A method for identifying or assisting in the identification of the resistance of sea island cotton to Verticillium wilt, characterized in that, The method includes: detecting the polymorphism or genotype of the above-mentioned SNP markers in the genome of the cotton to be tested, and determining the resistance of the cotton to Verticillium wilt based on the polymorphism or genotype.

7. A method for breeding island cotton, characterized in that, The method includes: detecting the polymorphism or genotype of any of the SNP markers described in claims 1-5 in the genome of the cotton to be tested, selecting cotton with the SNP site of type AA in the genome of the cotton to be tested as the parent, and selecting cotton with the SNP site of type AA in the genome in each generation of breeding.

8. The method according to claim 7, characterized in that, The methods for detecting SNP marker polymorphisms or genotypes in the genome of the sea island cotton to be tested include: A: The polymorphism or genotype of the above SNP markers in the genome of sea island cotton was detected by sequencing; B: Use the substances described above for detecting SNP marker polymorphism or genotype to perform PCR on the genomic DNA of the sea island cotton to be tested, and then perform genotyping on the products.

9. The application of a GbM_A03G0171 gene in the breeding of plants resistant to Verticillium wilt, characterized in that, By silencing or overexpressing the GbM_A03G0171 gene, plants resistant to Verticillium wilt were obtained.

Images