Functional molecular marker of wheat powdery mildew resistance related gene Pm61 and application of functional molecular marker

Abstract

The invention discloses a functional molecular marker of a wheat powdery mildew resistance related gene Pm61 and application of the functional molecular marker. The invention belongs to the field of nucleic acid determination and detection, and particularly relates to a functional molecular marker of a wheat powdery mildew resistance related gene Pm61 and application of the functional molecular marker. The invention provides an application of a Pm61 gene InDel molecular marker or a substance for detecting the molecular marker, wherein the InDel molecular marker is a double-stranded DNA (deoxyribonucleic acid) molecule of 19-123 sites of which the nucleotide sequence of one chain is SEQ ID No: 1; the InDel molecular marker can be applied to any one of the following applications: 1) application in identification or auxiliary identification of wheat powdery mildew resistance; and 2) application in wheat breeding.

Description

Technical Field

[0001] This invention belongs to the field of nucleic acid detection and assay, specifically involving the functional molecular marker of wheat powdery mildew-related gene Pm61 and its application. Background Technology

[0002] wheat( Triticum aestivum Powdery mildew is one of the world's three major staple foods, providing basic nutrition for more than 35% of the population. Powdery mildew is caused by the specialized fungal pathogen *Erysiphe flavescens* (a member of the Poaceae family). Blumeria graminis f. sp. tritici abbreviation Bgt Powdery mildew is one of the major diseases threatening global wheat production. It causes significant yield losses by inhibiting the photosynthetic efficiency of the host wheat, reducing tillering and ear formation rates, and decreasing thousand-grain weight. Current strategies for controlling powdery mildew rely heavily on chemical agents, but these pose risks of environmental pollution and pathogen resistance. Therefore, developing wheat varieties with durable, broad-spectrum resistance has become a core solution that combines economic viability with ecological sustainability.

[0003] Through thousands of years of domestication and natural selection, my country's local wheat varieties have accumulated rich genetic diversity, serving as an important resource for the discovery of disease-resistant genes. Of the wheat resources currently existing in the National Crop Germplasm Bank, one-third (13,000 accessions) are local varieties. Historically, local wheat varieties have played a significant role in both production and breeding. Local wheat varieties contain abundant powdery mildew resistance genes; currently identified powdery mildew resistance genes include... Pm2c , Pm3b , Pm5d , Pm5e , Pm24a , Pm24b , Pm45 , Pm47 , Pm59 , Pm61 and Pm63 Furthermore, local varieties have high hybridization compatibility with conventional wheat varieties, outstanding resistance to adverse conditions (such as drought and salt tolerance), and great potential for improving agronomic traits, making them strategic genetic resources for disease-resistant breeding.

[0004] Pm61 Derived from the local wheat variety Xuxu Sanyuehuang, it exhibits stable and high resistance to powdery mildew in both the seedling and mature stages. Sun et al. (2018) used SSR (EST-SSR) marker technology to... Pm61 Located on the long arm of chromosome 4A (4AL) Xicsx79 and Xgwm160A 0.46 cM genetic interval exists between markers. Hu et al. (2019) further localized it to a 31 Mb physical interval at the end of 4AL using BSR-Seq combined with SNP / KASP markers, and developed a [missing information - likely a gene or assay]. Xicsk8 / Xicsx497 and Xicsk13 / Xicsx538 High-density labeling with a density of 0.71 cM. However, existing molecular markers and... Pm61 The large genetic distance between genes still makes molecular marker-assisted selection (MAS) breeding time-consuming, labor-intensive, and inefficient. The high cost of gene marker amplification makes it difficult to meet the demands for precision and high-throughput operations in breeding practices. Therefore, developing molecular marker-assisted selection (MAS) based on... Pm61 Codominant molecular markers for functional sites have become a key technological bottleneck in improving the efficiency of disease-resistant breeding. Summary of the Invention

[0005] The problem to be solved by this invention is how to identify or assist in the identification of wheat powdery mildew resistance.

[0006] To address the above technical problems, this invention provides the application of InDel molecular markers or substances for detecting InDel molecular markers, and verifies the practicality of the markers, providing reliable molecular markers for identifying or assisting in the breeding of wheat varieties.

[0007] This invention first provides the application of InDel molecular markers or substances for detecting InDel molecular markers, wherein the InDel molecular marker is a double-stranded DNA molecule with a single-stranded nucleotide sequence of positions 19-123 of SEQ ID No:1; the application is any of the following: 1) Application in identifying or assisting in the identification of wheat powdery mildew resistance; 2) Application in wheat breeding.

[0008] The nucleotide sequence of the other strand of the InDel molecular marker is reverse complementary to positions 19-123 of SEQ ID No:1.

[0009] The above SEQ ID No:1 consists of 1210 nucleotides.

[0010] In the above applications, the substance used to detect the InDel molecular marker may contain PCR primers for amplifying wheat genomic DNA fragments containing the wheat InDel molecular marker.

[0011] In the above application, the PCR primer is a primer pair, the primer pair consists of a forward primer and a reverse primer, the forward primer is a single-stranded DNA that specifically binds to the upstream of the InDel molecular marker in the wheat genomic DNA, and the reverse primer is a single-stranded DNA that specifically binds to the downstream of the InDel molecular marker in the wheat genomic DNA.

[0012] Further, the sequence of the forward primer is shown in SEQ ID No: 2, and the sequence of the reverse primer is shown in SEQ ID No: 3.

[0013] Herein, the wheat is a wheat inbred line or a wheat variety (line).

[0014] The present application also provides a method for identifying or assisting in identifying the resistance of wheat powdery mildew, comprising the following steps: detecting whether the InDel molecular marker described above is contained in the genomic DNA of the wheat to be identified, and the resistance of the wheat to be identified containing the InDel molecular marker in the genomic DNA is greater than or candidate greater than the wheat to be identified not containing the InDel molecular marker in the genomic DNA.

[0015] The method for identifying or assisting in identifying the resistance of wheat powdery mildew can specifically comprise the following steps: (1) Using the genomic DNA of the wheat material to be identified as a template, PCR amplification is carried out using the primer pair to obtain a PCR product; (2) Identifying the resistance of wheat powdery mildew according to whether the PCR product contains the InDel molecular marker.

[0016] The resistance of the wheat to be identified containing the InDel molecular marker in the PCR product to powdery mildew is greater than or candidate greater than the wheat to be identified not containing the InDel molecular marker in the PCR product.

[0017] If the size of the DNA fragment of about 1000 bp in the PCR product in the wheat material to be identified is 1210 bp, the nucleotide sequence of the DNA fragment is SEQ ID No: 5 in the sequence listing, and the nucleotide sequence is the 19-123th DNA fragment of SEQ ID No: 1 in the sequence listing; the genotype of the wheat variety (line) containing the nucleotide sequence of the 19-123th DNA fragment of SEQ ID No: 1 in the sequence listing in the PCR product is defined as the insertion type (abbreviation for allelic variation Pm61DM -AA genotype or AA genotype).

[0018] If no PCR amplification product or no band of about 1200 bp is identified in the wheat material, the DNA fragment of SEQ ID No: 1 at 19-123 is not contained in the strain, and the genotype of the wheat variety (line) whose PCR product does not contain the DNA fragment of SEQ ID No: 1 at 19-123 in the sequence listing is defined as a deletion type (referred to as allelic variation Pm61DM -BB genotype or BB genotype).

[0019] Further, the PCR system is: genomic DNA (25 ng / μL) of the wheat leaf to be tested 2 μL, 2× PCR Mix 5 μL, water solution of primer F (concentration of 10 μmol / L) 1 μL, water solution of primer R (concentration of 10 μmol / L) 1 μL and ddH2O 1 μL.

[0020] PCR amplification procedure: 94℃ 5 min; 94℃ 30 s, 57℃ 30 s, 72℃ 30 s, 35 cycles; 72℃ 7 min.

[0021] The InDel molecular marker described in the foregoing also belongs to the protection scope of the present application.

[0022] The InDel molecular marker is a double-stranded DNA molecule with the nucleotide sequence of SEQ ID No: 1 at 19-123.

[0023] The InDel molecular marker is named Pm61DM .

[0024] The present application also provides a method for wheat breeding.

[0025] The method for wheat breeding provided by the present application comprises selecting a wheat containing the InDel molecular marker described in the foregoing as a parent for breeding.

[0026] The InDel molecular marker is a double-stranded DNA molecule with the nucleotide sequence of SEQ ID No: 1 at 19-123.

[0027] In the present application, the breeding purpose includes cultivating a wheat variety with wheat powdery mildew resistance. BRIEF DESCRIPTION OF DRAWINGS

[0028] Figure 1 Different RIL families are resistant to powdery mildew E09.

[0029] Figure 2 Molecular marker Pm61DM Polymorphism detection in RIL population.

[0030] Figure 3 Sequence comparison of Pm61 gene among 4 varieties (A) and molecular markers Pm61DM Detection map of 10+ genes in common wheat (B).

[0031] Figure 4 Molecular markers Pm61DM Partial detection results of 262 Chinese micro-core germplasm wheat. DETAILED DESCRIPTION

[0032] The application will be further described in conjunction with the specific embodiments. The examples given are only for the purpose of illustrating the application, but not for limiting the scope of the application. The examples provided below can be used as a guide for further improvement by those skilled in the art, and do not in any way constitute a limitation on the application.

[0033] In the following examples, the experimental methods are conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained commercially, unless otherwise specified.

[0034] In the following examples, the quantitative tests are performed in triplicate, and the results are averaged, unless otherwise specified.

[0035] In the following examples, the wheat seedling powdery mildew resistance identification method is specifically referred to the following literature: Liu ZY, Sun QX, Ni ZF, Yang TM. Development of SCAR markers linked to the gene conferring resistance to powdery mildew in common wheat. Plant Breeding, 1999, 118: 215-219. The biological material can be obtained from the applicant, and is only used for repeating the experiments of the application, and cannot be used for other purposes. Pm21

[0036] ​The materials Jagger, CDC Stanley, CDC Landmark, Norin 61, Julius, ArinaLrFor, SY Mattis, LongReach Lancer, Mace, spelta PI190962, Claire, Cadenza, Paragon, Robius, and Weebill_1 in the following examples are described in: Walkowiak, S., Gao, L., Monat, C. et al. Multiple wheat genomes reveal global variation in modern breeding. Nature 588, 2020, 277–283; Jimai 22 is described in: Jiao C, Xie X, Hao C, et al. Pan-genomebridges wheat structural variations with habitat and breeding[J]. Nature, 2025, 637(8045): 384-393; 262 hexaploid Chinese wheat microcore germplasm accessions were provided by Researcher Zhang Xueyong of the Institute of Crop Science, Chinese Academy of Agricultural Sciences, and are described in: Dong YC, Cao YS, Zhang XY, Liu SC, Wang LF, You GX, Pang BS, Li LH, Jia JZ. Establishment of candidate core collections in Chinese common wheat germplasm. Journal of Plant Genetic Resources, 2003, 4(1):1-8. and Li Hongjie, Wang Xiaoming, Song Fengjing, Wu Cuiping, Wu Xiaofei, Zhang Ning, Zhou Yang, Zhang Xueyong. Resistance response of Chinese wheat varieties to powdery mildew and detection of resistance genes. Acta Agronomica Sinica, 2011, 37(6):943-954. The biological material is available to the public from the applicant and is intended solely for the purpose of replicating the experiments of this invention and may not be used for any other purpose.

[0037] The specific steps for identifying the phenotypic characteristics of wheat powdery mildew are as follows: Wheat seeds were sown in 5×5 cm seedling trays, with 10-15 seeds per tray, and cultured in an artificial climate chamber under 20ºC light for 16 hours and 18ºC darkness for 8 hours, with relative humidity controlled at 60%-80%. When the seedlings grew to one leaf and one bud, they were inoculated with powdery mildew using the sweeping method.

[0038] The grading standards for wheat powdery mildew are as follows: 0: immunity, no disease spot on whole plant, no mycelium attachment.

[0039] 0: necrotic reaction, leaf with dead spot.

[0040] 1: high resistance, small disease spot, thin mycelium layer, green leaf surface, occasionally large disease spot but still green, little sporulation.

[0041] 2: medium resistance, small disease spot, thick mycelium layer but weak three-dimensionality, not green, some sporulation.

[0042] 3: medium susceptibility, many disease spots, thick mycelium layer, strong three-dimensionality, leaf chlorosis, much sporulation but not continuous disease spot.

[0043] 4: high susceptibility, many disease spots, thick mycelium layer, much sporulation, continuous disease spot.

[0044] Disease degree 0-2 is resistant, 3-4 is susceptible.

[0045] The resistant parent Xuxusanyuehuang and the susceptible parent Zhongzu 9504, and the powdery mildew physiological race E09 used in the following examples have been described in Sun HG, et al. Pm61 : a recessive gene for resistance to powdery mildew in wheat landrace Xuxusanyuehuang identified by comparative genomics analysis. Theoretical and Applied Genetics, 2018, 131: 2085-2097. The biological material is available from the applicant, which is only used for repeating the experiments of the present application and cannot be used for other purposes.

[0046] Example 1, Wheat Pm61 Development of genetic molecular markers and polymorphism detection I. Pm61 Gene and Pm61CS Nucleotide sequence alignment of genes Amplified from Xuxusanyuehuang Pm61 Gene, Pm61CS gene (nucleotide sequence is Genbank: 123088537, updated date 2025-7-2) was amplified from Zhongguo Chun. The Pm61 gene of Xuxusanyuehuang was aligned with the Pm61CS gene of Zhongguo Chun. Pm61 Gene and Pm61CS Alignment of genes found that Pm61 Gene and Pm61CSThe coding region of the gene has a 105 bp base difference, and the difference sequence is as follows: 5'-GGTTACTTGATGGTTCATATTTTGAGAATTTGGGATCTTTAAGCTTTAATAATTGCAGCGCATTACAAAGCCTACCGTCCAATAGTAAGCTATTTGAGAATTGCT- 3' (SEQ ID No: 4), and the specific sequence is nucleotide sequence 19-123 of SEQ ID No: 1. The genome of Xuxusanzhuyuan (a wheat variety resistant to powdery mildew) contains the sequence of 19-123 of SEQ ID No: 1 (referred to as InDel insertion type), and the sequence of 744,383,058-744,383,059 of the 4A chromosome genome of Zhongchun (a wheat variety susceptible to powdery mildew) does not contain the sequence of 19-123 of SEQ ID No: 1 (referred to as InDel deletion type). The InDel molecular marker is named Pm61DM. Pm61DM .

[0047] II. Development of specific identification primers for molecular marker Pm61DM According to the upstream and downstream sequences of the InDel molecular marker Pm61DM (referred to as molecular marker Pm61DM ), a specific primer set is designed, and the primer set information is as follows: Pm61DM-F: 5'-AGCTATTTGAGAATTGCTGGTT-3' (SEQ ID No: 2); Pm61DM-R: 5'-CTGCCTTCAAGAGTCAAAGATT-3' (SEQ ID No: 3).

[0048] III. Polymorphism detection Wheat to be tested: Xuxusanzhuyuan, Zhongzu 9504, and a recombinant inbred line (RIL) population formed by crossing the two.

[0049] Construction of hybrid population: the powdery mildew susceptible variety Zhongzu 9504 was used as the male parent, and the female parent local variety Xuxusanzhuyuan was used as the female parent to carry out hybridization, and the hybrid F1 generation was obtained. The hybrid F1 generation seeds were sown in the field, and through self-crossing for 6 generations, 352 F6 recombinant inbred lines (RILs) were obtained. The RIL population was planted, and the resistance of the population to powdery mildew was detected.

[0050] The specific steps of polymorphism detection are as follows: 1. The plant DNA rapid extraction kit was used to extract the genomic DNA of the wheat leaves to be tested.

[0051] 2. Using the genomic DNA of the wheat leaves as the template, the primer pair composed of the primer F and the primer R in step two was used for PCRPm61DM Perform PCR amplification to obtain PCR amplification products.

[0052] PCR reaction system (10 μL): 2 μL of genomic DNA (25 ng / μL) from wheat leaves to be tested, 5 μL of 2× PCR Mix (Nanjing Novizan Biotechnology Co., Ltd.), 1 μL of aqueous solution of primer F (concentration of 10 μmol / L), 1 μL of aqueous solution of primer R (concentration of 10 μmol / L), and 1 μL of ddH2O.

[0053] PCR reaction conditions: 94℃ for 5 min; 94℃ for 30 s, 58℃ for 15 s, 72℃ for 45 s, 35 cycles; 72℃ for 7 min.

[0054] 3. Take the PCR amplification product obtained in step 2, perform 1.0% agarose gel electrophoresis, and sequence the PCR amplification product.

[0055] Based on the PCR product results, the following judgments can be made: 1) If the amplified product contains DNA fragments of approximately 1200 bp, all of which are 1210 bp in size, the nucleotide sequence of this DNA fragment is SEQ ID No:1 in the sequence listing; the genotype of wheat varieties (lines) whose PCR products contain DNA fragments with the nucleotide sequence of SEQ ID No:1 from positions 19 to 123 in the sequence listing is defined as the disease resistance type AA (abbreviated as allelic variation). Pm61DM - AA genotype or AA genotype, which is the same as the amplification result of the disease-resistant parent, *Xuxu Sanyuehuang*). 2) If the amplification product does not show bands or bands of other sizes, that is, the PCR product does not contain the DNA fragment whose nucleotide sequence is the DNA fragment at positions 19-123 of SEQ ID No:1 in the sequence listing, then the genotype of the wheat being tested is defined as susceptible type BB (abbreviated as allelic variation). Pm61DM -BB genotype or BB genotype, the same as the 9504 amplification result in the susceptible parent).

[0056] Some experimental results are shown in Table 1 and Figure 1 , Figure 2 The yellow must be harvested in March. Pm61DM The genotype is AA, while the genotype of Zhongzuo 9504 is BB. The RIL population has two genotypes: one is genotype AA (which is the same as the genotype of *Hypericum simonii* and its powdery mildew resistance, i.e.) Figure 1 moderately resistant single plants and Figure 2 One type is the family with banded pedigrees; the other is the BB genotype (which has the same genotype as Zhongzuo 9504 and the same resistance to powdery mildew, i.e.) Figure 1 Infected single plants and Figure 2 (A family lineage without bands).

[0057] Table 1, Disease resistance phenotypes and Pm61DM genotypes of Xuxusanliu, Zhongzu 9504 and partial recombinant inbred lines

[0058]

[0059]

[0060] Note: Disease severity classification in Table 1 refers to Shaanxi Provincial Standard DB61 / T 1014-2016 “Technical Specification for Wheat Variety Resistance to Powdery Mildew”, wherein 1+0; belongs to high resistance reaction type, i.e. when recording the grade number of leaf blades inoculated with powdery mildew at the seedling stage, the reaction type is 1 grade and there is a part of hypersensitive necrosis reaction.

[0061] Table 2, Pm61DM Genotype and powdery mildew resistance statistical analysis results of

[0062]

[0063] The above results show that the molecular marker Pm61DM developed in this study can identify the genotype of wheat. The molecular marker Pm61DM can effectively distinguish the resistance of wheat to powdery mildew (Table 2).

[0064] Example 2, Application of molecular marker Pm61DM 1. Using the published wheat genome material to detect Pm61 Pm61DM gene, only Chinese Spring, Jagger, CDCStanley, CDC Landmark materials contain Pm61CS haplotype (see Figure 3 A), and the rest of the wheat varieties Fielder, Jimai 22, Norin 61, Julius, ArinaLrFor, SY Mattis, LongReach Lancer, Mace, spelta PI190962, Claire, Cadenza, Paragon, Robigus, Weebill_1 do not contain Pm61 gene and Pm61CS gene.

[0065] Pm61DM detection results are as follows: Figure 3 ​B, RP is Xuxu San Yue Huang, SP is Zhongzu 9504, the order of 1-19 is Zhonghua Chun, Jagger, CDC Stanley, CDC Landmark, Fielder, Jimai 22, Norin 61, Julius, ArinaLrFor, SY Mattis, LongReach Lancer, Mace, spelta PI190962, Claire, Cadenza, Paragon, Robigus, Weebill_1, blank control. It is indicated that this marker Pm61DM Pm61, Pm61CS and other haplotypes can be efficiently identified.

[0066] 2, using functional markers Pm61DM 262 Chinese wheat micro-core germplasm were detected.

[0067] According to the detection method in Example 1, the 262 hexaploid Chinese wheat micro-core germplasm were genotyped. The experimental results are shown in Figure 4 and the 2nd and 5th columns in Table 2.

[0068] The 262 wheat powdery mildew resistance data come from Qiu Y C, Li J J, Rong Z X, et al. Identification and analysis of Chinese wheat micro-core germplasm resistance to rust and powdery mildew [J]. Chinese Journal of Wheat and Maize, 2015, 35(02): 268-273. Among the 262, 15 were resistant at seedling stage, and the remaining 147 were fully susceptible.

[0069] Table 2 shows that the genotypes of the 262 hexaploid Chinese wheat micro-core germplasm are Pm61DM-BB. Pm61 resistance gene type has not been detected in Chinese micro-core germplasm, and it is speculated that the powdery mildew resistance gene Pm61 is a rare disease type. Figure 4 The gel map of the first 46 materials in Table 2 is for Pm61DM.

[0070] Table 3, detection of Pm61DM gene type of 262 Chinese wheat micro-core germplasm

[0071]

[0072]

[0073]

[0074]

[0075]

[0076]

[0077] The application has been described in detail. Those skilled in the art will understand that they can make modifications and alterations to this application without departing from the spirit and scope of the application. Although this application presents specific examples, it is to be understood that further modifications can be made. In general, the application is intended to cover any adaptations or variations of the present application including modifications based on the disclosure in the patent application in its broadest form.

Claims

1. Use of a Pm61 gene InDel molecular marker or a substance for detecting the molecular marker, characterized in that, The InDel molecular marker is a double-stranded DNA molecule with the nucleotide sequence of SEQ ID No: 1 at 19-123 of one strand; the application is any of the following: 1) application in identifying or assisting in identifying wheat powdery mildew resistance; 2) application in wheat breeding.

2. Use according to claim 1, characterized in that, The substance contains PCR primers for amplifying a fragment of wheat genomic DNA containing the InDel molecular marker.

3. Use according to claim 2, characterized in that, The PCR primers are a primer pair, which consists of a forward primer and a reverse primer, the forward primer is a single-stranded DNA that specifically binds to the upstream of the InDel molecular marker in wheat genomic DNA, and the reverse primer is a single-stranded DNA that specifically binds to the downstream of the InDel molecular marker in wheat genomic DNA.

4. Use according to claim 3, characterized in that, The sequence of the forward primer is shown in SEQ ID No: 2, and the sequence of the reverse primer is shown in SEQ ID No:

3.

5. Use according to any one of claims 1 to 4, characterized in that, The wheat is a wheat inbred line or variety.

6. A method of identifying or assisting in the identification of resistance to powdery mildew in wheat, characterised in that, The method comprises the following steps: detecting whether the InDel molecular marker in claim 1 is contained in the genomic DNA of the wheat to be identified, the powdery mildew resistance of the wheat to be identified containing the InDel molecular marker in the genomic DNA is greater than or candidate greater than that of the wheat to be identified not containing the InDel molecular marker in the genomic DNA.

7. A method of identifying or assisting in the identification of resistance to powdery mildew in wheat, characterised in that, The method comprises the following steps: (1) using the genomic DNA of the wheat to be identified as a template, performing PCR amplification using the primer pair in claim 3 or 4 to obtain a PCR product; (2) identifying the powdery mildew resistance of the wheat according to whether the PCR product contains the InDel molecular marker in claim 1; The powdery mildew resistance of the wheat to be identified containing the InDel molecular marker in claim 1 in the PCR product is greater than or candidate greater than that of the wheat to be identified not containing the InDel molecular marker in claim 1 in the PCR product.

8. The InDel molecular marker in claim 1.

9. A method for wheat breeding, the method comprising selecting wheat containing the InDel molecular marker in claim 1 in the genomic DNA of the wheat as a parent for breeding.

Images