Canine distemper virus RT-RAA CRISPR / Cas 12b detection kit and detection method thereof

Abstract

The invention belongs to the field of canine distemper virus detection, and particularly relates to a canine distemper virus RT-RAA CRISPR / Cas 12b detection kit and a detection method thereof. According to the kit, isothermal amplification is performed by using an RT-RAA universal primer, and then detection is performed by using a CRISPR / Cas 12b detection system consisting of target sequence sgRNA, so that amplification of a target fragment of the N gene of the canine distemper virus and target detection visualization can be effectively realized. The result of the embodiment shows that the RT-RAA CRISPR / Cas 12b detection kit finally designed by the invention is high in specificity and does not have cross reaction with other viruses, the lowest visual detection limit reaches 4.77 * 10 < 1 > copies / mu L, the virus can be instantly detected when the RT-RAA CRISPR / Cas 12b detection kit is used for detecting the CDV, the labor and equipment cost is low, the period is short, and the detection time does not exceed 2 hours. The rapid detection technology can be popularized and applied to epidemiological investigation and epidemic situation monitoring of the canine distemper virus, is suitable for epidemic disease monitoring of wild animals, quarantine of zoos and on-site rapid detection of clinical samples of canines, and has good practical significance and wide market prospects.

Description

Technical Field

[0001] This invention belongs to the technical field of canine distemper virus detection, specifically relating to a canine distemper virus RT-RAA CRISPR / Cas 12b detection kit and its detection method. Background Technology

[0002] Canine distemper virus (CDV) can cause acute systemic disease, characterized by high infectivity and mortality, posing a serious threat to the health and safety of its host. CDV infection can lead to respiratory, digestive, and neurological symptoms in animals. Furthermore, CDV infection can cause a sharp decline in lymphocyte count and induce long-term immunosuppression, creating conditions for secondary infections by other pathogens. Animals infected with CDV who exhibit characteristic symptoms often have a poor prognosis. Therefore, early screening is necessary for timely diagnosis and early treatment.

[0003] Polymerase chain reaction (PCR) is a commonly used technique for pathogen detection. However, its multi-step and expensive process limits its application and large-scale use in specialized laboratories. Although PCR-based methods are now well-established and robust, they are not suitable for inexperienced personnel. Furthermore, antigen-antibody binding immunoassay methods also have drawbacks, such as the tendency for false negatives to occur if detection is performed too early.

[0004] "CDetection" is a novel CRISPR / Cas system developed by the Chinese Academy of Sciences. It is a rapid DNA detection system integrating Cas 12b protein, guide RNA (sgRNA), trans-cleavage reporter molecule (single-stranded DNA, ssDNA) fluorescent reporter molecule, and recombinase polymerase amplification (RPA). After the Cas 12b protein targets and cleaves the RPA-amplified target DNA, it activates ssDNA cleavage activity, randomly cleaving the ssDNA fluorescent reporter molecule, thereby emitting a fluorescent signal and achieving chemiluminescent visualization detection.

[0005] RT-RAA is an isothermal nucleic acid amplification technique that synchronizes the reverse transcription and amplification processes. This technique uses sample RNA as a template and reacts under isothermal conditions, which can amplify a large amount of product from a small amount of starting RNA template in a short time.

[0006] The combination of RT-RAA and CRISPR / Cas 12b can form a series of simple, rapid, sensitive, and visualized detection methods. No special precision instruments are required; only the target sequence needs to be amplified, followed by CRISPR nucleic acid detection. This detection method eliminates the need for complex temperature cycling, is easy to operate, and boasts advantages such as high sensitivity, high specificity, short reaction time, and high amplification efficiency.

[0007] Currently, there are no reports of using RT-RAACRISPR / Cas 12b for detection in the field of CDV detection technology. Summary of the Invention

[0008] The purpose of this invention is to provide a canine distemper virus RT-RAA CRISPR / Cas 12b detection kit and its detection method. This invention is the first to use the RT-RAA CRISPR / Cas 12b detection kit to detect canine distemper virus, which can not only effectively realize the amplification of the target fragment of the N gene of canine distemper virus and visualize the target detection, but also has high specificity and high sensitivity.

[0009] To achieve the above objectives, the present invention provides the following technical solution:

[0010] This invention provides a primer set for the detection of canine distemper virus RT-RAA CRISPR / Cas 12b, the primer set comprising an upstream primer as shown in SEQ ID NO.3 and a downstream primer as shown in SEQ ID NO.4.

[0011] The present invention also provides a reverse transcription isothermal amplification system, wherein the reverse transcription isothermal amplification system comprises the primer set described above.

[0012] The present invention also provides a kit for detecting canine distemper virus RT-RAACRISPR / Cas 12b, the kit comprising the above-mentioned reverse transcription isothermal amplification system and CRISPR / Cas 12b detection system.

[0013] Preferably, the CRISPR / Cas 12b detection system includes sgRNA targeting the N gene of canine distemper virus, VB-type Cas 12b protein, trans-cleavage reporter molecule, RT-RAA product, buffer, and nuclease-free water.

[0014] More preferably, the sgRNA targets the canine distemper virus N gene; the sequence of the sgRNA is shown in SEQ ID NO.6 of the nucleotide sequence listing, wherein the underlined portion in SEQ ID NO.6 is the sequence of its target; the target fragment of the canine distemper virus N gene is shown in SEQ ID NO.9, which is highly conserved and contains the sequence targeted by the sgRNA, which is the underlined portion in SEQ ID NO.9.

[0015] More preferably, the trans-cleaved reporter molecule is shown in SEQ ID NO.7, wherein the 5' end of the trans-cleaved reporter molecule is labeled with the fluorescent group 6-FAM and the 3' end is labeled with the quencher group BHQ-1.

[0016] More preferably, the final concentration of the VB-type Cas 12b protein and sgRNA is 125nM-250nM, and the final concentration of the trans-cleavage reporter molecule is 800nM-1.5μM.

[0017] The present invention also provides a method for detecting canine distemper virus, comprising using the above-mentioned kit to extract RNA from the sample to be tested, performing reverse transcription and isothermal amplification to obtain amplification products; and finally performing CRISPR / Cas 12b detection on the amplification products.

[0018] Preferably, the amplification conditions for the reverse transcription isothermal amplification are: 42℃ for 30 min; and the detection conditions for the CRISPR / Cas12b detection are: 52-60℃ for 30 min.

[0019] The present invention also provides the application of the above-mentioned primer set, kit, or method in the epidemiological investigation or epidemic monitoring of canine distemper virus.

[0020] The beneficial effects of this invention are:

[0021] The detection process of this invention utilizes RT-RAA amplification without the need for a thermal cycling device. A large amount of amplification products can be obtained by reacting at a constant temperature of 37℃-42℃ for 30 minutes. Detection can be achieved using a water bath or other device that can provide this constant temperature condition, which reduces detection costs and avoids reliance on expensive instruments, thus facilitating its application in clinical settings, especially in resource-poor areas.

[0022] This invention can detect canine distemper virus strains currently discovered in China, with a wide detection range.

[0023] The detection method established in this invention has no cross-reactivity with common canine pathogens and has high specificity.

[0024] This invention utilizes both RT-RAA and CRISPR / Cas 12b technologies, with the entire reaction process taking no more than 2 hours. Furthermore, the use of CRISPR / Cas 12b technology improves the specificity of isothermal amplification detection and reduces the risk of false positive results.

[0025] The lower limit of visual detection of this invention can reach 4.77 × 10⁻⁶. 1 With copies / μL, it enables real-time, visual detection of canine distemper virus using blue light or ultraviolet light, and has high detection sensitivity. Attached Figure Description

[0026] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0027] Figure 1 A schematic diagram of the amplification results of the conserved fragment of the CDV N gene (M: Marker; 1: cDNA prepared from extracted RNA as template; 2: negative control without template);

[0028] Figure 2 This is a schematic diagram of the detection results of RNA, an in vitro transcribed product (M: Marker; 1: cDNA prepared from in vitro transcribed RNA as a template; 2: negative control without template).

[0029] Figure 3 A schematic diagram of the RT-RAA amplification time screening results (M: Marker; 1: 10 min; 2: 20 min; 3: 30 min; 4: Negative control);

[0030] Figure 4 This is a schematic diagram of CRISPR nucleic acid testing results;

[0031] Figure 5 A schematic diagram showing the temperature screening results of the CRISPR nucleic acid detection system;

[0032] Figure 6 The final concentration and ratio screening results of sgRNA and AapCas 12b in the CRISPR nucleic acid detection system;

[0033] Figure 7 A graph showing the final concentration screening results of trans-cut report molecules in the CRISPR nucleic acid detection system;

[0034] Figure 8Figure showing the results of sensitivity investigation for the RT-RAA CRISPR / Cas 12b detection kit;

[0035] Figure 9 A schematic diagram illustrating the results of sensitivity investigation for the RT-RAA CRISPR / Cas 12b detection kit;

[0036] Figure 10 A visualization of the results of the investigation into the specificity of the RT-RAA CRISPR / Cas 12b detection kit. Detailed Implementation

[0037] This invention designs a chemiluminescent detection kit for canine distemper virus (CDV) based on CDetection (Cas 12b-mediated DNA detection) technology. Specifically, it combines reverse transcription-recombinase amplification (RT-RAA) technology with CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) nucleic acid detection to design a highly specific and sensitive canine distemper virus detection kit.

[0038] The RT-RAA universal primer set designed in this invention is used for the reverse transcription isothermal amplification system of the target fragment of the canine distemper virus N gene. The sgRNA (guide RNA) targeting the canine distemper virus N gene described in this invention is a type of small non-coding RNA with sequence guidance function, which achieves targeted localization of nucleic acid editing through a base complementary pairing mechanism. In the CRISPR gene editing system, the artificially designed single-stranded guide RNA (sgRNA) forms a complex by binding to the Cas12b protein, guiding the nuclease to cleave the DNA target site.

[0039] In different CRISPR systems, the combination of sgRNAs varies depending on the Cas protein they rely on. According to the AapCas 12b protein used in this invention, the sgRNA includes crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA). The crRNA targets the target fragment, while the tracrRNA is a longer RNA containing a Cas protein-binding domain and a sequence complementary to the repeating region of the crRNA. The crRNA and tracrRNA can be artificially fused to form a single guide RNA. The complementary sequences of the crRNA and tracrRNA can be linked together, ultimately forming a hairpin-shaped secondary structure, creating a structure similar to the crRNA-tracrRNA complex.

[0040] The detection system of this invention can effectively amplify the target fragment of the N gene of canine distemper virus and visualize the target detection, and has a wide detection range for canine distemper virus strains. The detection includes RT-RAA amplification and CRISPR visualization detection.

[0041] The conserved N genome sequence (SEQ ID NO. 8) in this invention is a key basis for target selection and sgRNA design. This invention first amplifies this conserved sequence (CDVN) to obtain a long fragment with high abundance. The total amplicon (SEQ ID NO. 9) is a short fragment of the target gene selected based on the aforementioned conserved long fragment (CDVN). Nested PCR amplification is then performed to obtain a high-purity, high-quality target fragment containing the target, ensuring the accuracy and reproducibility of the experiment.

[0042] The RT-RAA CRISPR / Cas 12b detection kit finally designed in this invention has high specificity, does not cross-react with other viruses, and has a visual limit of detection of 4.77 × 10⁻⁶. 1 The rapid detection method, using copies / μL, enables immediate detection of canine distemper virus (CDV) with low labor and equipment costs, a short turnaround time (no more than 2 hours). This rapid detection technology can be widely applied to epidemiological investigations and epidemic monitoring of canine distemper virus, and is suitable for wildlife disease monitoring, zoo quarantine, and rapid on-site detection of clinical samples from canines. It has significant practical value and broad market prospects.

[0043] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0044] The ABuffer, B Buffer, and reaction powder in the RT-RAA reaction system of this invention were all obtained from the RT-basic nucleic acid amplification kit, purchased from Hangzhou Zhongce Biotechnology Co., Ltd.; the trans-cleavage fluorescent reporter molecule was synthesized by Shanghai Sangon Biotech Co., Ltd.; and the sgRNA was synthesized by Beijing Qingke Biotechnology Co., Ltd. The instruments and reagents also included: DNA extraction reagent (Shanghai Jizhi Biochemical Technology Co., Ltd.), DNA Marker (Novozymes Biotechnology Co., Ltd.), agarose (Beyotime Biotechnology Co., Ltd.), AapCas 12b Nuclease (Yisheng Biotechnology Co., Ltd.), AapCas 12b Cleavage Buffer (Yisheng Biotechnology Co., Ltd.), and Gel Extraction Kit (Omega Bio-Tek).

[0045] Unless otherwise specified, the production processes, experimental methods, or testing methods involved in the embodiments of this invention are all conventional methods in the prior art, and their names and / or abbreviations are all conventional names in the field, which are very clear and distinct in the relevant application areas. Those skilled in the art can understand the conventional process steps based on the names and apply the corresponding equipment, and implement them according to conventional conditions or the conditions recommended by the manufacturer.

[0046] The various instruments, equipment, raw materials or reagents used in the embodiments of this invention are not subject to any special restrictions on their source. They are all conventional products that can be purchased through regular commercial channels and can be prepared according to conventional methods known to those skilled in the art.

[0047] Example 1: Design and Synthesis of Primers, sgRNA, and Probes

[0048] The N gene fragment of canine distemper virus was compared using MAGE 11 bioinformatics software to screen out conserved N genome sequences. Specifically, the sequence of the canine distemper virus gene sequence from position 475 to 1597 in the NCBI database (GenBank: NC001921.1) is shown in SEQ ID NO.8.

[0049] Based on the PAM site identified by AapCas 12b, the target sequence for CRISPR detection was determined, and sgRNA and RT-RAA primers capable of amplifying the target were designed. The total length of the sgRNA is 111 nt, the primer size is 30-35 bp, and the total amplicon size (the amplified fragment of the target gene) is 346 bp. The amplified target fragment is the 709th to 1054th bases of the aforementioned reference gene sequence (CDV N), and the base sequence of this region is as follows (5'-3'): AGCAAAGACGTGTGGTCGGAGAATTTAGAATG AACAAAATCTGGCTTGATATTGTTAGAAACAGGATTGCTGAGGACCTATCTTTGAGGCGATTCATGGTGGCGCTCATCTTGGACATCAAACGATCCCCAGGGAACAAGCCTAGAATTGCTGAAATGATTTGTGATATAGATAACTACATTGTGGAAGCTGGGTTAGCTAGTTTCATCCTAACTATCAAGTTT GGCATTGAAACTATGTATCC GGCTCTTGGGTTGCATGAGTTTTCCGGAGAATTAACAACTATTGAATCCCTCATGATGCTATATCAACAGATGGGTGAAACAGCACCGTACATGGTTATCTT (SEQ ID NO. 9).

[0050] Primer designs are shown in Table 1, and sgRNA and probe designs are shown in Table 2.

[0051] Table 1 Primer Design

[0052]

[0053] Table 2 sgRNA and probe design

[0054]

[0055]

[0056] Note: In the nucleotide sequence listing above, all sequences containing the base U (uracil) are replaced with N.

[0057] In sgRNA (Scaffold + protospacer), Scaffold is located at the 3' end of sgRNA and binds to the Cas 12b protein groove to form a ribonucleoprotein complex (RNP), ensuring precise cleavage of the target DNA; protospacer is the core target sequence of sgRNA, with a length of 20 nt, which is complementary to the target DNA sequence to ensure cleavage efficiency.

[0058] PAM stands for protospacer-adjacent motif, a short DNA sequence directly adjacent to the DNA sequence targeted by CRISPR effector proteins, and is essential for the cleavage activity of some Cas proteins. The PAM sequence of AapCas12b is 5'-TTN-3'.

[0059] ssDNA-FQ is a single-stranded DNA fluorescent probe composed of single-stranded DNA (ssDNA) and a fluorophore quencher (FQ). The 5' end of the probe sequence is labeled with a FAM fluorescent group, and the 3' end is labeled with a BHQ1 quencher group. In the CRISPR / Cas12b detection system, ssDNA-FQ acts as a reporter molecule. It is activated by the Cas12b nuclease upon recognition of the target nucleic acid sequence, which cleaves ssDNA-FQ to release a fluorescent signal, enabling visual detection. When the CRISPR / Cas12b system recognizes the target nucleic acid, the enzyme activity is activated and cleaves ssDNA-FQ, causing the fluorophore to separate from the quencher, and the fluorescence signal to recover.

[0060] Example 2 Initial preparation of the target fragment

[0061] Total RNA was extracted from laboratory-preserved canine distemper-positive samples using the RNA fast 200 Total RNA Rapid Extraction Kit. The extracted RNA was stored at -80℃ for later use. 5 μL of RNA was used to prepare cDNA using the TIANScript II RT Kit. Using this cDNA as a template, and with primers SEQ ID NO.1 and SEQ ID NO.2 as primers for amplifying the conserved CDVN gene sequence, conventional PCR was performed to amplify the conserved fragment. A negative control was also included, using nuclease-free water as the amplification template. The expected size of the successfully amplified product was 1123 bp.

[0062] The results are as follows Figure 1 As shown, lane 1 contains a band amplified using cDNA prepared from extracted RNA as a template, and the size is consistent with expectations; lane 2 contains the result of amplification using nuclease-free water as a template, and no band is shown. The band in lane 1 was excised from the gel, and the gel was recovered using a Gel Extraction Kit to obtain the purified conserved CDVN gene sequence.

[0063] Example 3: In vitro transcription of the target fragment to prepare RNA standards

[0064] (1) Obtaining in vitro transcription template: First, add the T7 transcription sequence before the N-RAA-F primer sequence, (5'-3')TAATACGACTCACTATAGGG (SEQ ID NO.10), that is, the primers for amplifying the transcription template are designed as T7-N-RAA-F and N-RAA-R, as shown in SEQ ID NO.5 and SEQ ID NO.4.

[0065] (2) Using the gel recovery product from Example 2 as a template, conventional PCR amplification was performed using the primer pairs N-RAA-F and N-RAA-R designed in this invention to obtain the target fragment of the CDVN gene. The PCR product was then subjected to agarose gel electrophoresis and gel recovery purification.

[0066] (3) Using the purified DNA recovered in step (2) as a template, in vitro transcription was performed using the HiScribe T7 ARCAmRNA Kit purchased from New England Biolabs. The specific procedures were performed according to the instructions provided with the kit. After transcription, 1 μL of DNase I (deoxyribonuclease) was added to eliminate the template DNA.

[0067] The RNA products transcribed in vitro were purified using the NucleoSpin RNA Clean-up Kit purchased from Macherey-Nagel, following the instructions.

[0068] Using the purified RNA as a template, cDNA was prepared using the TIANScript II RTKit. Then, using the cDNA as a template and N-RAA-F and N-RAA-R primer pairs, PCR experiments were performed. At the same time, a template-free control group was set up, i.e., nuclease-free water was used as the amplification template. After the amplification was completed, the two PCR products were subjected to agarose gel electrophoresis to verify whether the in vitro transcription was successful.

[0069] The results of the agarose gel electrophoresis experiment are as follows: Figure 2 As shown, lane 1 was amplified using cDNA as a template, and its band size was 346 bp, which was consistent with the expectation and was the target fragment containing the CDVN gene; lane 2 was the nuclease-free water negative control group, and no band was shown.

[0070] Standard RNA was successfully transcribed, with a concentration of 4.77 × 10⁻⁶. 12 The RNA standard was diluted to 4.77 × 10⁻⁶ copies / μL with nuclease-free water. 6 4.77×10 5 4.77×10 4 4.77×10 3477, 47.7 copies / μL.

[0071] Example 4: Screening of Reverse Transcription Isothermal Nucleic Acid Amplification Time

[0072] The RNA transcribed in vitro in Example 3 (4.77 × 10⁻⁶) 6 Using copies / μL as templates, amplification was performed using an RT-basic nucleic acid amplification kit.

[0073] The total reaction volume was 50 μL, which contained 13.5 μL of nuclease-free water, 25 μL of A Buffer, 2 μL of 10 μM forward primer, 2 μL of 10 μM reverse primer, 5 μL of RNA template, and 2.5 μL of B Buffer.

[0074] The specific operating steps are as follows:

[0075] Thaw the Abuffer and B buffer on ice.

[0076] Take 25 μL of buffer into an enzyme-free PCR tube, add 2 μL of 10 μM forward primer and 2 μL of 10 μM reverse primer, and add 13.5 μL of nuclease-free water. The primer combination used is N-RAA-F (SEQ ID NO.3) and N-RAA-R (SEQ ID NO.4).

[0077] After mixing the ingredients in step (2), add them to the reaction dry powder tube and gently aspirate to mix.

[0078] Add 5 μL of standard RNA (4.77 × 10⁻⁶) to the reaction powder tube. 6 (copies / μL), while a nuclease-free water control group was set up.

[0079] Add 2.5 μL of B buffer to the cap of the reaction dry powder tube, and centrifuge using a low-speed instantaneous centrifuge to remove the B buffer.

[0080] Place the reaction tube in the PCR instrument and set the program to 42℃, 10min, 20min, 30min.

[0081] After the reaction was complete, 50 μL of DNA extraction reagent was added to extract the product from the reaction tube. After adding the extraction reagent, a white substance was clearly observed to precipitate out.

[0082] Place the reaction tube containing the extraction reagent in a centrifuge and centrifuge at 12,000 rpm for 5 minutes. After centrifugation, transfer the supernatant to a new enzyme-free PCR tube, add 10× DNA loading buffer, and discard the remaining liquid and precipitate after centrifugation.

[0083] Prepare a 2% agarose gel using a 2000bp DNA marker.

[0084] Perform agarose gel electrophoresis.

[0085] The results are as follows Figure 3 As shown, the RT-RAA amplification product is 346bp in size. The band is brighter when the RT-RAA amplification is 30 min. 30 min was selected as the duration for reverse transcription isothermal nucleic acid amplification in subsequent operations.

[0086] Example 5: Preliminary Experiment with CRISPR Nucleic Acid Detection

[0087] With a concentration of 4.77 × 10 6 Using RNA standards (copies / μL) as templates, RT-RAA amplification of the target fragment was performed. The specific procedures are as described in Example 3. After incubation at 42℃ for 30 min, the sample was placed on ice for later use. The CRISPR nucleic acid detection system was prepared, and the reagents and quantities are shown in the table below:

[0088] Table 3 CRISPR Nucleic Acid Detection System

[0089]

[0090] The AapCas 12b and sgRNA complex was incubated at room temperature for 10 min beforehand. Then, 10× reaction buffer, ssDNA-FQ, and nuclease-free water were added sequentially. 2 μL of the RT-RAA product was added to the cap of a CRISPR detection tube. After a brief incubation period, fluorescence was immediately detected using a Roche / LightCycler 480Ⅱ real-time quantitative PCR instrument. The program was set to 55℃ for 30 min, with FAM fluorescence collected every 30 s. Results are as follows: Figure 4 As shown.

[0091] Example 6: Screening of CRISPR nucleic acid detection reaction temperatures

[0092] The temperature gradient was set to 51℃, 53℃, 55℃, 57℃, 58℃, and 59℃. First, an RT-RAA amplification experiment was performed. Then, 2 μL of the product was added to the cap of the CRISPR detection tube. The specific operation is as shown in Examples 4 and 5.

[0093] CRISPR nucleic acid detection reaction temperature screening results are as follows: Figure 5As shown in the line graph, the optimal temperature for CRISPR nucleic acid detection is 58℃.

[0094] Example 7: Screening of the optimal final concentration and ratio of sgRNA and AapCas 12b in a CRISPR nucleic acid detection system.

[0095] In the CRISPR system, the ratio of AapCas 12b to sgRNA was changed to enhance the sensitivity of the nucleic acid detection system.

[0096] Set up combination 1: AapCas 12b final concentration 250nM, sgRNA final concentration 250nM respectively;

[0097] Combination 2: AapCas 12b final concentration 250 nM, sgRNA final concentration 125 nM;

[0098] Combination 3: AapCas 12b final concentration 125 nM, sgRNA final concentration 125 nM;

[0099] Combination 4: AapCas 12b final concentration 125 nM, sgRNA final concentration 250 nM.

[0100] First, perform RT-RAA amplification, then take the product for CRISPR detection, as shown in Examples 4 and 5.

[0101] The results of the screening for the optimal final concentration and ratio of sgRNA and AapCas 12b in the CRISPR nucleic acid detection system are as follows: Figure 6 As shown in the line graph, the CRISPR detection system exhibits the strongest fluorescence when the final concentration of AapCas 12b reaches 250 nM and the final concentration of sgRNA reaches 125 nM.

[0102] Example 8: Screening for the optimal final concentration of trans-cleavage reporter molecules in a CRISPR nucleic acid detection system.

[0103] Set the ssDNA-FQ gradient concentrations to 800 nM, 1 μM, 1.2 μM, and 1.5 μM. First, perform RT-RAA amplification, and then take the product for CRISPR detection. The specific operation is as shown in Examples 4 and 5.

[0104] The optimal final concentration screening results for trans-cutting report molecules in the CRISPR nucleic acid detection system are as follows: Figure 7 As shown in the line graph, the CRISPR detection system exhibits the strongest fluorescence intensity when the concentration of ssDNA-FQ is 1.2 μM.

[0105] Example 9: Sensitivity Investigation of the RT-RAA CRISPR / Cas 12b Detection System

[0106] RNA standards diluted to 1000, 477, 100, 47.7, and 10 copies / μL were used for RT-RAA amplification, as shown in Example 4.

[0107] After the RT-RAA reaction was carried out at 42°C for 30 min, 2 μL of the reaction product was added to the cap of the prepared CRISPR detection tube. The CRISPR detection system was as shown in Example 5, wherein the CRISPR nucleic acid detection temperature was 58°C; the final concentration of AapCas12b was 250 nM; the final concentration of sgRNA was 125 nM; and the concentration of ssDNA-FQ was 1.2 μM.

[0108] The sensitivity investigation results of the RT-RAACRISPR / Cas 12b detection system are as follows: Figure 8 as well as Figure 9 As shown in the line graph, the detection limit of this method can reach 4.77 × 10⁻⁶. 1 copies / μL.

[0109] Example 10: Specificity Investigation of the RT-RAA CRISPR / Cas 12b Detection System

[0110] Viral nucleic acid was extracted from canine distemper virus (CDV) positive anal swab samples. Nucleic acid was also extracted from laboratory-preserved canine parvovirus (CPV) strains, canine coronavirus (CCoV) strains, canine parainfluenza virus (CPIV) nucleic acid, and canine adenovirus (CAV) nucleic acid for the specific detection of this invention.

[0111] Test results as follows Figure 10 As shown, the extracted CDV nucleic acid can be successfully amplified by RT-RAA and can be successfully detected by CRISPR visualization. CCoV, CPV, CPIV, and CAV are all undetectable. Therefore, this detection method has good specificity.

[0112] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A primer set for the detection of canine distemper virus RT-RAA CRISPR / Cas 12b, characterized in that, The primer set includes an upstream primer as shown in SEQ ID NO.3 and a downstream primer as shown in SEQ ID NO.

4.

2. A reverse transcription isothermal amplification system, characterized in that, The reverse transcription isothermal amplification system includes the primer set described in claim 1.

3. A kit for detecting canine distemper virus RT-RAA CRISPR / Cas 12b, characterized in that, The kit includes the reverse transcription isothermal amplification system and the CRISPR / Cas 12b detection system described in claim 2.

4. The reagent kit according to claim 3, characterized in that, The CRISPR / Cas 12b detection system includes sgRNA targeting the N gene of canine distemper virus, VB-type Cas 12b protein, trans-cleavage reporter molecule, RT-RAA product, buffer, and nuclease-free water.

5. The reagent kit according to claim 4, characterized in that, The sgRNA targets the N gene of canine distemper virus; the sequence of the sgRNA is shown in SEQ ID NO.6 of the nucleotide sequence listing; the target fragment of the N gene of canine distemper virus is shown in SEQ ID NO.9 of the nucleotide sequence listing.

6. The reagent kit according to claim 4, characterized in that, The trans-cleaved reporter molecule is shown in SEQ ID NO.7, and the 5' end of the trans-cleaved reporter molecule is labeled with the fluorescent group 6-FAM and the 3' end is labeled with the quencher group BHQ-1.

7. The reagent kit according to claim 4, characterized in that, The final concentrations of the VB-type Cas 12b protein and sgRNA were 125 nM-250 nM, and the final concentrations of the trans-cleavage reporter molecule were 800 nM-1.5 μM.

8. A method for detecting canine distemper virus, characterized in that, The procedure includes using the kit described in claim 3 to extract RNA from the sample to be tested, performing reverse transcription and isothermal amplification to obtain the amplification product; and finally, performing CRISPR / Cas 12b detection on the amplification product.

9. The method according to claim 8, characterized in that, The amplification conditions for the reverse transcription isothermal amplification are: 42℃, reaction time 30 min; the detection conditions for the CRISPR / Cas 12b detection are: 52-60℃, reaction time 30 min.

10. The application of the primer set of claim 1, the kit of claim 3, or the method of claim 8 in the epidemiological investigation or epidemic monitoring of canine distemper virus.

Images