Hemoglobin-resistant Taq DNA polymerase mutant and construction method thereof

Abstract

The invention discloses a hemoglobin-resistant Taq DNA polymerase mutant and a construction method thereof, and relates to the field of biology, and the hemoglobin-resistant Taq DNA polymerase mutant is characterized in that a nucleotide sequence for coding the Taq DNA polymerase is shown as SEQ ID NO.1, and the mutant comprises at least one mutation or all mutations selected from S623D and E721A sites. On the basis of natural Taq DNA polymerase, the molecular structure of the Taq DNA polymerase is modified through rational design and combination with a site-specific mutagenesis biotechnology, so that the Taq DNA polymerase mutant is more suitable for PCR amplification of samples containing hemoglobin and the like than a wild type, and the result judgment accuracy of a sample containing a hemoglobin inhibitor is more facilitated.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biology, more particularly, it relates to a hemoglobin-resistant Taq DNA polymerase mutant and a construction method thereof. BACKGROUND

[0002] Hemoglobin (HGB) is a special protein for transporting oxygen in red blood cells, which is the protein that makes blood red, and is composed of globin and hematin. The globin part is a tetramer composed of two pairs of different globin chains (alpha and beta chains). Hematin is a ferroporphyrin compound, which is a coenzyme of hemoglobin, and each hematin is composed of four pyrrole subunits to form a ring, with a ferrous ion at the center. When blood is used as a template for PCR detection in clinical practice, hemoglobin in the blood will be released into the PCR system and react with Taq DNA polymerase, thereby inhibiting the formation of amplicons.

[0003] Taq DNA polymerase is the first discovered heat-stable DNA polymerase, with a molecular weight of 94 kD, which was originally extracted from a strain of Thermus aquaticus isolated from a hot spring by Saiki et al. This enzyme can withstand high temperatures, and after 2 h of reaction at 70℃, its residual activity is greater than 90% of the original, after 2 h of reaction at 93℃, its residual activity is 60% of the original, and after 2 h of reaction at 95℃, its residual activity is 40% of the original. In molecular cloning, Taq DNA polymerase can be used for DNA sequence determination and can be used for in vitro amplification of specific DNA fragments by polymerase chain reaction (PCR). In the PCR process, since Taq DNA polymerase is not inactivated in the denaturation step (about 94℃), it can directly enter the second cycle, so it is not necessary to add new enzyme every cycle, which makes Taq DNA polymerase a unique enzyme in PCR reaction.

[0004] PCR technology is an important cornerstone of modern molecular biology, and Taq DNA polymerase is a classic main force of PCR technology. Based on the functions and characteristics of Taq DNA polymerase, its modification is carried out through site-directed mutagenesis, domain recombination, directed evolution, etc. Many mutants of Taq enzyme with improved catalytic performance or new functions are obtained, which are widely used in the field of molecular biology, such as direct PCR, allele detection, Sanger sequencing, fluorescent quantitative PCR, TA cloning, etc. However, due to the presence of many substances in common clinical samples, especially hemoglobin, which has a great inhibitory effect on PCR amplification, there is a problem of low hemoglobin resistance of Taq DNA polymerase. SUMMARY

[0005] The present application provides a hemoglobin-resistant Taq DNA polymerase mutant and a construction method thereof to solve the above problems.

[0006] The above technical object of the present application is achieved by the following technical solution: a hemoglobin-resistant Taq DNA polymerase mutant, wherein the nucleotide sequence encoding the Taq DNA polymerase is shown as SEQ ID NO. 1, and the mutant comprises at least one mutation or all mutations selected from sites S623D and E721A.

[0007] SEQ ID NO. 1: In one embodiment, the S623D site mutation is a mutation of the serine at position 623 of Taq DNA polymerase having an amino acid sequence as set forth in SEQ ID NO. 1 to an aspartic acid, which has an amino acid sequence as set forth in SEQ ID NO. 2.

[0008] SEQ ID NO. 2: In another embodiment, the E721A site mutation is a mutation of glutamic acid at position 721 of Taq DNA polymerase having an amino acid sequence as set forth in SEQ ID NO. 1 to alanine, which has an amino acid sequence as set forth in SEQ ID NO. 3.

[0009] SEQ ID NO. 3: In yet another embodiment, the S623D site E721A site co-mutation is a mutation of the serine at position 623 to aspartic acid and the glutamic acid at position 721 to alanine of the Taq DNA polymerase having the amino acid sequence set forth in SEQ ID NO. 1, which has the amino acid sequence set forth in SEQ ID NO. 4.

[0010] SEQ ID NO. 4: The application provides a method for preparing the hemoglobin-resistant Taq DNA polymerase mutant, and the specific steps are as follows: (1) taking the nucleotide sequence shown in SEQ ID NO. 1 as a template, designing a site-directed mutation primer according to a rationally designed site, performing PCR amplification to obtain a gene containing a mutation site, and then constructing a vector containing the mutant gene; (2) transforming the gene vector containing the mutant into a host cell; (3) screening and verifying the recombinant cell constructed in the step, obtaining a positive clone, then culturing and fermenting to produce an enzyme, centrifuging to collect cells, crushing the cells by using an ultrasonic cell disruptor, and centrifuging to obtain a crude enzyme solution containing the Taq DNA polymerase mutant.

[0011] The application further provides a gene encoding the Taq DNA polymerase mutant.

[0012] The application further provides a recombinant vector carrying the gene.

[0013] In an embodiment, the recombinant vector takes a pET-28a(+) vector as an expression vector.

[0014] The application further provides a recombinant cell carrying the gene or the recombinant vector.

[0015] In an embodiment, the recombinant cell takes Escherichia coli as an expression host. Escherichia coli ) as an expression host.

[0016] The application further provides a genetically engineered bacterium, which takes Escherichia coli as a host and expresses the Taq DNA polymerase mutant.

[0017] In an embodiment, the genetically engineered bacterium takes Escherichia coli BL21 (DE3) as an expression host.

[0018] In another embodiment, the genetically engineered bacterium takes a pET-28a(+) vector as an expression host.

[0019] The application provides a construction method of the hemoglobin-resistant Taq DNA polymerase mutant, which is to mutate the amino acid at the 623th and / or 721th position of the Taq DNA polymerase with the amino acid sequence shown in SEQ ID NO. 1.

[0020] The application provides application of the recombinant vector or the recombinant cell in preparation of the Taq DNA polymerase.

[0021] The application provides application of the Taq DNA polymerase mutant, or the gene encoding the mutant, or the Taq DNA polymerase expressed by the recombinant vector or the recombinant cell in amplification of a PCR reaction containing a hemoglobin sample.

[0022] In summary, the application has the following advantages: 1. Based on the natural Taq DNA polymerase, the application improves the stability of the mutant strains S623D and E721A by rational design, combination of site-directed mutation biological technology and modification of the molecular structure of the Taq DNA polymerase, and analysis of the influence of the residues after mutation on the ability of the enzyme to resist hemoglobin.

[0023] 2. The natural Taq DNA polymerase can be amplified in the presence of 0.8 mg / mL hemoglobin, the Taq DNA polymerase mutant S623D provided by the application can be amplified in the presence of 3.2 mg / mL hemoglobin, which is 4 times that of the natural Taq DNA polymerase, the Taq DNA polymerase mutant E721A can be amplified in the presence of 3.2 mg / mL hemoglobin, which is 4 times that of the natural Taq DNA polymerase, and S623D / E721A can be amplified in the presence of 6.4 mg / mL hemoglobin, which is 8 times that of the natural Taq DNA polymerase.

[0024] 3. The Taq DNA polymerase mutant obtained by the application is more suitable for PCR amplification of samples containing hemoglobin and the like than the wild type, and is more conducive to the accuracy of the result evaluation of samples containing hemoglobin inhibitors. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1 It is a sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) analysis diagram of a washing liquid in a Taq DNA polymerase purification process; Figure 2 It is a standard curve diagram for determination of the enzyme activity of the Taq DNA polymerase; Figure 3 It is an agarose gel detection diagram of Taq-wt (1-6), Taq-S623D (7-14) and Taq-E721A (15-22) under the hemoglobin gradient of 0.1 mg / mL, 0.2 mg / mL, 0.4 mg / mL, 0.8 mg / mL, 1.6 mg / mL, 3.2 mg / mL and 6.4 mg / mL; Figure 4The detection chart of Taq-S623D / E721A on agarose gel under hemoglobin gradient of 0.1 mg / mL, 0.2 mg / mL, 0.4 mg / mL, 0.8 mg / mL, 1.6 mg / mL, 3.2 mg / mL, 6.4 mg / mL. DETAILED DESCRIPTION

[0026] The technical solutions in the embodiments of the present application will be clearly and completely described below. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments in the present application, all the other embodiments obtained by those skilled in the art without creative work fall within the protection scope of the present application.

[0027] The pET-28a(+) vector involved in the following embodiments is purchased from Invitrogen.

[0028] The culture medium involved in the following embodiments is as follows: (1) LB liquid culture medium: 10 g / L of proteose peptone, 5 g / L of yeast extract, 10 g / L of NaCl.

[0029] (2) LB solid culture medium: 10 g / L of proteose peptone, 5 g / L of yeast extract, 10 g / L of NaCl, 15 g / L of agar.

[0030] The detection method involved in the following embodiments is as follows: The enzyme activity determination of Taq DNA polymerase adopts fluorescence method. Mainly, Taq DNA polymerase can use long-chain oligonucleotide as a template, and a small piece of single-stranded oligonucleic acid complementary to the 5' end of the long-chain oligonucleotide as a primer to amplify double-stranded DNA. Fluorescent dye SYBR Green can bind to the small groove of double-stranded DNA and emit fluorescence. The more double-stranded DNA is synthesized, the stronger the fluorescence signal is. The real-time fluorescence signal collected by DNA polymerase amplification can be determined by analyzing the initial slope of the real-time fluorescence signal curve. The method for determining enzyme activity mainly includes two steps: (1) drawing a standard curve of known commercial Taq DNA polymerase activity units; (2) determining the activity units of unknown enzyme.

[0031] A 236 bp amplicon on human genome was used to investigate the tolerance of Taq DNA polymerase to hemoglobin in PCR detection system. The 25 uL PCR reaction system was as follows: 1x PCR buffer, 2.5 mM MgCl2, 0.2 μΜ upstream primer, 0.02 μΜ downstream primer, 200 μΜ dNTPs, 0.4x SYBR Green, 1 U enzyme, and 1 ng / uL template concentration, and 2 μL was loaded. The hemoglobin content in the system was increased in gradient, and the PCR products were subjected to nucleic acid electrophoresis analysis.

[0032] Example 1: Construction of recombinant plasmid containing Taq DNA polymerase mutant The specific steps are as follows: (1) Construction of recombinant plasmid containing wild-type Taq DNA polymerase The wild-type Taq DNA polymerase gene polA with the nucleotide sequence shown in SEQ ID NO. 1 was chemically synthesized, and the pET-28a(+) vector was digested with Nde I and Mlu I enzymes and then ligated to prepare the recombinant vector pET-28a(+)-polA.

[0033] (2) Obtaining of recombinant vector containing mutant: The recombinant vector pET-28a(+)-polA prepared in step (1) was used as a template to perform site-directed mutagenesis by whole plasmid PCR technology to obtain recombinant plasmids pET-28a(+)-S623D, pET-28a(+)-E721A, and pET-28a(+)-S623D / E721A containing mutant genes.

[0034] The primer sequences designed are as follows: S623D-F: GGCGCATCTGGATGGCGATGAAAAC S623D-R: GTTTTCATCGCCATCCAGATGCGCC E721A-F: GGCTATGTGGCGACCCTGTTTGGC E721A-R: GCCAAACAGGGTCGCCACATAGCC Among them, the PCR amplification program was set as follows: first, 95 ℃ pre-denaturation for 5 min; then, 30 cycles of 95 ℃ denaturation for 30 s, 72 ℃ annealing for 30 s, 58 ℃ extension for 3.5 min, and 4 ℃ incubation. The PCR products were detected by 0.8% agarose gel electrophoresis.

[0035] The final amplified fragments were treated with Dpn I enzyme in a 37°C water bath for 1 h to remove the template, and then the PCR mixture was chemically transformed into E. coli JM109 competent cells. The transformation liquid was spread on LB solid medium containing kanamycin (50 μg / mL), and the plasmid was extracted and sequenced. The sequencing work was completed by Suzhou Jinvizhi. Example 2: Construction of recombinant E. coli engineering bacteria of Taq DNA polymerase mutant, and expression, isolation and purification of Taq DNA polymerase The specific steps are as follows: (1) The recombinant plasmids pET-28a(+)-S623D, pET-28a(+)-E721A and pET-28a(+)-S623D / E721A obtained in Example 1 were transformed into E. coli BL21 competent cells, respectively, to prepare the gene engineering bacteria E. coli BL21 / pET-28a(+)-pulA, E. coli BL21 / pET-28a(+)-S623D, E. coli BL21 / pET-28a(+)-E721A and E. coli BL21 / pET-28a(+)-S623D / E721A, respectively.

[0036] (2) The gene engineering bacteria prepared in step (1) were inoculated into 10 mL of LB liquid medium containing 50 μg / mL kanamycin sulfate, and cultured at 37°C and 200 rpm overnight to prepare seed liquid; The prepared seed liquid was transferred to 100 mL of LB liquid medium containing 50 μg / mL kanamycin sulfate at an inoculation amount of 2% (v / v), and cultured at 30°C for 20 h to obtain fermentation broth. The prepared fermentation broth was centrifuged at 8000 x g and 4°C for 5 min to obtain cell mass, and the cells were resuspended with 10 mL of sodium phosphate dibasic-sodium phosphate monobasic buffer (pH 7.0) after washing 3 times.

[0037] The resuspended cells were treated with an ultrasonic disrupter under ice bath conditions for 30 min, and centrifuged at 8000 x g and 4°C for 30 min. The supernatant was removed to obtain crude enzyme liquid; The supernatant part was filtered through a 0.22-μm filter, and then further loaded onto a 1 mL Ni affinity column, which was pre-equilibrated with 50 mM washing buffer (20 mM Tris and 500 mM NaCl, pH 7.4), and then elution buffer (20 mM Tris, 500 mM NaCl and 500 mM imidazole, pH 7.4) was used to elute the unbound proteins and Taq DNA polymerase with a linear gradient; the pure enzyme liquid containing wild-type Taq DNA polymerase, the pure enzyme liquid containing S623D, the pure enzyme liquid containing E721A, and the pure enzyme liquid containing S623D / E721A were prepared, respectively; The above pure enzyme liquids were analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), respectively. The results, as shown in Figure 1 , showed that there were obvious bands at 94 kDa, proving that the Taq DNA polymerase was expressed.

[0038] (3) Enzyme activity determination of the pure enzyme liquid prepared in step (2) The pure enzyme liquid containing wild-type Taq DNA polymerase, the pure enzyme liquid containing S623D, the pure enzyme liquid containing E721A, and the pure enzyme liquid containing S623D / E721A prepared in step (2) were detected, respectively.

[0039] The designed primer sequences were as follows: 236bp-F: TGGGCTTGAATAGTTAGATGCT 236bp-R: GCCTTCGCCTGTCCTCAT A standard curve of the known commercial Taq DNA polymerase activity units was drawn (as shown in Figure 2 ), the curve on the real-time fluorescent PCR instrument was exported, and the initial slope of each curve was analyzed by Origin software. Example 3: Hemoglobin resistance test of Taq DNA polymerase mutants The detection example uses the method of fluorescent quantitative PCR to detect the anti-hemoglobin inhibitory capacity of Taq-wt, Taq-S623D, Taq-E721A and Taq-S623D / E721A. 5 ng of Human cDNA is used as a template, and 525 bp fragments are amplified by using wild-type Taq DNA polymerase and each Taq DNA polymerase mutant, respectively. The 25 uL PCR reaction system is as follows: 1x PCR bufer, 2.5 mM MgCl2, 0.2 uM upstream primer, 0.02 uM downstream primer, 200 uM dNTPs, 0.4x SYBR Green, 1 U enzyme, the template concentration is 1 ng / uL, and 2 uL is loaded. The hemoglobin gradient is 0.1 mg / mL, 0.2 mg / mL, 0.4 mg / mL, 0.8 mg / mL, 1.6 mg / mL, 3.2 mg / mL and 6.4 mg / mL. The reaction program is as follows: 95℃ for 30 s; 95℃ for 5 s, 60℃ for 30 s / cycles, a total of 45 cycles. After the reaction, the amplification curve is analyzed, and the reaction product is detected by electrophoresis using 3% agarose gel. The nucleotide sequences of the primers used are as follows: 525bp-F: TTGGTGGAGGTATGTTTAGATTT 525bp-R: TCGCCTGTCCTCATGTATTG The experimental results are shown in Figure 3 、 Figure 4 .

[0040] In summary, based on the natural Taq DNA polymerase, the molecular structure of the Taq DNA polymerase is reformed by rational design and site-directed mutagenesis biological technology, the influence of the residues after mutation on the hemoglobin tolerance of the enzyme is analyzed, and finally two single-point mutant strains S623D and E721A with improved stability are obtained. The Taq DNA polymerase mutant S623D can be amplified in the presence of 3.2 mg / mL hemoglobin, which is 4 times that of the natural Taq DNA polymerase; the Taq DNA polymerase mutant E721A can be amplified in the presence of 3.2 mg / mL hemoglobin, which is 4 times that of the natural Taq DNA polymerase; S623D / E721A can be amplified in the presence of 6.4 mg / mL hemoglobin, which is 8 times that of the natural Taq DNA polymerase, that is, the Taq DNA polymerase mutant is more suitable for PCR amplification of samples containing hemoglobin and other samples, and is more conducive to the accuracy of the result evaluation of samples containing hemoglobin inhibitors.

[0041] The above merely describes the preferred embodiments of the present application, and the protection scope of the present application is not limited to the above-described embodiments. Any technical solution falling within the concept of the present application shall fall within the protection scope of the present application. It should be noted that, for ordinary skilled persons in the art, some improvements and refinements without departing from the principles of the present application shall also be considered as falling within the protection scope of the present application.

Claims

1. A hemoglobin-resistant Taq DNA polymerase mutant, characterized in that, The nucleotide sequence encoding the Taq DNA polymerase is shown in SEQ ID NO. 1, and the mutant contains at least one or all of the mutations selected from the S623D and E721A sites.

2. A method for preparing the hemoglobin-resistant Taq DNA polymerase mutant of claim 1, characterized in that, The specific steps are as follows: (1) Using the nucleotide sequence shown in SEQ ID NO.1 as a template, design site-directed mutagenesis primers according to the rationally designed sites, perform PCR amplification to obtain the gene containing the mutation site, and then construct a vector containing the gene encoding the mutant. (2) Transform the gene vector containing the coding mutant into the host cell; (3) Screen and verify the recombinant cells constructed in the previous step to obtain positive clones. Then, culture and ferment to produce enzymes, collect cells by centrifugation, break the cells using an ultrasonic cell disruptor, and centrifuge to obtain crude enzyme solution containing Taq DNA polymerase mutant.

3. A gene encoding the Taq DNA polymerase mutant of claim 1.

4. A recombinant vector carrying the gene of claim 3, characterized in that, The recombinant vector used was pET-28a(+) as the expression vector.

5. A recombinant cell carrying the gene of claim 3 or the recombinant vector of claim 4, characterized in that, The recombinant cells used Escherichia coli as the expression host.

6. A genetically engineered bacterium expressing the Taq DNA polymerase mutant of claim 1, characterized in that, The genetically engineered bacteria use Escherichia coli as a host.

7. The genetically engineered bacteria as described in claim 6, characterized in that, The genetically engineered bacteria use Escherichia coli BL21(DE3) or pET-28a(+) vectors as expression hosts.

8. A method for constructing a hemoglobin-resistant Taq DNA polymerase mutant, characterized in that, This method involves mutating amino acids at positions 623 and / or 721 of the Taq DNA polymerase, as shown in SEQ ID NO.

1.

9. The use of the recombinant vector of claim 4 or the recombinant cell of claim 5 in the preparation of Taq DNA polymerase.

10. The use of the Taq DNA polymerase mutant of claim 1, the gene of claim 3, the recombinant vector of claim 4, or the recombinant cell of claim 5 expressing the Taq DNA polymerase in a PCR reaction for amplifying samples containing hemoglobin.

Images