Magnaporthe oryzae MoGFD1 gene and application thereof

Abstract

The invention belongs to the field of biological genetic engineering, and particularly relates to a magnaporthe oryzae MoGFD1 gene and application thereof. The full-length sequence of the magnaporthe oryzae MoGFD1 gene is as shown in SEQ ID No. 1, the cDNA sequence is as shown in SEQ ID No. 2, and the amino acid sequence of the encoded protein is as shown in SEQ ID No. 3. The magnaporthe oryzae MoGFD1 gene is applied to regulation and control of growth and development of magnaporthe oryzae and reduction of pathogenicity of magnaporthe oryzae. By verifying physiological functions of the magnaporthe oryzae MoGFD1 gene in nutrition hypha growth, conidium production, appressorium formation, pathogenicity and the like, it is clear that the growth, development and pathogenicity of magnaporthe oryzae can be remarkably inhibited by replacing the magnaporthe oryzae MoGFD1 gene with a hygromycin resistance gene, and it is indicated that MoGFD1 is an important gene in the magnaporthe oryzae pathogenicity process. The MoGFD1 gene and the application thereof provided by the invention provide a new choice for prevention and control of rice blast.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of biological genetic engineering, and particularly relates to a Magnaporthe oryzae MoGFD1 gene and application thereof. BACKGROUND

[0002] Rice is the main food crop in China (especially in the southern region), and feeds 70% of the population in China, so how to cultivate high-quality and high-yield rice has become a major concern of agricultural workers. In recent decades, high-quality rice varieties have emerged in an endless stream, but rice blast caused by Magnaporthe oryzae (Pyricularia oryzae) has brought immeasurable economic losses to major rice-growing regions around the world. Studying the function of Magnaporthe oryzae pathogenicity-related genes helps to elucidate the pathogenic mechanism of rice blast and provide new biological pesticide targets for the prevention and control of rice blast. Maganporthe oryzae

[0003] The appressorium is an infection structure of Magnaporthe oryzae. During the infection process, the germ tube produced by spore germination differentiates into an enlarged infection structure, i.e., an appressorium. During appressorium formation, energy substances stored in spores are transferred to the appressorium through autophagy. The crucial link is that lipids are stored in the appressorium in the form of glycerol as the material basis for the formation of a huge swelling pressure. It is not yet clear how Magnaporthe oryzae coordinates the formation and storage of lipids in conidia and how they are rapidly degraded and utilized during appressorium formation.

[0004] Glycerol dehydrogenase (Gfd1) catalyzes lipid metabolism during the formation of Magnaporthe oryzae appressorium. The activities of glycerol-3-phosphate dehydrogenase (Gpd1) and glycerol dehydrogenase (Gfd1) are detected in the mycelium and appressorium of Magnaporthe oryzae, and the accumulation of glycerol reaches a peak at 8 hours after germination. However, the role of Gfd1 in the growth and pathogenicity of Magnaporthe oryzae is not yet clear. GFD1 SUMMARY

[0005] The purpose of the present application is to provide a Magnaporthe oryzae MoGFD1 gene and application thereof. MoGFD1 The gene plays an important role in regulating the growth of vegetative hyphae, the development of conidia and appressorium, and pathogenicity of Magnaporthe oryzae.

[0006] The technical scheme adopted by the present application is as follows: The present application first provides a Magnaporthe oryzae MoGFD1 gene, wherein the full-length sequence of the Magnaporthe oryzae MoGFD1 gene is shown as SEQ ID No. 1, the cDNA sequence is shown as SEQ ID No. 2, and the amino acid sequence of the encoded protein is shown as SEQ ID No. 3. ​​

[0007] The application further provides the application of the Magnaporthe grisea MoGFD1 gene in regulating the growth and development of the Magnaporthe grisea.

[0008] Further, the application is the application of the Magnaporthe grisea MoGFD1 gene in regulating the vegetative mycelium growth of the Magnaporthe grisea.

[0009] Further, the application is the application of the Magnaporthe grisea MoGFD1 gene in the conidium development of the Magnaporthe grisea.

[0010] Further, the application is the application of the Magnaporthe grisea MoGFD1 gene in regulating the spore morphology.

[0011] Further, the application is the application of the Magnaporthe grisea MoGFD1 gene in delaying the appressorium development.

[0012] Specifically, the Magnaporthe grisea MoGFD1 gene is knocked out and replaced by a hygromycin resistance gene HPH, so that the knockout mutant of the Magnaporthe grisea MoGFD1 gene is constructed, and the growth and development of the Magnaporthe grisea are regulated.

[0013] Further, the method for constructing is as follows: taking the genomic DNA of a wild type strain Guy11 as a template, the upstream fragment A and the downstream fragment B of the target gene are amplified by using primers MoGFD1AF&MoGFD1AR and MoGFD1BF&MoGFD1BR respectively, and the N-terminal HY fragment and the C-terminal YG fragment of the hygromycin are amplified by using primers HYG / F&HY / R and YG / F&HYG / R respectively; the fragments A and HY and the fragments B and YG are fused by using primers MoGFD1AF&HY / R and YG / F&MoGFD1BR respectively through overlap extension PCR technology, the fragments AH and HB are introduced into the protoplast of Guy11 by using a polyethylene glycol-mediated genetic transformation method, and the clones are screened by using the hygromycin resistance; the primers are shown in SEQ ID NO. 4-SEQ ID NO. 11.

[0014] The application further provides the application of the Magnaporthe grisea MoGFD1 gene in reducing the pathogenicity of the Magnaporthe grisea.

[0015] Further, the application of reducing the pathogenicity is the application of reducing the pathogenicity of the Magnaporthe grisea to rice.

[0016] Specifically, the Magnaporthe grisea MoGFD1 gene is knocked out and replaced by a hygromycin resistance gene HPH, so that the pathogenicity of the Magnaporthe grisea is reduced.

[0017] The application has the following advantages: This invention is the first to discover a gene encoding glycerol dehydrogenase from rice blast fungus. MoGFD1 This gene can affect the growth, development, and pathogenicity of rice blast fungus. This invention uses molecular biology methods to verify... MoGFD1 Gene deletion can significantly affect the mycelial growth, spore and appressorium development, and pathogenic process of rice blast fungus. The present invention provides... MoGFD1 Genes play an important role in the pathogenicity of rice blast fungus and can provide important drug targets for the design and screening of targeted drugs for rice blast fungus. They also provide new ideas for further utilizing this gene to control rice blast and have certain practical applications.

[0018] This invention addresses the rice blast fungus. MoGFD1 The gene's physiological functions, including mycelial growth, conidia production, appressorium formation, and pathogenicity, were verified, confirming the use of the hygromycin resistance gene to replace the rice blast fungus. MoGFD1 The gene can significantly inhibit the growth, development, and pathogenicity of rice blast fungus, indicating that... MoGFD1 It is an important gene in the pathogenic process of rice blast fungus. The present invention provides... Figure 1 Genes and their applications provide a new option for the control of rice blast. Attached Figure Description

[0019] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0020] MoGFD1 for Figure 2 A diagram illustrating gene knockout.

[0021] MoGFD1 for Figure 3 Southern blot identification of gene knockout strains.

[0022] MoGFD1 for Figure 4 The gene knockout strain exhibits vegetative mycelial growth.

[0023] MoGFD1 for Figure 5 Spore morphology of gene knockout strains.

[0024] MoGFD1 for Figure 6 Appendage cell development of gene knockout strains.

[0025] MoGFD1 for MoGFD1 Pathogenicity of gene knockout strains. Detailed Implementation

[0026] The technical solutions of the present application will be described clearly and completely in combination with the drawings and specific embodiments. The specific conditions not mentioned in the embodiments are carried out according to the conventional conditions or the conditions suggested by the manufacturers. The reagents or instruments not mentioned by the manufacturers are all conventional products that can be purchased in the market.

[0027] Test strains and plants: The test strain is a wild type strain of Magnaporthe grisea Guy11, and the test rice is a susceptible variety CO39.

[0028] Preparation of related culture media and solutions: Complete medium (CM): sucrose 10 g / L, acid hydrolysis casein 6 g / L, yeast extract 6 g / L, agar powder 20 g / L (required for solid medium); Protoplast transformation medium (TB3): sucrose 200 g / L, acid hydrolysis casein 3 g / L, yeast extract 3 g / L, agar powder 12 g / L (required for solid medium); Spore production medium (rice bran): rice bran 40 g / L, agar powder 20 g / L (pH=6.0).

[0029] Example 1: Figure 1 Knockout method (1) Using the genomic DNA of the wild type strain Guy11 as a template, the upstream fragment A and the downstream fragment B of the target gene were amplified by primers MoGFD1AF & MoGFD1AR and MoGFD1BF & MoGFD1BR, respectively, and the N-terminal HY fragment and the C-terminal YG fragment of hygromycin were amplified by primers HYG / F & HY / R and YG / F & HYG / R, respectively. Through the overlapping extension PCR (SOE PCR) technology, the A and HY fragments and the B and YG fragments were fused by primers MoGFD1AF & HY / R and YG / F & MoGFD1BR, respectively. Mogfd1-1This method can reduce the non-target gene knockout transformants caused by ectopic insertion of HPH, compared with the method of fusing A fragment, HPH and B fragment. This is because the ectopic insertion of A-H-B fragment into any position can produce resistance, while neither AH nor HB fragment contains a complete HPH gene, and a complete HPH gene can only be formed by recombination. The AH fragment and the HB fragment are introduced into Guy11 protoplasts by PEG-mediated genetic transformation method, and the clones are screened by hygromycin resistance. PCR verification is performed using primers MoGFD1tF & MoGFD1tR and MoGFD1UAF & H853 to detect whether the open reading frame (ORF) of MoGFD1 in the hygromycin-resistant transformants has been replaced by the hygromycin resistance gene, and the positive transformants are further verified by Southern blot.

[0030] (2) Protoplast transformation method: Freshly grown mycelium of Magnaporthe grisea was cut into small pieces and inoculated into liquid CM medium and incubated at 28°C with 120 rpm shaking for 3-5 days. In a clean bench, most of the supernatant was discarded and the remaining small amount of culture solution and mycelium ball were transferred into a sterile mortar and ground into homogenate. An appropriate amount of homogenate was inoculated into fresh liquid CM medium and incubated at 28°C with 150 rpm shaking for 16-24 hours. The mycelium was collected by filtration with a sterile funnel and sterile double-layer gauze. The residual culture solution was washed clean with sterile water and the mycelium was washed thoroughly with 1 M sorbitol solution. The gauze was placed on a sterile filter paper stack with sterile forceps and pressed carefully to absorb the residual water. The dried mycelium was transferred into an appropriate amount of Lysing Enzymes from Trichoderma harzianum (final concentration 10 mg / mL, prepared with 1 M sorbitol, and filtered to remove bacteria) and the Lysing Enzymes solution was just enough to cover the mycelium. The mycelium was stirred carefully and lysed at 30°C with 60 rpm for 2-3 hours. The mycelium lysis was observed with a hemocytometer every hour during the lysis. The lysate was filtered through miracloth into a sterile and pre-cooled 50 mL centrifuge tube. The filter residue was washed once with 1 M sorbitol solution to elute the lysed protoplasts into the centrifuge tube. The supernatant was discarded carefully and the pellet was resuspended thoroughly with an appropriate amount of STC solution (1.2 M sorbitol, 50 mM Tris-HCl pH 8.0, 50 mM CaCl2, filtered to remove bacteria). The pellet was centrifuged at 4°C with 5000 rpm for 10 minutes, and the supernatant was discarded carefully. The pellet was resuspended with 1 mL of STC solution. The concentration of the protoplasts was observed with a hemocytometer under a microscope and adjusted to 5 x 107-8 cells / mL with STC solution. DMSO was added to a final concentration of 7% and mixed thoroughly. 200-250 μL of the protoplasts were taken with a sharp-end pipette tip and dispensed into a sterile centrifuge tube, which was stored at -80°C for later use.

[0031] The dispensed protoplasts were taken with a sharp-end pipette tip and added into a sterile 50 mL centrifuge tube. 2-10 μg of the PCR product or plasmid for transformation was added and mixed gently. The mixture was incubated on ice for 20 minutes. A total amount of 1-1.5 mL of 40% PTC solution (40% PEG 3350, 20% sucrose, 50 mM Tris-HCl pH 8.0, 50 mM CaCl2, dissolved by heating and filtered to remove bacteria) was added in two portions and mixed gently. The mixture was incubated on ice for 20 minutes. 5 mL of liquid TB3 medium was added and mixed gently. The tube was sealed with parafilm and fixed on a constant temperature shaker at an angle. The mixture was recovered at 28°C with 90 rpm overnight.

[0032] Dissolve TB3 medium, after cooling, add appropriate amount of desired antibiotic (final concentration of hygromycin 100 μg / mL, final concentration of neomycin 300 μg / mL), pour the medium containing antibiotic into the centrifuge tube containing the resuscitated bacteria solution, mix well by inverting, pour into a sterile culture dish; after the lower layer of medium solidifies completely, pour the upper layer of TB3 medium (final concentration of hygromycin 300 μg / mL, final concentration of neomycin 500 μg / mL) on it; after pouring, open the cover in the clean bench until the medium solidifies and there is no water vapor on the dish cover, seal with parafilm; invert and culture at 28°C for 7-10 days, some Magnaporthe colonies can be observed to grow to the upper layer of medium, pick these colonies and inoculate into starch yeast medium and culture at 28°C; use crude extraction method to extract the transformant DNA for PCR verification.

[0033] (3) Southern hybridization identification: Select the PCR verification results of the positive transformants D Mogfd1-2 and D Mogfd1-1 for Southern hybridization verification. The genomic DNA of Guy11 wild type strain and D Mogfd1-2 and D Figure 2 was digested with restriction endonuclease Hind III. Southern blot experiment was performed with A fragment of MoGFD1 gene as probe. The results showed that (Fig. 3) Mogfd1-1 ), the wild type strain Guy11 produced a band of about 3.5 kb, and two candidate mutant transformants produced a band of about 4.0 kb. The band size of wild type and mutant was the same as expected, indicating that the two candidate transformants detected were MoGFD1 gene knockout mutants.

[0034] (4) Primer sequences used: MoGFD1AF: TTTGGACAGTTGCCGCACAGT (SEQ ID NO. 4) MoGFD1AR: TTGACCTCCACTAGCTCCAGCCAAGCCTCTCGACGCCGTTGTTGAGCT (SEQ ID NO. 5) MoGFD1BF: GAATAGAGTAGATGCCGACCGCGGGTTCAAACATTGAAGTGCCCGACT (SEQ ID NO. 6) MoGFD1BR: GGAGACCACTGCCAAGCAGCT (SEQ ID NO. 7) HYG / F: GGCTTGGCTGGAGCTAGTGGAGGTCAA (SEQ ID NO. 8) HYG / R: AACCCGCGGTCGGCATCTACTCTATTC (SEQ ID NO. 9) YG / F: GATGTAGGAGGGCGTGGATATGTCCT (SEQ ID NO. 10) HY / R: GTATTGACCGATTCCTTGCGGTCCGAA (SEQ ID NO. 11) MoGFD1 UAF: AAACCAGCCAAGCAGCGAAAG (SEQ ID NO. 12) MoGFD1 tF: CCTCGACTGCGCGTGGTTCTA (SEQ ID NO. 13) MoGFD1 tR: AGCTCTTGGGCAGCACGACGT (SEQ ID NO. 14) H853: GACAGACGTCGCGGTGAGTT (SEQ ID NO. 15)

[0035] The mycelial plugs of wild type strain Guy11, D Mogfd1-2 and D Figure 3 were inoculated on CM medium and cultured in an inverted manner at 28°C for 7 days in a constant temperature incubator. The results are shown in Mogfd1-1 , D Mogfd1-2 and D Mogfd1-1 The colony diameters of the strains were significantly smaller than that of the wild type strain Guy11, indicating that MoGFD1 regulates the growth of the vegetative hyphae of M. oryzae.

[0036] The mycelial plugs of wild type strain Guy11, D Mogfd1-2 and D Figure 4 were inoculated on sporulation medium (rice bran) and cultured in an inverted manner at 28°C for 7 days in a constant temperature incubator. After the aerial hyphae were scraped off, they were cultured in a light incubator for 2 days to prepare a spore suspension, and the spore morphology was observed under a microscope. The results are shown in Mogfd1-1 , D Mogfd1- and D Mogfd1-1 2 The number of 1-septate and 0-septate spores produced by the strains was significantly higher than that of the wild type strain Guy11, indicating that MoGFD1 regulates the spore morphology of M. oryzae.

[0037] 10 mL of the wild type strain Guy11, D Mogfd1-2 and D Figure 5Conidial suspension of the strains were dropped onto hydrophobic coverslips and incubated at 28°C in the dark. The samples were taken at 4 h, 6 h and 8 h after incubation, and the formation of appressoria was observed under microscope. The results showed that (Fig. 1) Mogfd1-1 ), the appressorium formation rate of D Mogfd1-2 and D Mogfd1-1 was significantly lower than that of the wild type strain Guy11; there was no significant difference in the appressorium formation rate between the mutant strains and the wild type strain at 6 h and 8 h after induction. The above results showed that the deletion of MoGFD1 led to the delay of appressorium development of M. oryzae.

[0038] Conidial suspension of the wild type strain Guy11, D Mogfd1-2 , D Mogfd1-1 was inoculated onto the three-week-old susceptible rice variety CO39, respectively. Phenotype analysis was performed 7 days after inoculation. The results showed that the lesion produced by D Mogfd1-2 and D Figure 6 was significantly smaller than that of the wild type strain (Fig. 2) Mogfd1-1 Mogfd1-2 Mogfd1-1 Mogfd1-2 Mogfd1-1 Mogfd1-2 Figure 6 , indicating that MoGFD1 regulated the pathogenicity of M. oryzae.

[0039] Although the specific embodiments of the present application are described above, it should be understood by those skilled in the art that the specific examples described are only illustrative, and are not intended to limit the scope of the present application, and equivalent modifications and variations made by those skilled in the art in accordance with the spirit of the present application should be covered within the scope of the claims of the present application.

Claims

1. A rice blast fungus MoGFD1 Genes are characterized by: The rice blast fungus MoGFD1 The full-length sequence of the gene is shown in SEQ ID No. 1, the cDNA sequence is shown in SEQ ID No. 2, and the amino acid sequence encoding the protein is shown in SEQ ID No.

3.

2. The rice blast fungus as described in claim 1 MoGFD1 Application of genes in regulating the growth and development of rice blast fungus.

3. The application according to claim 2, characterized in that: The application is for rice blast fungus. MoGFD1 The role of genes in regulating the growth of vegetative mycelia of rice blast fungus.

4. The application according to claim 2, characterized in that: The application is for rice blast fungus. MoGFD1 Application of genes in the fractional spore development of rice blast fungus.

5. The application according to claim 2, characterized in that: The application is for rice blast fungus. MoGFD1 Application of genes in regulating spore morphology.

6. The application according to claim 2, characterized in that: The application is for rice blast fungus. MoGFD1 Application of genes in delayed appressorium development.

7. The application according to claim 2, characterized in that: Knockout of the rice blast fungus MoGFD1 The gene was replaced with the hygromycin resistance gene HPH to construct... MoGFD1 Gene knockout mutants, in turn, regulate the growth and development of rice blast fungus.

8. The application according to claim 7, characterized in that: The construction method is as follows: using wild-type strain Guy11 genomic DNA as a template, the upstream fragment A and downstream fragment B of the target gene are amplified using primers MoGFD1AF & MoGFD1AR and MoGFD1BF & MoGFD1BR, respectively. Then, the N-terminal HY fragment and C-terminal YG fragment of hygromycin are amplified using primers HYG / F & HY / R and YG / F & HYG / R, respectively. Using overlap extension PCR technology, the A and HY fragments and the B and YG fragments are fused using primers MoGFD1AF & HY / R and YG / F & MoGFD1BR, respectively. The AH and HB fragments are introduced into Guy11 protoplasts using polyethylene glycol-mediated genetic transformation. Clones are selected using hygromycin resistance. The primers involved are shown in SEQ ID NO.4-SEQ ID NO.

11.

9. The rice blast fungus as described in claim 1 MoGFD1 Application of genes in reducing the pathogenicity of rice blast fungus.

10. The application according to claim 9, characterized in that: The reduction of pathogenicity refers to its application in reducing the pathogenicity of rice blast fungus to rice.

Images