Recombinant expression plasmid of AHR2a and ARNT1 genes of subtropical estuary benthic fish mullet chubil and application of recombinant expression plasmid
By constructing a luciferase reporter gene system suitable for nearshore and estuarine fishes, and using recombinant expression plasmids of the AHR2a and ARNT1 genes of the mullet goby, the problem of insufficient ecological relevance in existing technologies has been solved, enabling high-throughput, high-sensitivity detection and early warning of dioxins and dioxin-like chemicals.
Patent Information
- Application Number
- CN202511407543.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-29
- Publication Date
- 2025-11-21
AI Technical Summary
Existing rodent-based AhR-based luciferase reporter gene methods lack ecological relevance when used for predicting the toxicity of aquatic organisms. They are difficult to accurately assess the response of native fish such as mullet goby to dioxins and dioxin-like chemicals, leading to uncertainty in assessing the ecological risk of DLCs.
A luciferase reporter gene system suitable for nearshore and estuarine fish was constructed. By using recombinant expression plasmids of the AHR2a and ARNT1 genes of the subtropical estuarine benthic fish *Mulletodon spp.* and combining them with a firefly luciferase reporter plasmid of the mouse CYP1A1 gene promoter, high-throughput and high-sensitivity environmental monitoring was achieved.
It enhances the detection of ecological relevance, can truly reflect the toxic effects of DLCs on target ecological species, fills the gap in molecular tools, and provides species-specific early warning technology for DLC pollution in coastal and estuarine areas.
Smart Images

Figure CN120989158A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of environmental toxicology, and in particular to a recombinant expression plasmid of the AHR2a and ARNT1 genes of the subtropical estuarine benthic fish, the goby, and its application. Background Technology
[0002] Dioxins and dioxin-like compounds (DLCs) mainly include polychlorinated dibenzo-dioxins (PCDDs), polychlorinated dibenzofurans (PCDFs), and some polychlorinated biphenyls (PCBs). They are a class of persistent organic pollutants that mediate toxic effects through the activation of aryl hydrocarbon receptors (AhRs). Due to their recalcitrant nature and the cumulative and amplified effects across the food chain, these substances pose a long-term threat to human health and other organisms. Their mechanism of action is as follows: after binding to cytoplasmic AhRs, DLCs are transported to the nucleus and form a complex with the aryl hydrocarbon receptor nuclear translocator (ARNT). This complex binds to the dioxin response element (DRE) in the promoter region of target genes, regulating the expression of genes such as CYP1A, and causing a series of intracellular toxic effects, including immunotoxicity, reproductive defects, teratogenicity, and endocrine toxicity. Given the high bioaccumulation and long-distance migration characteristics of DLCs, the development of efficient and eco-relevant detection technologies is crucial for environmental pollution early warning.
[0003] For the detection of DLCs, traditional chromatographic methods are the gold standard, but their complexity, high cost, and long turnaround time, coupled with their inability to reflect biotoxicity effects, limit their application in large-scale screening. Therefore, bioassays, particularly the luciferase reporter gene assay (CALUX) based on the AhR signaling pathway, have been gradually developed and applied due to their speed, simplicity, and ability to reflect sample toxicity. This method achieves semi-quantitative detection of DLCs by constructing a reporter gene plasmid containing the DRE promoter regulatory sequence and a stably transfected cell line.
[0004] However, existing rodent-based luciferase reporter gene methods using AhR (Aquatic Organism Toxicity Rating) lack ecological relevance when used for predicting the toxicity of aquatic organisms. Current research focuses primarily on model fish such as zebrafish or other freshwater fishes, lacking studies on estuarine fish (such as species within specific ecosystems). Due to interspecies differences in AhR gene structure and function, it is difficult to accurately assess the pollutant responses of native fish species, which may lead to uncertainty in assessing the ecological risk of DLCs (Dwelling Risk Capacities).
[0005] The native species *Mugilogobius chulae* is a representative benthic fish of subtropical estuaries and nearshore areas. It is a euryhaline, warm-water demersal fish that inhabits shallow coastal, estuarine, and intertidal zones. *Mugilogobius chulae* is characterized by its small size, transparent embryos, high reproductive rate, short reproductive cycle, ease of laboratory husbandry and management, and sensitivity to environmental pollutants. It is an ideal fish species for monitoring new pollution in estuaries and marine environments, playing an irreplaceable role compared to freshwater experimental fish. *Mugilogobius chulae* has been included in the recommended list of test organisms in the ecological and environmental standard "Technical Guidelines for Derivation of Water Quality Standards for Marine Organisms (Trial Implementation)". However, the function of the AhR gene in this species remains unresolved, and its AhR sequence characteristics, DRE binding efficiency, and pollutant response thresholds are still unclear. Summary of the Invention
[0006] The purpose of this invention is to provide a recombinant expression plasmid of the AHR2a and ARNT1 genes of the subtropical estuarine benthic fish *Mulletodon spp.* and its application, in order to solve the problems existing in the prior art. By utilizing the AHR2a and ARNT1 genes of the subtropical estuarine benthic fish *Mulletodon spp.*, a reporter gene plasmid suitable for nearshore and estuarine fish can be constructed, enabling high-throughput and high-sensitivity environmental monitoring and providing species-specific early warning technology for nearshore and estuarine DLC pollution.
[0007] To achieve the above objectives, the present invention provides the following solution:
[0008] This invention provides a recombinant expression plasmid for the AHR2a and ARNT1 genes of the subtropical estuarine benthic fish, the mullet goby. The recombinant expression plasmid is constructed by ligating the AHR2a and ARNT1 genes to an expression vector, respectively, to construct recombinant expression plasmid I and recombinant expression plasmid II. The nucleotide sequences of the AHR2a and ARNT1 genes are shown in SEQ ID NO.1-2, respectively.
[0009] The present invention also provides a luciferase reporter gene system, which includes the recombinant expression plasmid and a firefly luciferase reporter plasmid containing a mouse CYP1A1 gene promoter.
[0010] The present invention also provides a method for detecting dioxins and dioxin-like chemicals using the aforementioned luciferase reporter gene system, comprising the following steps:
[0011] (1) Mix the recombinant expression plasmid I, recombinant expression plasmid II, firefly luciferase reporter plasmid containing mouse CYP1A1 gene promoter, experimental control plasmid and single-stranded DNA to prepare transfection plasmid premix;
[0012] (2) Mix the premixed transfection plasmid solution prepared above with the transfection reagent and Opti-MEM, and incubate at room temperature for 15-20 min;
[0013] (3) Add the premixed solution from step (2) to a 96-well plate containing cultured cells and incubate at 37°C for 5 hours. Then add the disinfectant solution. After disinfection, continue to incubate the 96-well plate for 20 hours and then detect the Firefly and Renilla cold light values.
[0014] (4) The luciferase ratio was calculated based on the Firefly and Renilla cold light values to obtain the luciferase activity induced by the luciferase reporter gene, and then the content of dioxins and dioxin-like chemicals was determined.
[0015] Preferably, in step (1), the amounts of recombinant expression plasmid I, recombinant expression plasmid II, firefly luciferase reporter plasmid containing the mouse CYP1A1 gene promoter, experimental control plasmid, and single-stranded DNA added are 0.2-0.23 μL / well, 0.2-0.25 μL / well, 0.2-0.25 μL / well, 0.2-0.25 μL / well, and 0.2-0.25 μL / well, respectively.
[0016] Preferably, in step (2), the amount of transfection reagent and Opti-MEM added is 0.1-0.2 μL / well and 3-5 μL / well, respectively.
[0017] Preferably, in step (3), the contaminated liquid includes dioxins and dioxin-like chemicals or water bodies contaminated by dioxins and dioxin-like chemicals;
[0018] And / or the amount of the toxic solution added is 3-5 μL / well.
[0019] Preferably, a premix containing no firefly luciferase reporter plasmid is used as the reporter control, a premix containing no transfected DNA is used as the blank control, and TCDD is used as the positive control.
[0020] Preferably, in step (3), the cells include COS-7 cells, the amount of cells added is 70-75 μL of cell suspension, and the concentration of the cell suspension is 140,000 cells / mL;
[0021] Before adding the premixed solution, the COS-7 cells were cultured overnight at 37°C and 95% humidity in DMEM medium containing fetal bovine serum.
[0022] This invention also provides the use of the recombinant expression plasmid or the luciferase reporter gene system described herein in any of the following:
[0023] (1) Application in the detection of dioxins and dioxin-like chemicals;
[0024] (2) Application in detecting dioxin and dioxin-like chemical pollution in nearshore and estuarine waters.
[0025] The present invention discloses the following technical effects:
[0026] 1) Enhance the ecological relevance of detection: By measuring the dose effect of TCDD, clarify its activation ability on the AHR signaling pathway of the native species *Mulletus edulis*, and truly reflect the toxic effects of DLCs on the target ecological species, the subtropical estuarine benthic fish *Mulletus edulis*.
[0027] 2) Filling the gap in molecular tools: By utilizing the AHR2a and ARNT1 genes of the subtropical estuarine benthic fish *Mulletodon zhushouensis*, a luciferase reporter gene system suitable for nearshore and estuarine fish will be developed; and the luciferase reporter gene system will be used to comprehensively characterize the toxicity of complex environmental wastewater, and the sensitivity and specificity of the *Mulletodon zhushouensis* AHR2a and ARNT1 subtype-dependent reporter gene system will be evaluated, providing a theoretical basis for supporting high-throughput and high-sensitivity environmental monitoring.
[0028] 3) Optimize risk assessment models: provide species-specific early warning technologies for DLC pollution in coastal and estuarine areas. Attached Figure Description
[0029] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0030] Figure 1 Gel image of vector digestion; M: DL5000 Ladder; 1: pCDNA3.1(+); 2 / 3: double-digested vector pCDNA3.1(+) / BamHI, EcoRI;
[0031] Figure 2 Gel images of the target genes AHR2a and ARNT1 for cloning; from left to right: AHR2a, ARNT1, and DNA Marker;
[0032] Figure 3 Maps of pCDNA3.1(+)-AHR2a and pCDNA3.1(+)-ARNT1 plasmids;
[0033] Figure 4The dose-response curve of luciferase activity induced by TCDD in COS-7 cells transfected with recombinant expression plasmids of AHR2a and ARNT1 genes from the Chinese mullet goby.
[0034] Figure 5 This is a dose-response curve showing the luciferase activity induced in COS-7 cells transfected with recombinant expression plasmids of AHR2a and ARNT1 genes from environmental samples. Detailed Implementation
[0035] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0036] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0037] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0038] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This specification and embodiments are merely exemplary.
[0039] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0040] Example 1
[0041] 1. Constructing the pCDNA3.1(+)-AHR2a plasmid
[0042] 1.1 Target gene synthesis: Obtain the AHR2a gene fragment.
[0043] (1) Template: AHR2a sequence was amplified using cDNA from the brain of the mullet goby as a template.
[0044] (2) Amplification primers:
[0045] Upstream primer (5'-3'): ATGTTGGGAAACCCGGGGACGTACGCG (SEQ ID NO.3);
[0046] Downstream primer (5'-3'): TCATATATTGCATGGTGTTGCATTA (SEQ ID NO.4).
[0047] (3) Amplification conditions
[0048] The composition of the PCR reaction solution is shown in Table 1 below.
[0049] Table 1. Composition of PCR reaction solution (50 μL system)
[0050] Components Usage Final concentration PrimeSTAR HS (Premix) 25μL 1× upstream primer 10-15 pmol 0.2-0.3μM Downstream primer 10-15 pmol 0.2-0.3μM cDNA template <200ng Sterilized water Add to 50μL Total volume 50μL
[0051] PCR reaction conditions: 98℃ for 10 seconds, 55℃ for 5 seconds, 72℃ for 3 minutes, 30 cycles.
[0052] (4) Sample purification, recovery, and sequencing
[0053] Electrophoresis results are shown below Figure 2 The target DNA band was recovered using an agarose gel extraction kit, and the product was precipitated with ethanol and then detected by a sequencer.
[0054] The amplified AHR2a CDS sequence (SEQ ID NO.1) is shown below:
[0055]
[0056] 1.2 Ligation and Transformation: First, the pCDNA3.1(+) vector was digested with BamHI and EcoRI, and then the digested pCDNA3.1(+) vector (see...) Figure 1 The gene fragment was ligated with the AHR2a gene and then transformed into Top10 competent E. coli cells.
[0057] 1.3 Screening and Validation: Transformed *E. coli* were plated on antibiotic-containing plates and incubated upside down for 12-14 hours. Bacteria were picked for PCR identification. Plasmids were extracted from positive colonies, and the recombinant plasmid was identified by enzyme digestion. Positive clones were sequenced. After successful sequencing alignment, the plasmid was extracted to obtain the constructed recombinant expression plasmid pCDNA3.1(+)-AHR2a. (See...) Figure 3 .
[0058] (1) The colony PCR identification system (20 μL) is shown in Table 2 below.
[0059] Table 2 Colony PCR Identification System
[0060] Components Usage template 1μL upstream primer 1μL Downstream primer 1μL 2×mix 10μL
[0061] PCR reaction conditions: 94℃ for 150s; 94℃ for 150s, 60℃ for 150s, 72℃ for 180s, 20 cycles; 72℃ for 5 min.
[0062] (2) Primers are:
[0063] F: 5'-ATCCGCCACCATGTTGGGGAACCCGGGGACGTACGCGAACAAGAAG-3' (SEQ ID NO.5);
[0064] R: 5'-CTCGAGCGGCCGCCACTGTGCTGGATATCTGCAGAATTCTCATATATTGCATGGTGTTG-3' (SEQ ID NO. 6).
[0065] 2. Constructing the pCDNA3.1(+)-ARNT1 plasmid
[0066] 2.1 Target gene synthesis: Obtain the ARNT1 gene fragment.
[0067] 2.1.1 Template: The ARNT1 sequence was amplified using cDNA from the liver of the Chinese mullet goby as a template.
[0068] 2.1.2 Primers
[0069] (1) Connector primers:
[0070] 5'adaptor GCTGTCAACGATACGCTACGTAACGGCATGACAGTGGGIIGGGIIGGGIIG (SEQ ID NO. 7); (I: represents deoxyinosine, a synthetic nucleotide analog designed in primers to increase compatibility with the target sequence and reduce the risk of primer dimerization).
[0071] 5.3'outer: GCTGTCAACGATACGGCTACGTAAC(SEQ ID NO.8);
[0072] 5.3'inner: GCTACGTAACGGCATGACAGTG (SEQ ID NO. 9).
[0073] (2) Primers for intermediate sequence amplification:
[0074] RC1100-C-N1F: ATGGGGCGAGTGGGACC (SEQ ID NO. 10);
[0075] RC1100-C-N1F': AACATCTGTCCTGCCGAGTGC (SEQ ID NO. 11);
[0076] RC1100-C-N1R: TCCGTTCTGACGAGAAATCTGAG (SEQ ID NO. 12);
[0077] Nested PCR was used to extract the intermediate sequence CN1.
[0078] RC1100-C-P2F: ACAGCAAGAGCCTGGAGAAGAC (SEQ ID NO. 13);
[0079] RC1100-C-P2R:TCACTCATTAAATGAAGAGTACATGGGA (SEQ ID NO. 14).
[0080] (3) 5'RACE reverse transcription primers and specific primers:
[0081] RC1100-C-RT1: TTGCTCTCGCAGTTTCCGGT (SEQ ID NO. 15);
[0082] RC1100-C-RT2:GTTCAGGACGGGAATGATAGAGT (SEQ ID NO. 16);
[0083] RC1100-C-R2: TTCGATCTCGCTGTGGTTCTCT (SEQ ID NO. 17);
[0084] RC1100-C-R3: TTATCATGTTGGAGCCTGAAGTG (SEQ ID NO. 18).
[0085] 2.2 Amplification of intermediate sequences
[0086] (1) The PCR reaction system is shown in Table 3 below.
[0087] Table 3 Intermediate sequence PCR reaction system
[0088] Components volume F(10μM) 0.5μL R(10μM) 0.5μL Taq SuperMix 13.5μL cDNA template 1 μL (cDNA) Nuclease-free water Add to 20μL Total volume 20μL
[0089] (2) The PCR cycling conditions are shown in Table 4 below.
[0090] Table 4 Intermediate Sequence PCR Cycling Conditions
[0091] program temperature time Pre-variation 95℃ 3min transsexual 94℃ 30s annealing 58℃ 30s extend 72℃ 90s Repair and extension 72℃ 7min Cycle number (mutation, annealing, extension) 33 cycles
[0092] 2.35' RACE
[0093] 2.3.1 Adding C to the end of cDNA
[0094] The cDNA obtained by reverse transcription using 5'RACE reverse transcription primers was processed as follows: RNase H digestion, cDNA purification and recovery, and TdT C-tailing.
[0095] 2.3.2 Nested PCR Reaction System
[0096] (1) The PCR reaction system is shown in Table 5 below.
[0097] Table 5 Nested PCR reaction system
[0098] Components First round (μL) Second round (μL) F(10μM) 0.5 (RC1100-C-R2) 0.5 (RC1100-C-R3) R(10μM) 0.5 (5' adapter) 0.5 (5.3'outer) cDNA template 0.5 (cDNA) 0.5 (first round PCR dilution product) Taq SuperMix 13.5 13.5 Nuclease-free water Added to 20 Added to 20 Total volume 20 20
[0099] (2) The PCR cycling conditions are shown in Table 6 below.
[0100] Table 6 PCR Cycling Conditions
[0101]
[0102] Note: *1: The first 10 cycles are landing PCR, with a temperature drop of 1℃ per cycle; *2: The extension time is set at 1kb / min.
[0103] Electrophoresis was used to detect the amplification products, and the results were as follows: Figure 2 As shown.
[0104] 3. Cloning and sequencing
[0105] 3.1 Conversion of Linkage Products
[0106] The competent cells (SK2301) were prepared, and the transformation steps are as follows:
[0107] 1) Place 100 μL of competent cells on ice, and after complete thawing, gently suspend the cells evenly.
[0108] 2) Add 10 μL of ligation solution and mix gently. Incubate on ice for 30 min.
[0109] 3) Heat shock in a 42℃ water bath for 60 seconds. Place on ice for 10–15 minutes.
[0110] 4) Add 400 μL of LB medium and incubate at 37℃ with shaking at 200-250 rpm for 1 h.
[0111] 5) Centrifuge at 4000 rpm for 5 min at room temperature, remove 400 μL of supernatant with a pipette tip, and suspend the cells with the remaining culture medium.
[0112] 6) Spread the bacteria on ampicillin plates pre-spread with 20 μL of 100 mM IPTG and 100 μL of 20 mg / mL X-gal, and incubate upside down overnight.
[0113] 3.2 Colony PCR and Sequencing
[0114] Colony PCR was performed using universal primers on the pMD18-T vector [M13+(-47): agggttttcccagtcacg (SEQ ID NO.19); M13-(-48): gagcggataacaatttcacac (SEQ ID NO.20)].
[0115] (1) The PCR reaction system is shown in Table 7 below.
[0116] Table 7 Colony PCR Reaction System
[0117] Components volume 10×Taq Buffer 2.5μL M13+(10μM) 0.5μL M13-(10μM) 0.5μL dNTPs (10mM) 0.5μL <![CDATA[ddH2O]]> 19.8μL Template 1μL Taq enzyme (5 U / μL) 0.2μL Total volume 25μL
[0118] (2) The PCR cycling conditions are shown in Table 8 below.
[0119] Table 8. Cycling conditions for colony PCR
[0120]
[0121] The amplified ARNT1 CDS sequence (SEQ ID NO.2) is shown below:
[0122]
[0123] 3.3 Connection Conversion
[0124] First, the pCDNA3.1(+) vector was digested with BamHI and EcoRI, and then the digested pCDNA3.1(+) vector (see...) Figure 1 The ARNT1 gene fragment was ligated with an enzyme and then transformed into Top10 competent E. coli cells.
[0125] 3.4 Screening and Validation
[0126] Transformed *E. coli* were plated on antibiotic-containing plates and incubated upside down for 12-14 hours. Bacteria were picked for PCR identification. Plasmids were extracted from positive colonies, and the recombinant plasmid was identified by enzyme digestion. Positive clones were sequenced. After successful sequencing alignment, the plasmid was extracted to obtain the constructed recombinant expression plasmid pCDNA3.1(+)-ARNT1. (See below) Figure 3 .
[0127] 1) The colony PCR identification system (20 μL) is shown in Table 9 below.
[0128] Table 9 Colony PCR Identification System
[0129] Components Usage template 1μL upstream primer 1μL Downstream primer 1μL 2×mix 10μL
[0130] PCR reaction conditions: 94℃ for 150s; 94℃ for 150s, 60℃ for 150s, 72℃ for 135s, 20 cycles; 72℃ for 5 min.
[0131] 2) Primers:
[0132] F: 5'-ATCCGCCACCATGTTATTCCACTCGGATATGTCTTCATCAAACCCCGATTTAC-3' (SEQ ID NO. 21);
[0133] R: 5'-CTCGAGCGGCCGCCACTGTGCTGGATATCTGCAGAATTCTCACTCATTAAATGAAGAGT-3' (SEQ ID NO. 22).
[0134] Example 2: Construction and Application of Luciferase Reporter Gene
[0135] I. Culture medium preparation
[0136] 1. Preparation of DMEM medium for cell culture in luciferase reporter gene assay (LRG)
[0137] Add 50 mL of heat-inactivated fetal bovine serum (Gibco), 5 mL of 100× non-essential amino acid solution (Gibco), and 5 mL of 100× penicillin-streptomycin solution (Gibco) to 500 mL of pre-prepared DMEM medium (Gibco).
[0138] 2. Preparation of CS-DMEM medium used in LRG
[0139] (1) Measure 950 mL of distilled water with a graduated cylinder, pour it into a 1 L beaker, add a clean stir bar, and place it on a magnetic stirrer.
[0140] (2) Take out the DMEM bag of powder (Gibco), and tap the top of the bag before opening to remove any powder from the top.
[0141] (3) After opening the bag, pour the powder into the beaker and turn on the magnetic stirrer to stir gently.
[0142] (4) Rinse the bag several times with distilled water and pour it into a beaker.
[0143] (5) Add 3.7g NaHCO3 and distilled water to make up to 1L.
[0144] (6) Continue stirring until the powder is completely melted.
[0145] (7) Adjust the pH of the culture medium to 6.8 using a pH meter (Sarto ius, Model PB-11).
[0146] (8) Add 25g of dextran-coated charcoal (Sima-Aldrich) to each 50mL Corning centrifuge tube.
[0147] (9) Add the pH-adjusted culture medium to the centrifuge tube and mix thoroughly. Incubate at 37°C with shaking (30 rpm) for 1 hour.
[0148] (10) Centrifuge at 2000g at 21℃ for 20min. During centrifugation, wipe the clean bench with 70% alcohol and sterilize with ultraviolet light for 20min.
[0149] (11) After centrifugation, carefully remove the centrifuge tube to prevent disturbing the charcoal inside. Spray with 70% alcohol to sterilize, and then carefully place it in the laminar flow hood.
[0150] (12) Use a 0.22μm Steritop bottle top filter (Millipore, USA) for sterilization. Do not transfer the charcoal into the filter along with the CS-DMEM.
[0151] (13) Add 5 mL of penicillin / streptomycin (Gibco) and 50 mL of charcoal-treated fetal bovine serum (CS-FBS, Charcoal Stripped Fetal Bovine Serum; HyClone Laboratories, Logan, UT) to 500 mL of filtered CS-DMEM. Wrap the bottle with aluminum foil to protect it from light and store it in a refrigerator at 4°C until use.
[0152] II. Exposure concentrations of TCDD and environmental sample solutions
[0153] TCDD exposure concentrations: 0.01, 0.05, 0.1, 0.5, 1, 5, 10, 50, 100, 300 (nM).
[0154] Exposure concentration factors for environmental samples: 0.01, 0.1, 1, 10, 50, 100 REF.
[0155] III. Luciferase Reporter Gene Assay
[0156] 1. Seed board
[0157] (1) Open the biosafety cabinet and place the necessary items (Thermo electronic pipettes, Eppendorf pipettes and multi-channel pipettes of various sizes, Axygen sterile enzyme-free pipette tips, Corning 96-well plates (Costar 3610; NY, Corning), Corning disposable sterile pipettes, disposable sterile sample trays (Santa Cruz Biotechnology, Santa Cruz, CA), waste container, etc.) into the biosafety cabinet. Turn on the UV sterilization for 30 minutes. At the same time, melt 1× trypsin (Gibco) in a 37°C water bath and equilibrate COS-7 cell culture DMEM and CS-DMEM to 37°C.
[0158] (2) Remove the cell culture flask from the cell culture incubator, tilt the flask and remove the old cell culture DMEM from the far corner and discard it, being careful not to touch the bottom of the cell culture flask.
[0159] (3) Add 4 mL of phosphate buffered saline (PBS; HyClone) along the side wall of the cell culture flask. Do not add PBS directly to the cells. Gently shake the flask to cover the entire bottom surface of the cell culture flask. Tilt the flask and aspirate the PBS from the far corner and discard it.
[0160] (4) Repeat the previous step.
[0161] (5) Add 2 mL of 1× trypsin directly to the bottom cells, gently shake to cover all cells with trypsin, incubate at 37°C for 5 min in a cell culture incubator, remove and tap the side wall of the culture flask, then put it back into the incubator and incubate for another 5 min to allow all cells to be digested from the bottom of the culture flask.
[0162] (6) Add 6 mL of cell culture DMEM to each cell culture flask, rinse the bottom twice and pipette 5 times, then transfer the cell suspension to the same 50 mL sterile centrifuge tube (Corning), and pipette about 50 times to separate all the cells and form a single cell suspension.
[0163] (7) Centrifuge at 2000×g for 5 min at room temperature, aspirate and discard the DMEM supernatant, and do not disturb the bottom cells.
[0164] (8) Turn off the lights in the biosafety cabinet.
[0165] (9) If the cell coverage in the cell culture flask is 100%, then the cells in one cell culture flask are enough to seed 4 96-well plates. Based on the cell coverage, roughly estimate the volume of CS-DMEM required to reach 140,000 cells / mL. First, add 1 / 4 of the required amount, pipette to completely suspend the cells, count them using a hemocytometer, calculate and add the remaining CS-DMEM to reach the above cell concentration, pipette evenly, and then add 75 μL of cell suspension to the 96-well plate. After it has all settled to the bottom, observe to ensure that the coverage is 30-40%.
[0166] (10) After adjusting to meet the cell concentration requirements, transfer the cell suspension to a disposable sterile sample loading tank and use a pipette to transfer 75 μL of cell suspension into each well of the 96-well cell culture plate. Before each transfer, blow the cell suspension in the sample loading tank once to ensure that it is uniform.
[0167] (11) Place the 96-well cell culture plate in a Memmert carbon dioxide cell culture incubator overnight (37°C, 95% humidity).
[0168] 2. Instantaneous transfection
[0169] (1) Plasmids for transfection
[0170] Recombinant expression plasmids of AHR2a and ARNT1 in the Chinese mullet gargoyle.
[0171] The firefly luciferase reporter plasmid pGudLuc6.1 containing the mouse CYP1A1 gene promoter was donated by Professor Zhang Rui of Jinan University.
[0172] The experimental control pRL-CMV plasmid was purchased from Promega.
[0173] (2) Transfection process
[0174] ① Open the biosafety cabinet, put in the necessary items, and turn on the ultraviolet sterilization for 30 minutes.
[0175] ② Place the DNA stock solution for the experiment on ice until it thaws, and then dilute it to the working concentration in a biosafety cabinet: AHR2a—35 ng / μL; ARNT1—6.2 ng / μL; CYP1A1—30 ng / μL; pRL-CMV—12 ng / μL; ss-DNA—100 ng / μL (purchased from MedChemExpress).
[0176] ③ Refer to Table 10 to prepare the premixed solution for transfection plasmids. Scale up the reaction system proportionally to the number of wells to be transfected, and prepare an extra 10-20% for each tube to prevent insufficient solution due to sample loading errors.
[0177] Table 10 Formulation of premixed solution for transfection plasmids
[0178]
[0179] ④ Prepare two control groups: one is called the reporter control, which does not contain AHR2a and ARNT1 in the transfection mixture, and is used to detect background values. Refer to Table 11 for preparation. The other is a blank control that does not contain any transfected DNA. Similarly, scale up the reaction system proportionally to the number of wells to be transfected, and prepare an extra 10-20% for each tube to prevent insufficient solution due to sample loading errors.
[0180] Table 11 Reporter's Comparison of Premixed Liquid Formulations
[0181]
[0182] ⑤ Prepare corresponding volumes of FuGENE DNA transfection reagent and Opti-MEM premixes for each tube of DNA premix: 0.2 μL FuGENE / well and 5 μL Opti-MEM / well. Scale up the reaction system proportionally to the number of wells to be transfected, preparing an extra 10-20% to prevent insufficient solution due to loading errors. When preparing, add FuGENE directly to the Opti-MEM, invert and gently tap to mix, then incubate at room temperature for 5 minutes.
[0183] ⑥ Add the above FuGENE DNA transfection reagent and Opti-MEM premix to the corresponding DNA premix, invert and gently tap to mix, then incubate at room temperature for 15 min.
[0184] ⑦ Except for the blank control, use a BIOHIT eLINE continuous pipette to add 6 μL of the above transfection mixture to each well of the 96-well plate, gently shake the 96-well plate to distribute the transfection mixture evenly, and label the plasmid information on the 96-well plate cap.
[0185] ⑧ After incubating the 96-well plate at 37°C for 5 hours in a carbon dioxide cell culture incubator, the plate was then exposed to the virus.
[0186] 3. Drug use
[0187] Following the layout in Table 12, 5 μL of the prepared DMSO solution was added to each well of the 96-well plate, with a final concentration of 0.5%. After DMSO treatment, the 96-well plates were incubated in a CO2 cell culture incubator for 20 hours before analysis. Four technical replicates were performed on each plate, for a total of three plates as biological replicates.
[0188] Table 12 LRG Test 96-well Plate with Toxic Cloth
[0189] BG DMSO L(1) -2 -3 -4 -5 -6 -7 -8 H(9) PC BG DMSO L(1) -2 -3 -4 -5 -6 -7 -8 H(9) PC BG DMSO L(1) -2 -3 -4 -5 -6 -7 -8 H(9) PC BG DMSO L(1) -2 -3 -4 -5 -6 -7 -8 H(9) PC Reporter Reporter Reporter Reporter
[0190] Note: BG: Background; DMSO: Dimethyl sulfoxide; L: Minimum exposure concentration; H: Maximum exposure concentration; PC: Positive control (300 nM TCDD); Reporter: Reporter control; 1-9 indicate the concentration of the exposed solution increases sequentially.
[0191] 4. Firefly and Renilla cold light detection
[0192] (1) One hour before testing, Promega Dual-Glo TM (Luciferase Assay System) Remove from -80°C freezer. Place Luciferase Buffer in a beaker containing room temperature water and allow to thaw at room temperature. Add this to the brown bottle containing Luciferase Substrate. After the Luciferase Substrate is completely dissolved, aliquot into 9 mL portions (Luciferase Reagent). Stop and... Also dispense into equal 9mL portions.
[0193] (2) Remove the 96-well plate from the incubator and allow it to equilibrate to room temperature for 5-10 minutes.
[0194] (3) In a fume hood, pour the required volume of Luciferase Reagent into a disposable sample container, add 85 μL to each well using a multi-channel pipette, and gently tap the side of the plate to mix.
[0195] (4) Cover the 96-well plate with tin foil to protect it from light, place it on a horizontal shaker (Grant-bio) and incubate at room temperature for 20 minutes. Detect the Firefly cold light using a Synergy H4 Hybrid microplate reader (Bio-Tek) or a LuminoSkan Ascent microplate reader (ThermoFisher).
[0196] (5) Add approximately 9 mL / plate of Stop& Pour into another new disposable sample container and add 90 μL of Top& Shake and mix well to form Stop& Add 85 μL of Top& to a 96-well plate that has already been tested for Firefly light using a hot air gun. And gently pat the side of the board to mix it.
[0197] (6) Cover the 96-well plate with aluminum foil to protect it from light, place it on a horizontal shaker (Grant-bio) and incubate at room temperature for 20 minutes. Detect Renilla cold light on a Synergy H4 Hybrid microplate reader (Bio-Tek) or a LuminoSkan Ascent microplate reader (ThermoFisher).
[0198] (7) The remaining pre-packaged Luciferase Reagent, Stop& and Stop& Store in a -20°C refrigerator until the next use.
[0199] IV. Data Collection and Analysis
[0200] Luciferase ratio calculation:
[0201] (1) In the Excel worksheet, calculate the arithmetic mean of the background controls, and subtract this background average from all cool light values.
[0202] (2) The initial luciferase ratio is obtained by dividing the blank-corrected Firefly value by the blank-corrected Renilla value.
[0203] (3) Calculate the arithmetic mean of the initial luciferase ratios of the DMSO exposed wells. Subtract this mean from all initial luciferase ratios to obtain the standardized luciferase ratios.
[0204] (4) Calculate the arithmetic mean of the luciferase ratio of the standardized positive control (300 nM TCDD) to eliminate errors caused by inter-plate differences, transfection efficiency differences, pipetting volume differences, and minor cytotoxicity. Next, divide all standardized luciferase ratios by the average of this positive control according to OECD Guideline 455 to obtain the reporter gene induction activity value expressed as a percentage of the TCDD positive control induction effect.
[0205] V. Results and Analysis
[0206] like Figure 4 As shown, in COS-7 cells transfected with recombinant expression plasmids of the AHR2a and ARNT1 genes from *Mulletodon spp.*, TCDD-induced luciferase activity reached a plateau. Overall, this indicates that a 300 nM concentration of TCDD is reasonable as a positive control for LRG assay standardization. A dose-response relationship exists between luciferase activity and TCDD; higher TCDD concentrations result in stronger luciferase activity. The luciferase activity induced by TCDD in COS-7 cells transfected with *Mulletodon spp.* AHR2a and ARNT1 expression plasmids was measured in EC50 cells. 50 The value was 2.14 nM. The results indicate that the recombinant expression plasmids of the AHR2a and ARNT1 genes constructed in this invention for *Mulletoia zhuyi* and *Goblinus spp.* can detect TCDD-mediated cytotoxicity through activation of the aromatic hydrocarbon receptor (AHR) and can detect low concentrations of the contaminant.
[0207] pass Figure 5 It was found that exposure to different concentrations of water samples increased luciferase activity, and a dose-response relationship existed between luciferase activity and water sample concentration. The LOEC value of the induced luciferase activity was 100REF. Although the luciferase activity of the water sample with the highest concentration did not reach 50%, the EC value predicted by the four-parameter model was [missing value]. 50 The value was 134.5 REF. The results indicate that the recombinant expression plasmids of AHR2a and ARNT1 genes constructed in this invention for *Mulletoia zhuyis* and *Goblinus spp.* can detect AHR-related cytotoxicity in actual water bodies.
[0208] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A recombinant expression plasmid of AHR2a and ARNT1 genes in the subtropical estuarine benthic fish *Mulletodon spp.*, characterized in that... The recombinant expression plasmids are constructed by ligating the AHR2a and ARNT1 genes to the expression vector, respectively, to construct recombinant expression plasmid I and recombinant expression plasmid II, wherein the nucleotide sequences of the AHR2a and ARNT1 genes are shown in SEQ ID NO.1-2, respectively.
2. A luciferase reporter gene system, characterized in that, It includes the recombinant expression plasmid as described in claim 1 and the firefly luciferase reporter plasmid containing the mouse CYP1A1 gene promoter.
3. A method for detecting dioxins and dioxin-like chemicals using the luciferase reporter gene system according to claim 2, characterized in that, Includes the following steps: (1) Mix the recombinant expression plasmid I, recombinant expression plasmid II, firefly luciferase reporter plasmid containing mouse CYP1A1 gene promoter, experimental control plasmid and single-stranded DNA to prepare transfection plasmid premix; (2) Mix the premixed transfection plasmid solution prepared above with the transfection reagent and Opti-MEM, and incubate at room temperature for 15-20 min; (3) Add the premixed solution from step (2) to a 96-well plate containing cultured cells and incubate at 37°C for 5 hours. Then add the disinfectant solution. After disinfection, continue to incubate the 96-well plate for 20 hours and then detect the Firefly and Renilla cold light values. (4) The luciferase ratio was calculated based on the Firefly and Renilla cold light values to obtain the luciferase activity induced by the luciferase reporter gene, and then the content of dioxins and dioxin-like chemicals was determined.
4. The method as described in claim 3, characterized in that, In step (1), the amounts of recombinant expression plasmid I, recombinant expression plasmid II, firefly luciferase reporter plasmid containing mouse CYP1A1 gene promoter, experimental control plasmid, and single-stranded DNA added are 0.2-0.23 μL / well, 0.2-0.25 μL / well, 0.2-0.25 μL / well, 0.2-0.25 μL / well, and 0.2-0.25 μL / well, respectively.
5. The method as described in claim 3, characterized in that, In step (2), the amount of transfection reagent and Opti-MEM added is 0.1-0.2 μL / well and 3-5 μL / well, respectively.
6. The method as described in claim 3, characterized in that, In step (3), the contaminated liquid includes dioxins and dioxin-like chemicals or water bodies contaminated by dioxins and dioxin-like chemicals; And / or the amount of the toxic solution added is 3-5 μL / well.
7. The method as described in claim 3, characterized in that, A premix containing no firefly luciferase reporter plasmid was used as a reporter control, a premix containing no transfected DNA was used as a blank control, and TCDD was used as a positive control.
8. The method as described in claim 3, characterized in that, In step (3), the cells include COS-7 cells, the amount of cells added is 70-75 μL of cell suspension, and the concentration of the cell suspension is 140,000 cells / mL; Before adding the premixed solution, the COS-7 cells were cultured overnight at 37°C and 95% humidity in DMEM medium containing fetal bovine serum.
9. The use of the recombinant expression plasmid as described in claim 1 or the luciferase reporter gene system as described in claim 2 in any of the following: (1) Application in the detection of dioxins and dioxin-like chemicals; (2) Application in detecting dioxin and dioxin-like chemical pollution in nearshore and estuarine waters.