Primer, TaqMan probe and kit for carrying out fluorescent PCR (Polymerase Chain Reaction) detection on bovine-derived ureaplasma
By designing specific primers and combining them with TaqMan probes and fluorescent PCR technology, the problems of speed and accuracy in detecting bovine ureaplasma have been solved, achieving highly sensitive detection of bovine ureaplasma and supporting bovine health management and disease control.
Patent Information
- Application Number
- CN202511442888.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-10
- Publication Date
- 2025-11-21
AI Technical Summary
Existing technologies make it difficult to detect bovine ureaplasma quickly and accurately, which leads to difficulties in the diagnosis and control of reproductive and respiratory diseases in cattle, affecting the reproductive efficiency and calf survival rate of cattle.
This invention provides primers, TaqMan probes, and a kit for the fluorescent PCR detection of bovine ureaplasma, including specific upstream and downstream primers and TaqMan probes labeled with fluorescent reporter and quencher groups. The kit is used in conjunction with fluorescent PCR technology for detection and is equipped with positive and negative controls and standards. Quantitative and qualitative analysis is achieved through a standard curve.
It enables rapid and highly sensitive detection of bovine ureaplasma, accurately determining the presence of bovine ureaplasma in samples, supporting investigations into the main prevalence of pathogens, disease eradication, and quality monitoring, thus ensuring the health of cattle herds.
Smart Images

Figure CN120989274A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of animal disease detection technology, and more specifically to primers, TaqMan probes and kits for fluorescent PCR detection of bovine ureaplasma. Background Technology
[0002] Ureaplasma diversum, belonging to the class Mollusca, order Mycoplasma, family Mycoplasmatidae, family Ureaplasmatidae, and genus Ureaplasma, was first isolated from tissue specimens of the vagina, urethra, and bladder wall of dairy cows in 1967. It is primarily transmitted through direct contact, such as during mating and calving, and can also be indirectly transmitted through contaminated instruments. In most cases, Ureaplasma diversum remains latent in healthy cattle. When the herd's immunity is weakened (e.g., due to stress, malnutrition, or secondary diseases), it can cause clinical symptoms, leading to bovine reproductive tract diseases (such as vaginitis, endometritis, and abortion in cows, and urethritis and orchitis in bulls) and respiratory diseases (calf pneumonia). In severe cases, it can affect herd reproductive efficiency and calf survival rates. Therefore, rapid detection of Ureaplasma diversum has significant public health and economic importance.
[0003] With the development of molecular biology diagnostic technology, TaqMan real-time quantitative PCR technology has been widely used in the field of pathogen detection. Compared with ordinary PCR technology, it has the advantages of accurate quantification, high specificity, good repeatability and high sensitivity. It can also amplify efficiently and in high throughput, avoid false negative results, and reduce environmental pollution and chemical hazards to laboratory personnel caused by high concentrations of PCR products.
[0004] Therefore, providing primers, TaqMan probes, and kits for fluorescent PCR detection of bovine ureaplasma is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention
[0005] In view of this, the present invention provides primers, TaqMan probes, and a kit for fluorescent PCR detection of bovine ureaplasma.
[0006] The quantitative real-time PCR detection method for bovine ureaplasma established in this invention aims to provide technical assistance for the rapid detection and quantification of pathogens, as well as the inspection and quarantine of livestock and poultry products and the identification of biological products. It will also play an important role in the vaccine production process.
[0007] To achieve the above objectives, the present invention adopts the following technical solution:
[0008] A primer and TaqMan probe for fluorescent PCR detection of bovine ureaplasma, wherein the primer comprises an upstream primer U.diversum-F3 and a downstream primer U.diversum-R3 for detecting bovine ureaplasma; the nucleotide sequence of the upstream primer U.diversum-F3 is shown in SED ID NO.7, and the nucleotide sequence of the downstream primer U.diversum-R3 is shown in SED ID NO.8;
[0009] The TaqMan probe is a probe U.diversum-P3 for detecting bovine ureaplasma, and its nucleotide sequence is shown in SED ID NO.9. The 5' end of the TaqMan probe is labeled with a fluorescent reporter group, the 3' end is labeled with a fluorescent quencher group, and the 3' end of the TaqMan probe has been phosphorylated.
[0010] In some embodiments, the 5' end of the TaqMan probe is labeled with a fluorescent reporter group, the 3' end is labeled with a fluorescent quencher group, and the 3' end of the TaqMan probe has been phosphorylated; optionally, the fluorescent reporter group is selected from FAM, HEX, JOE, TET, CY3, CY5, ROX, Texas; the fluorescent quencher group is selected from TAMRA, BHQ (BHQ1, BHQ2, BHQ3), MGB, DABCYL.
[0011] Furthermore, a kit for fluorescent PCR detection of bovine ureaplasma includes the aforementioned primers and TaqMan probe.
[0012] In some embodiments, the kit further includes a positive control and a negative control, wherein the positive control is a recombinant plasmid containing the bovine ureaplasma uvrC gene; and the negative control is a component that does not contain bovine ureaplasma or its genomic DNA, such as DEPC-treated water (double-distilled water, deionized water, etc.).
[0013] In some embodiments, the kit further includes a standard, which is a recombinant plasmid containing the bovine ureaplasma uvrC gene, at a concentration selected from 1 × 10⁻⁶. 10 1×10 9 1×10 8 1×10 7 and 1×10 6 copies / μL.
[0014] Furthermore, a method for detecting bovine ureaplasma via fluorescent PCR for non-disease diagnosis and treatment purposes includes the following steps:
[0015] (1) Extract genomic DNA from the sample to be tested, and use the extracted genomic DNA as a template to perform fluorescent PCR detection under the guidance of the primers and TaqMan probes mentioned above;
[0016] (2) The obtained Ct value and the specific amplification curve were used to perform qualitative detection of bovine ureaplasma.
[0017] In some embodiments, the fluorescent PCR detection system described in step (1) comprises: 12.5 μl Hieff Unicon Universal TaqMan mμltiplex qPCR mastermix, 10 μM U.
[0018] 31 μl of diversum-F, 31 μl of 10 μM U. diversum-R, 0.5 μl of 10 μmol / L U. diversum-P, 5 μl of template, and DEPC-treated water to bring the total to 25 μl.
[0019] In some implementations, the conditions for fluorescence PCR detection in step (1) are: pre-denaturation at 95°C for 5 minutes; PCR amplification at 95°C for 15 seconds, extension at 60°C for 30 seconds, for 45 cycles.
[0020] In some embodiments, the method for plotting the standard curve in step (2) includes the following operation: diluting the bovine ureaplasma standard by a 10-fold gradient to a concentration of 1×10⁻⁶. 7 1×10 6 1×10 5 1×10 4 1×10 3 1×10 2 1×10 1 Copies / μL were used to obtain standard samples of different concentrations. Using the standard samples of different concentrations as templates, fluorescent PCR detection was performed under the guidance of the primers and TaqMan probes described in claim 1 or 2. After the detection, the concentration Log value (X-axis) of each standard sample was plotted against its corresponding Ct value (Y-axis) to obtain a standard curve.
[0021] In some implementations, the criteria for qualitative determination in step (2) are:
[0022] If the sample to be tested shows a specific amplification curve and the Ct value is ≤38, the result is determined to be positive for bovine ureaplasma nucleic acid.
[0023] If a specific amplification curve appears in the sample to be tested, and 38 < Ct value ≤ 40, the result is considered suspicious for bovine ureaplasma nucleic acid and a retest is required; if the suspicious sample is positive or suspicious after retesting, the result is considered positive, otherwise it is considered negative.
[0024] If the sample to be tested has no Ct value or no specific amplification curve, the result is determined to be negative for bovine ureaplasma nucleic acid.
[0025] In some implementations, the sample to be tested includes clinical samples, raw materials for vaccine production, vaccine semi-finished products, and finished products.
[0026] As can be seen from the above technical solution, compared with the prior art, this invention discloses primers, TaqMan probes, and a kit for fluorescent PCR detection of bovine ureaplasma. This enables rapid and highly sensitive detection of bovine ureaplasma, providing strong evidence for investigating the main prevalence of the pathogen, eradicating diseases, screening strains, and monitoring quality, effectively preventing and controlling the occurrence of diseases. The kit and detection method of this invention are simple to operate, highly specific, highly sensitive, and have good repeatability. They can achieve qualitative detection of bovine ureaplasma and will play an important role in the accurate detection of bovine ureaplasma in clinical diagnostic samples or cultures, as well as in the early technical support for vaccine manufacturing (non-diagnostic applications), showing broad application prospects. Attached Figure Description
[0027] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.
[0028] Figure 1 The results show the screening of primers and probes for fluorescent PCR of bovine ureaplasma; A, B, and C are primers and probes from groups 1, 2, and 3, respectively.
[0029] Figure 2 The results of constructing the standard curve for bovine ureaplasma fluorescence PCR are shown in Figure A; where Figure A shows the detection standard 1×10 7 -1×10 1 Figure B shows the amplification curve of copies / μL; Figure B shows the detection standard 1×10 7 -1×10 1 Standard curve of copies / μL.
[0030] Figure 3 This is a curve showing the amplification of bovine ureaplasma via fluorescent PCR at the lowest detection limit.
[0031] Figure 4 This is a specific amplification curve for the fluorescent PCR detection of bovine ureaplasma.
[0032] Figure 5This is a repeatable amplification curve for the fluorescent PCR detection of bovine ureaplasma. Detailed Implementation
[0033] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0034] Unless otherwise specified, the methods used in the following examples are conventional methods. For specific steps, please refer to: Molecular Cloning: A Laboratory Manual (Sambrook, J., Russell, David W., 3rd edition, 2001, NY, Cold Spring Harbor).
[0035] The primers and probes used were all synthesized using existing techniques.
[0036] Example 1: Primer and probe design for fluorescent PCR detection of bovine ureaplasma
[0037] 1.1. Strains
[0038] The bovine ureaplasma isolated from clinical swab samples from diseased cattle farms used in the examples were transported to Jinyu Baoling Biopharmaceutical Co., Ltd. for preservation after approval through the procedures for transporting highly pathogenic microorganisms.
[0039] 1.2 Extraction of genomic DNA
[0040] Using Axyprep TM The Body FluidViral DNA / DNA Miniprep Kit (AXYGEN) was used to extract nucleic acids from inactivated samples provided by Jinyu Baoling Biopharmaceutical Co., Ltd. The extracted nucleic acids were stored at -20℃ for later use.
[0041] 1.3 Primer and probe design and screening
[0042] The nucleotide reference sequence of the bovine ureaplasma uvrC gene was obtained from the NCBI nucleic acid database GenBank (http: / / www.ncbi.nlm.nih.gov). Its specific conserved region was determined. Based on the primer and TaqMan probe design principles, multiple sets of fluorescent PCR primers and TaqMan probes for detecting bovine ureaplasma were designed. Table 1 below lists three sets of primers and probes for detecting bovine ureaplasma (as shown in Group 1, Group 2, and Group 3 in Table 1). To prevent extension during PCR amplification, the 3' end of the probes was phosphorylated.
[0043] The bovine ureaplasma nucleic acid extracted by method 1.2 was serially diluted 10-1. 1 10 2 10 3 10 4 10 5 Five dilutions of nucleic acid were amplified by fluorescent PCR using three sets of primers and probes. Figure 1 The results of fluorescent PCR using primers and probes in groups AC are shown in Figure 1-3. By comparing the Ct values, curve morphology, and fluorescence intensity of different primer and probe groups for the same template, group 3 was determined to be the most suitable. Figure 1 The primers and probes in section C) are PCR primers and TaqMan probes that can be used for highly sensitive detection of bovine ureaplasma.
[0044] Table 1: Primer and Probe Information
[0045]
[0046] The TaqMan probe (U. diversum-P) is labeled with the fluorescent reporter group CY5 at its 5' end and the fluorescent quencher group BHQ2 at its 3' end.
[0047] Example 2: Fluorescent PCR Detection Method for Bovine Ureaplasma
[0048] 2.1 Extraction of genomic DNA
[0049] Nucleic acid was extracted from bovine ureaplasma infection samples using the AxyPrep Bacterial Genomic DNA Mini-Preparation Kit (Corning Life Sciences (Wujiang) Co., Ltd.). For tissue samples, an appropriate amount was added to PBS buffer and mixed, then thoroughly ground in a mortar and pestle. The tissue suspension was transferred to a sterile centrifuge tube, centrifuged, and the supernatant was extracted to obtain nucleic acid. For swab samples from the mouth, nose, and anus, the samples were soaked in PBS buffer, centrifuged, and the supernatant was extracted to obtain nucleic acid.
[0050] 2.2 Establishment of the standard curve
[0051] 2.2.1 PCR amplification of target sequences
[0052] Using the upstream primer U. diversum-F3 and downstream primer U. diversum-R3 from Table 1 of Example 1 above, the bovine ureaplasma genomic DNA extracted in Method 2.1 was amplified by PCR to obtain the bovine ureaplasma target gene fragment. The PCR reaction system is shown in Table 2 below. The PCR reaction conditions were: pre-denaturation at 95℃ for 5 min; PCR amplification at 95℃ for 30 s, 55℃ for 30 s, and 72℃ for 30 s, for 35 cycles; final extension at 72℃ for 7 min.
[0053] Table 2: PCR reaction system for bovine ureaplasma
[0054]
[0055] 2.2.2 Preparation of Standards
[0056] The bovine ureaplasma target gene fragment (as shown in SEQ ID NO. 10) obtained in step 2.2.1 above was purified and recovered, and ligated into the pMD19-T vector (purchased from TakaRa) to construct a recombinant plasmid by targeting the EcoR V recognition site. This plasmid was then transformed into JM109 competent cells (purchased from TakaRa) for cloning, and positive recombinant plasmids were screened and sent to Sangon Biotech (Beijing) Co., Ltd. for sequencing. After confirming the correct sequencing sequence, the recombinant plasmid pMD19-T-uvrC carrying the bovine ureaplasma target gene was obtained. The concentration was determined using an ultra-micro nucleic acid protein analyzer, calculated according to the formula: "copies / μl = (6.02 × 10⁻⁶) / μl". 23 (copies / mol × concentration ng / μl) / (DNA bases × 660 × 10) 9 The copy number of the plasmid was calculated using the formula "ng / mol", and then diluted to 1×10⁻⁶ with TE buffer. 10 copies / μl or lower dilution (e.g., 1×10⁻⁶) 9 1×10 8 1×10 7 1×10 6 Copies / μL, etc., are used as standards for bovine ureaplasma and should be stored below -15°C.
[0057] The target gene fragment of bovine ureaplasma:
[0058] AAGCAATTATGCAACTATGT ATTCAAAATGCAATTGATCATTATCGAGTTAATATTAATGCTTTTATTCAAAGGCAAACTAATCATGCAATTGCATTAGCTAGTTTAGCTAAGATTTGTAAAGTAGATAATTTAGACTTAATTGAATGTTTTGATAATTCAAACATTAATTTACAATTT CCAGTTGCAGGGATGATTGG ; SEQ ID NO.10.
[0059] 2.2.3 Establishment of the Standard Curve
[0060] The bovine ureaplasma standard prepared in step 2.2.2 above was serially diluted 10-fold to 1×10⁻⁶. 1 copies / μl, take 1×10 7 1×10 6 1×10 5 1×10 4 1×10 3 1×10 2 1×10 1 A dilution buffer of copies / μL was used as a standard sample (template) for fluorescence PCR detection guided by the primers and TaqMan probe from group 3 in Example 1. The fluorescence PCR reaction system included: 12.5 μL HieffUnicon Universal TaqMan mμltiplex qPCR mastermix, 1 μL each of forward and reverse primers (10 μmol / L), 0.5 μL of probe (10 μmol / L), 5 μL of template, and DEPC-treated water to a final volume of 25 μL. The fluorescence PCR reaction conditions were: pre-denaturation: 95℃ for 5 min; PCR amplification conditions: 95℃ for 15 s, 60℃ for 30 s, 45 cycles. The real-time fluorescence PCR detection results of the bovine ureaplasma standard sample are as follows: Figure 2 As shown in AB, where Figure 2 In the middle, A represents the amplification curve, corresponding to 1×10 from left to right. 7 1×10 6 1×10 5 1×10 4 1×10 3 1×10 2 1×10 1 The standard samples were in copies / μL. It can be seen that the amplification curves of the standard samples at each concentration were all smooth "S"-shaped and the curve shape was good. Figure 2 In section B, a standard curve is plotted by comparing the concentration Log values (X-axis) of each standard sample with their corresponding Ct values (Y-axis). The correlation coefficient R of the curve is... 2 =0.999, the amplification efficiency E is 95.92%, and the linear equation is y = -3.42X + 39.71, which meets the requirements. Therefore, the standard curve can be used for quantitative detection of bovine ureaplasma by fluorescent PCR.
[0061] 2.3 Fluorescent PCR Amplification
[0062] The extracted genomic DNA of the sample to be tested was used as a template, an appropriate concentration of bovine ureaplasma standard sample was used as a positive control, and DEPC-treated water was used as a negative control. The sample to be tested was judged based on the real-time fluorescence PCR detection results, and the copy number of bovine ureaplasma nucleic acid positive samples was quantified.
[0063] The specific testing method includes the following steps:
[0064] (1) Using genomic DNA extracted from the sample as a template, fluorescent PCR was performed under the guidance of the primers and probes in group 3 of Table 1. The 25 μL fluorescent PCR detection system included: 12.5 μL HieffUnicon Universal TaqMan mμltiplexqPCR mastermix, 1 μL each of upstream and downstream primers (10 μmol / L), 0.5 μL of probe (10 μmol / L), 5 μL of template, and DEPC-treated water to a final volume of 25 μL. The reaction conditions for fluorescent PCR were: pre-denaturation, 95℃ for 5 min; PCR amplification conditions, 95℃ for 15 s, 60℃ for 30 s, for 45 cycles. Fluorescence signal was detected at the end of each annealing cycle.
[0065] (2) The obtained Ct value and the specific amplification curve are used to achieve qualitative detection of bovine ureaplasma. Then, according to the standard curve generated by method 2.2.3, the copy number of bovine ureaplasma nucleic acid contained in the sample to be tested is obtained to achieve accurate quantification.
[0066] 2.4 Result Judgment
[0067] (1) If the sample to be tested shows a specific amplification curve in the fluorescence channel and the Ct value is ≤38, the result is determined to be positive for bovine ureaplasma nucleic acid.
[0068] (2) If the sample to be tested shows a specific amplification curve in the fluorescence channel and 38 < Ct value ≤ 40, the result is judged as suspicious; if the suspicious sample is positive or suspicious after retesting, the result is judged as positive, otherwise it is negative.
[0069] (3) If the sample to be tested has no Ct value or no specific amplification curve, the result is determined to be negative for bovine ureaplasma nucleic acid.
[0070] Example 3: Evaluation of the fluorescent PCR detection method for bovine ureaplasma
[0071] 3.1 Minimum Detection Limit
[0072] The standard sample with a concentration of 10 copies / μL was further diluted to 5 copies / μL and 1 copy / μL using TE buffer. These three concentrations of standard samples were used as templates, and 20 replicates were performed each under the guidance of the primers and TaqMan probes in group 3 of Example 1. The fluorescence PCR reaction system and reaction conditions were as described in step 2.2.3 of Example 2 to evaluate the lower limit of detection of this method.
[0073] Test results as follows Figure 3 As shown in Table 3 below, the fluorescent PCR method provided by this invention showed specific amplification curves in all 20 repeated detections of a standard sample with a concentration of 10 copies / μL, and the Ct value was ≤38, indicating a positive result for bovine ureaplasma nucleic acid. Therefore, the lower limit of detection of this method can be confirmed to be 10 copies / μL. Table 3 also shows that the detection rate of the method of this invention for a standard sample with a concentration of 5 copies / μL was 17 / 20 (85%), and the detection rate for a standard sample with a concentration of 1 copy / μL was 10 / 20 (50%), further demonstrating the high sensitivity of the bovine ureaplasma fluorescent PCR detection method provided by this invention.
[0074] Table 3: Results of Limit of Detection (LOD) for Bovine Ureaplasma Fluorescent PCR
[0075]
[0076] 3.2 Specificity Detection
[0077] Genomic DNA was extracted from inactivated Mycoplasma bovis (Mb), Mycoplasma hyopneumoniae (Mhp), Mycoplasma hyopneumoniae (Mhr), Mycoplasma bovigenitalium (M. bovigenitalium), and Ureaplasma bovis (U. diversum) provided by Jinyu Baoling Biopharmaceutical Co., Ltd. DEPC-treated water was used as a negative control. Fluorescent PCR was performed under the guidance of the primers and probes shown in group 3 of Example 1. The PCR reaction system and reaction conditions were as described in method 2.2.3 of Example 2.
[0078] Specific test results such as Figure 4 As shown, only *Ureaplasma bovis* exhibited a specific amplification curve with a Ct value of 24.68, indicating a positive result for *Ureaplasma bovis* nucleic acid. Other samples did not show specific amplification curves or Ct values, indicating a negative result for *Ureaplasma bovis* nucleic acid. The results demonstrate that the method of this invention can specifically detect *Ureaplasma bovis*, showing no cross-reactivity with the other five pathogens, exhibiting high specificity.
[0079] 3.3 Repeatability Test
[0080] The concentration used in Example 2 was 1×104 1×10 3 1×10 2 1×10 1 Using standard samples of copies / μL as templates, three replicates of fluorescent PCR were performed for each sample. The reaction system and conditions were as described in Method 2.2.3 of Example 2. The mean, standard deviation, and coefficient of variation of the Ct value for each template were calculated to analyze and evaluate the reproducibility of the method.
[0081] Test results as follows Figure 5 As shown in Table 4 below, the amplification curves of the same concentration of standard sample were relatively clustered after three repeated detections, and there was no significant difference in the number of cycles. The coefficient of variation (CV) of the number of cycles for different concentrations of standard sample was less than 2%, indicating that the fluorescent PCR method for detecting bovine ureaplasma provided by this invention has good repeatability.
[0082] Table 4: Results of repeatable detection of bovine ureaplasma by fluorescent PCR
[0083]
[0084] Example 4: Bovine Ureaplasma Fluorescent PCR Detection Kit
[0085] The fluorescent PCR detection kit for bovine ureaplasma provided in this embodiment includes:
[0086] (1) Primers and probes: The primers (U.diversum-F3, U.diversum-R3) and TaqMan probe (U.diversum-P3) shown in Group 3 of Example 1 for fluorescent PCR detection of bovine ureaplasma.
[0087] For ease of detection, the fluorescent PCR detection kit for bovine ureaplasma provided in this embodiment may further include:
[0088] (2) Fluorescent PCR premix: For example, the premix for a 25 μL fluorescent PCR detection system contains: 12.5 μL HieffUnicon Universal TaqMan multiplex qPCRmastermix, 11 μL 10 μM U.diversum-F, 11 μL 10 μM U.diversum-R, 0.5 μL 10 μmol / L U.diversum-P, and 5 μL DEPC-treated water.
[0089] (3) Controls: For ease of detection, the kit may also include positive and negative controls. The positive control may be a recombinant plasmid pMD19-T-uvrC containing the U. diversum target gene, such as that prepared in Example 2 above. The negative control is a reaction system that does not contain bovine ureaplasma or its genomic DNA, such as DEPC-treated water (double-distilled water, sterile deionized water, etc.).
[0090] (4) Standard: Recombinant plasmid containing the bovine ureaplasma uvrC gene, with a concentration selected from 1×10⁻⁶. 10 1×10 9 1×10 8 1×10 7 and 1×10 6 copies / μL.
[0091] (5) Instructions for use: For ease of detection, the kit may also include the instructions obtained in Example 2, which may include the PCR reaction procedure: pre-denaturation, 95℃ for 5 min; PCR amplification conditions, 95℃ for 15 s, 60℃ for 30 s, 45 cycles. Fluorescence signal detection is performed at the end of the annealing at the end of each cycle.
[0092] Example 5: Detection of Bovine Ureaplasma Fluorescent PCR in Clinical Samples
[0093] The kit used in Example 4 (where the 25 μL fluorescence PCR detection system included: Hieff Unicon Universal TaqMan mμltiplex qPCR mastermix 12.5 μl, 10 μM U) was used.
[0094] The kit consisted of 31.0 μL of *U. diversum*-F, 31.0 μL of 10 μM *U. diversum*-R, 0.5 μL of 10 μM *U. diversum*-P, and 5 μL of template, brought to a total of 25 μL using DEPC-treated water. Eighty-three clinical samples provided by the National Engineering Laboratory of Jinyu Baoling Biopharmaceutical Co., Ltd. (sample numbers 1-83) were tested. The results are shown in Table 5 below. Ten samples were positive for *U. diversum* nucleic acid, one sample was questionable for *U. diversum* nucleic acid, and 72 samples were negative for *U. diversum* nucleic acid. This demonstrates that the fluorescent PCR detection kit for *U. diversum* provided by this invention can detect clinical samples and provides a strong basis for screening raw material strains and quality control in subsequent production processes.
[0095] Table 5: Results of fluorescence PCR detection of bovine ureaplasma in 83 clinical samples
[0096]
[0097]
[0098] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. Primers and a TaqMan probe for fluorescent PCR detection of bovine ureaplasma, characterized in that, The primers include an upstream primer U.diversum-F3 and a downstream primer U.diversum-R3 for detecting bovine ureaplasma; the nucleotide sequence of the upstream primer U.diversum-F3 is shown in SED ID NO.7, and the nucleotide sequence of the downstream primer U.diversum-R3 is shown in SED ID NO.8; The TaqMan probe is a probe U.diversum-P3 for detecting bovine ureaplasma, and its nucleotide sequence is shown in SEDID NO.
9. The 5' end of the TaqMan probe is labeled with a fluorescent reporter group, the 3' end is labeled with a fluorescent quencher group, and the 3' end of the TaqMan probe has been phosphorylated.
2. The primers and TaqMan probe for fluorescent PCR detection of bovine ureaplasma according to claim 1, characterized in that, The fluorescent reporter group is selected from FAM, HEX, JOE, TET, CY3, CY5, ROX or Texas; the fluorescent quencher group is selected from TAMRA, BHQ, MGB or DABCYL, and the BHQ is BHQ1, BHQ2 or BHQ3.
3. A kit for fluorescent PCR detection of bovine ureaplasma, characterized in that, The kit includes the primers and TaqMan probes as described in claim 1 or 2.
4. The reagent kit according to claim 3, characterized in that, The kit also includes a positive control and a negative control; the positive control is a recombinant plasmid containing the bovine ureaplasma uvrC gene; the negative control is DEPC-treated water, double-distilled water, or deionized water.
5. The kit according to claim 3 or 4, characterized in that, The kit also includes a standard, which is a recombinant plasmid containing the bovine ureaplasma uvrC gene, at a concentration selected from 1×10⁻⁶. 10 1×10 9 1×10 8 1×10 7 and 1×10 6 copies / μL.
6. A method for fluorescent PCR detection of bovine ureaplasma for non-disease diagnosis and treatment purposes, characterized in that, Includes the following steps: (1) Extract genomic DNA from the sample to be tested, and use the extracted genomic DNA as a template to perform fluorescent PCR detection under the guidance of the primers and TaqMan probes described in claim 1 or 2; (2) Use the obtained Ct value and the specific amplification curve to perform qualitative detection of bovine ureaplasma, and / or calculate the copy number of bovine ureaplasma in the sample to be tested based on the standard curve and the obtained Ct value to achieve quantitative detection.
7. The method according to claim 6, characterized in that, The fluorescence PCR detection system described in step (1) includes: 12.5 μl HieffUnicon Universal TaqManmμltiplex qPCRmastermix, 31 μl 10 μM U.diversum-F, 31 μl 10 μM U.diversum-R, 0.5 μl 10 μmol / L U.diversum-P, 5 μl template, and DEPC-treated water to bring the total volume to 25 μl. The conditions for the fluorescent PCR detection described in step (1) are: pre-denaturation at 95℃ for 5 minutes; PCR amplification: denaturation at 95°C for 15 seconds, extension at 60°C for 30 seconds, 45 cycles.
8. The method according to claim 6 or 7, characterized in that, The method for plotting the standard curve in step (2) includes the following operations: diluting the bovine ureaplasma standard by a 10-fold gradient to a concentration of 1×10⁻⁶. 7 1×10 6 1×10 5 1×10 4 1×10 3 1×10 2 1×10 1 Copies / μL were used to obtain standard samples of different concentrations. Using the standard samples of different concentrations as templates, fluorescent PCR detection was performed under the guidance of the primers and TaqMan probes described in claim 1 or 2. After the detection, the concentration Log value of each standard sample was used as the X-axis and its corresponding Ct value was used as the Y-axis to plot the standard curve.
9. The method according to claim 8, characterized in that, The criteria for qualitative judgment in step (2) are as follows: If the sample to be tested shows a specific amplification curve and the Ct value is ≤38, the result is determined to be positive for bovine ureaplasma nucleic acid. If a specific amplification curve appears in the sample to be tested, and 38 < Ct value ≤ 40, the result is considered suspicious for bovine ureaplasma nucleic acid and a retest is required; if the suspicious sample is positive or suspicious after retesting, the result is considered positive, otherwise it is considered negative. If the sample to be tested has no Ct value or no specific amplification curve, the result is determined to be negative for bovine ureaplasma nucleic acid.
10. The method according to claim 9, characterized in that, The samples to be tested include clinical samples, raw materials used in vaccine production, and vaccine semi-finished and finished products.