Respiratory pathogen detection multiplex amplification system and kit

Abstract

The invention belongs to the technical field of molecular detection, and particularly relates to a respiratory tract pathogen detection kit based on capillary electrophoresis and application of the respiratory tract pathogen detection kit, the kit can detect common pathogens which are possibly infected by respiratory tract patients and cannot be detected and determined through a conventional technology or a kit, and the kit at least has the technical advantages of being high in sensitivity and specificity.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of molecular detection, and particularly relates to a multiplex fluorescence amplification combined with capillary electrophoresis amplification detection technology. BACKGROUND

[0002] Respiratory tract infection (RTI) is one of the most common types of human infectious diseases, and is also a common and frequently-occurring disease in clinic, accounting for about 30%-40% of infectious diseases. Respiratory tract infection is mainly caused by pathogenic microorganisms invading and proliferating in the respiratory tract, and can be divided into upper respiratory tract infection (URI) and lower respiratory tract infection (LRI) according to the infection site. Upper respiratory tract infection mainly includes common cold, rhinitis, pharyngitis and laryngitis, and lower respiratory tract infection mainly includes tracheitis, bronchitis and pneumonia. Generally speaking, upper respiratory tract infection is mainly caused by viruses, accounting for 70%-80%, and lower respiratory tract pathogens are more complex, with viruses as the main pathogens in developed countries, and bacteria as the main pathogens in developing countries. Domestic research reports show that the bacterial detection rate of lower respiratory tract infection in children is as high as 82.5%.

[0003] It is very important to identify the pathogen of respiratory tract infection in the early stage, but the specific diagnosis still needs to rely on laboratory diagnosis because of the few specific clinical symptoms after pathogen infection. However, the traditional detection of pathogens often uses culture method and immunodetection method, which is time-consuming, complicated, low in sensitivity, and most of the children have applied antibiotics before sampling, thereby further reducing the positive rate of pathogen detection, and cannot meet the requirement of rapid diagnosis. With the intervention of molecular biology method, it is possible to detect pathogenic bacteria in the early stage, and accurate result information can be obtained without waiting for a long time, which avoids the abuse of antibiotics and has important significance.

[0004] In addition, the common detection in clinic on the market is mostly for the detection of common pathogenic bacteria of respiratory tract infection, and a considerable part of patients cannot be simply and effectively detected, and need to take higher-cost, more-complicated-operation and longer-time NGS technology platform for detection. Such pathogenic bacteria include bacteria, viruses and fungi, and relative to the limitations of the above detection technologies, an urgent need exists for a supplementary detection means for detecting such infections.

[0005] In view of this, the present application is proposed.

[0006] CONTENT

[0007] To solve the problems in the above-mentioned technologies, the application provides an amplification system for detection of rare respiratory pathogens and a kit thereof, so as to make up for the defects that the existing detection products cannot detect and are time-consuming and laborious. The system has the detection characteristics of simple operation, timeliness, high specificity, high sensitivity, high throughput, high reliability and low cost.

[0008] Specifically, the technical scheme of the application is as follows:

[0009] The application first provides an amplification system or primer combination for detection of respiratory pathogens based on capillary electrophoresis. The primer combination is directed to respiratory pathogenic bacteria and respiratory pathogenic fungi.

[0010] Further, the respiratory pathogens include respiratory pathogenic bacteria (Bordetella pertussis, Citrobacter freundii, Moraxella catarrhalis, Enterobacter cloacae, Bordetella parapertussis, Streptococcus agalactiae, Streptococcus pyogenes, Proteus vulgaris, Acinetobacter baumannii, Mycobacterium tuberculosis, Proteus mirabilis) and respiratory pathogenic fungi (Aspergillus flavus, Aspergillus fumigatus, Pneumocystis jirovecii, Cryptococcus gattii and Cryptococcus neoformans).

[0011] Further, the detection system contains 11 pairs of specific detection primers for bacteria, and the specific sequences are as follows:

[0012]

[0013]

[0014] Further, the detection system contains 5 pairs of specific detection primers for fungi, and the specific sequences are as follows:

[0015]

[0016] Among them, R, S and Y are all degenerate bases, which represent G / A, C / G and C / T respectively.

[0017] In particular, the detection system contains specific detection primers for each target pathogenic bacteria, and also contains universal detection primers for bacteria and fungi.

[0018] The specific sequences of the universal detection primers are as follows:

[0019] Bacterial universal upstream detection primer: AGAGTTTGATCMTGGCTCAG (SEQ ID 33);

[0020] Bacterial universal downstream detection primer: ATGCCTCCCGTAGGAGTYTG (SEQ ID 34);

[0021] Fungal universal upstream detection primer: ACTTGGTCATTTAGAGGAAGT (SEQ ID 35);

[0022] Fungal universal downstream detection primer: GCTGCGTTCTTCATCGAYGY (SEQ ID 36);

[0023] Wherein, the M is a merger base, representing C / A.

[0024] Further, the amplification system comprises a quality control gene of human origin in addition to the specific detection primers for bacteria and fungi and the universal detection primers, and the detection primer sequences are as follows:

[0025] Human internal reference gene 1 upstream detection primer: ATCAGCTACTTTCCTGCAATGAGG (SEQ ID 37);

[0026] Human internal reference gene 1 downstream detection primer: ATTGTACCCTTGGAGTCCAGATC (SEQ ID 38);

[0027] Human internal reference gene 2 upstream detection primer: ATGGTGGGCATGGGTCAGACG (SEQ ID 39);

[0028] Human internal reference gene 2 downstream detection primer: ATGTCGTCCCAGTTGGTGACG (SEQ ID 40).

[0029] In some specific ways, the target-specific primers, the internal reference primers, and the universal primers are 2:1:1.

[0030] Further, the pathogenic bacteria and the quality control internal reference are respectively labeled with two colors of fluorescence, which are a FAM fluorescent group labeled with FAM fluorescent and a HEX fluorescent group labeled with HEX fluorescent.

[0031] The FAM fluorescent group comprises human internal reference gene 1, 11 kinds of bacteria, and bacterial universal detection primers.

[0032] The HEX fluorescent group comprises human internal reference gene 2, 5 kinds of fungi, and fungal universal detection primers.

[0033] Further, the detection adopts capillary electrophoresis detection, and the amplification method adopts a multiplex fluorescent PCR (MF-PCR) amplification technology.

[0034] The application also provides a composite amplification detection product (preferably a kit) for respiratory tract pathogen detection, which comprises any of the above-mentioned amplification systems or primer combinations.

[0035] Further, the kit further comprises the following components: hot start Taq DNA polymerase, UDG enzyme and 2x PCR amplification buffer, quality control, nuclease-free water and internal standard (QD550h), etc.

[0036] The detection kit described in the application adopts the method of multiplex fluorescent PCR (MF-PCR) to amplify the target, and then detects the amplification product through capillary electrophoresis, that is, the technology of multiplex fluorescent fragment analysis, to complete the detection of the clinical sample.

[0037] The application also provides a method for detecting respiratory pathogens, comprising the steps of amplifying the sample by using the amplification system or primer combination described above; or detecting the sample by using the kit described above.

[0038] Specifically, the method comprises the following steps: sample processing and extraction of genomic DNA, preparation of a PCR system, PCR amplification using the aforementioned primer combination, detection of the amplification product by a genetic analyzer, data analysis, and interpretation of the detection results.

[0039] Compared with the prior art, the application has at least the following advantages:

[0040] The application covers rare bacteria and fungi in respiratory infections, covers a large number of targets for detection, can early detect pathogens that cannot be detected by conventional kits, and can be used as a supplementary means for detection in cases where conventional detection means / kits cannot detect, but the patient may have a very rare pathogenic infection. The universal detection primer of the pathogenic bacteria and the human internal reference gene detection primer are also added in the system of the application, which can determine whether the sample is taken and whether there is an infection.

[0041] The application optimizes the primer sequence system of the high-repetition system, and finally establishes a primer system based on capillary electrophoresis detection. Through experiments and clinical sample verification, the application has high detection sensitivity, strong specificity, and can detect and determine as low as 100 copies of infection, which has obvious clinical significance. BRIEF DESCRIPTION OF DRAWINGS

[0042] In order to more clearly illustrate the specific embodiments of the application or the technical solutions in the prior art, the following will briefly introduce the drawings needed to be used in the description of the specific embodiments or the prior art. Obviously, the drawings described below are some embodiments of the application, and those skilled in the art can also obtain other drawings according to these drawings without creative labor.

[0043] Figure 1 , the test results of the preliminary design of the pathogenic bacteria primer mixture;

[0044] Figure 2 , Enterobacter cloacae primer specificity test results; wherein, Figure 2 A is CE test primer results; Figure 2 B is dye method test results;

[0045] Figure 3 , each concentration gradient detection peak average peak height graph;

[0046] Figure 4 , quality control detection results graph; wherein, A is negative control; B is quality control;

[0047] Figure 5 , inconsistent sample CE repeat detection results; wherein Figure 5 A is three repeat FAM group peak graph; Figure 5 B is three repeat FAM group peak statistics results. DETAILED DESCRIPTION

[0048] Those skilled in the art can implement the application with reference to the contents herein, and it is particularly pointed out that all similar substitutions and changes are obvious to those skilled in the art, and they are all considered to be included in the present application. The preparation method and application of the present application have been described by preferred embodiments, and relevant personnel can obviously make changes or appropriate changes and combinations to the preparation method and application herein without departing from the contents, spirit and scope of the present application, to realize and apply the technology of the present application. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as generally understood by those skilled in the art to which the present application belongs.

[0049] The following terms or definitions are provided only to aid in the understanding of the present application. These definitions should not be construed to limit the scope or meaning of the terms below to that which is specifically described above.

[0050] Unless defined otherwise herein, all technical and scientific terms used in the present application are intended to have the same meaning as is commonly understood by those skilled in the art to which the present application pertains. Although it is believed that the following terms are well understood by those skilled in the art, the following definitions are set forth to facilitate the understanding of the present application.

[0051] As used in this application, the terms "comprise", "comprising", "have", "having", or "include" are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. The term "consisting of" is considered a preferred embodiment of the term "comprising". If a group of embodiments is defined in the following text as comprising at least a certain number of embodiments, this is also to be understood as disclosing a group consisting preferably only of these embodiments.

[0052] The indefinite articles "a" or "an," as used herein in the specification and in the claims, include the meaning of zero or one, unless the context clearly dictates otherwise. The indefinite articles "a" or "an" thus "include" the concept of "at least one," "one or more," and "one but not more than one."

[0053] The terms "about," "substantially" in the present application mean an interval of accuracy that a person of skill in the art would understand as guaranteeing the technical effect of the feature in question. The terms generally mean ±10% of the indicated value, preferably ±5%.

[0054] The terms "or more," "at least," "exceeding," and the like, such as "at least one," are to be understood as including, but not limited to, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, or 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, or more than the stated value. Any larger number or fraction in between is also included.

[0055] Conversely, the term "not more than" includes every value less than the stated value. For example, "not more than 100 nucleotides" includes 100, 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 89, 88, 87, 86, 85, 84, 83, 82, 81, 80, 79, 78, 77, 76, 75, 74, 73, 72, 71, 70, 69, 68, 67, 66, 65, 64, 63, 62, 61, 60, 59, 58, 57, 56, 55, 54, 53, 52, 51, 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, and 0 nucleotides. Any smaller number or fraction in between is also included.

[0056] The terms "a plurality," "at least two," "two or more," "at least a second," and the like, should be understood to include but not be limited to 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, or 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, or more. Any larger number or fraction in between is also included.

[0057] The technical solutions of the present application will be described clearly and completely below in conjunction with the drawings. Obviously, the described embodiments are part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative labor fall within the scope of protection of the present application.

[0058] Example 1 Design and screening of respiratory pathogen joint detection primers

[0059] In view of the current lack of effective detection means for uncommon respiratory pathogens in clinical practice, the applicant summarized and statistically analyzed hospital clinical patient data to determine the following respiratory pathogens with important clinical significance but prone to be missed in routine detection as detection targets, including: Bordetella pertussis, Citrobacter freundii, Moraxella catarrhalis, Enterobacter cloacae, Bordetella parapertussis, Streptococcus agalactiae, Streptococcus pyogenes, Proteus vulgaris, Acinetobacter baumannii, Mycobacterium smegmatis, Proteus mirabilis, Aspergillus flavus, Aspergillus fumigatus, Pneumocystis jirovecii, Cryptococcus gattii, and Cryptococcus neoformans.

[0060] In order to design primers with high species specificity, it is necessary to screen specific target genes of each respiratory pathogen. The applicant adopts the following strategies to screen specific target genes of each pathogen: a) based on intra-species alignment: download each bacterial / fungal genome from NCBI, find all "core genes" common to all strains within the species, and exclude strains with >95% inter-strain variability; b) based on inter-species alignment: cross-check the candidate "core genes" with the GenBank bacterial / fungal library, and try to retain segments with >98% intra-species coverage and <80% inter-species homology. In addition, considering the target function and clinical relevance, the application preferentially selects virulence / drug resistance related genes or cell wall synthesis or spore surface protein genes or highly conserved genes such as Acinetobacter baumannii ompA (outer membrane protein A, highly conserved and virulence core), Cryptococcus neoformans CAP10 (capsular polysaccharide synthase), Aspergillus aflR (core transcriptional regulation gene for aflatoxin synthesis), etc., so that the detection results can directly or indirectly indicate the clinical focus.

[0061] According to the specific genes or sequences of each strain screened, specific detection primers are designed. In the primer design process, the length of the primer is set to 18-30 bp; the Tm value of each gene locus primer is kept consistent (about 60°C); primer dimer, hairpin, etc. are avoided; the 3' end of the primer does not have complementary pairing of more than 3 bases, and the last 5 bases of the 3' end are preferably mismatched by >2 bases with the genome of the closely related species; and the length of the PCR amplification fragment is limited to the range of 100-500 bp.

[0062] In addition, considering that the proportion of human host samples taken during sampling is large, and that housekeeping genes are easy to amplify, as well as pathogen detection coverage and specificity issues. Therefore, during primer design, the designed sequences are also modified with base mismatches, degenerate bases, and fluorescence, etc. to control efficiency, specificity, while ensuring primer usage, preventing primer degradation due to expiration date or other improper storage, thereby causing result misjudgment, missed detection, or abnormalities, etc. For example, the sequences SEQ ID NO. 12, 13, 20, and 21, etc. in the application.

[0063] The application is a single system with high re-amplification, which can ensure the balanced amplification of each target species or target gene in a multiplex system, which is very important for the accuracy of the detection results. The applicant initially designed a plurality of bacterial specific primers for mixed amplification in the initial design of the multiplex primer system. For example, the initial design primer sequences used initially are as follows, and the test results are as follows Figure 1 After mixing a plurality of pathogen specific primers (primer ratio 1:1:1:1:1:1:1:1:1:1), the test results show that in addition to the specific peaks, there are also a plurality of non-specific peaks Figure 1The peak height of each detection target was 23.91%, and the CV value reached 47%. It can be seen that the balance of the preliminary mixed test is poor. Analysis of the test results shows that there may be problems such as primer interaction, strain interference, or other mutual influences.

[0064]

[0065]

[0066] In the table, Y, W, and R are all merged bases, representing C / T, A / T, and A / G, respectively.

[0067] Therefore, adjustments need to be made to the primers during the screening process, and further secondary adjustments and designs are needed. In order to ensure the development cycle and control costs (long synthesis cycle and high cost of fluorescent primers), and to ensure the stability of the system and the accuracy of the results, dye method testing is used as the basis for CE verification testing to ensure the effectiveness of the primers. The main two aspects of screening evaluation include specificity and amplification efficiency.

[0068] For specificity, cross experiments were conducted using the CE method during the screening process, and compared with the dye method (KAPA FAST qPCR Master Mix Kit, purchased from Roche). The effect of each detection target on non-target detection was tested and verified under the CE method. The pathogens used in the experiment include Streptococcus pneumoniae, Klebsiella pneumoniae, Moraxella catarrhalis, Bordetella pertussis, Legionella pneumophila, Serratia marcescens, Streptococcus agalactiae, Enterobacter cloacae, Streptococcus pyogenes, Klebsiella oxytoca, Klebsiella oxytoca, Escherichia coli, Staphylococcus aureus, Acinetobacter baumannii, Pseudomonas aeruginosa, Stenotrophomonas maltophilia, Bordetella parapertussis, Haemophilus influenzae, Proteus vulgaris, Proteus mirabilis, Cryptococcus neoformans, Cryptococcus gattii, Aspergillus flavus, Aspergillus fumigatus, Pneumocystis jirovecii, Citrus flavonoids, Klebsiella citra, and other related pathogens that may infect the respiratory tract (each strain is from ATCC, the Chinese Academy of Sciences Microbial Institute Bacterial Center, and hospital clinical isolates). The detection results of the primers established after screening are as follows:

[0069]

[0070]

[0071] Note: "√" indicates specificity, and "-" indicates no product

[0072] According to the cross test results, the detection primers of each pathogen can well amplify and detect the single target, and do not amplify other pathogen targets. Figure 2 For example, the partial test results of the specific primer of Enterobacter cloacae show that when the strains other than Enterobacter cloacae are used as templates (10 4 copies) for amplification, the CE test results are consistent with the dye method test results, and there is no non-specific peak in the non-target peak detection, and when different strains of Enterobacter cloacae are used as templates (10 3 copies), the target peak can be specifically detected.

[0073] For the amplification efficiency, the balance and stability of the CE system amplification are mainly considered, and therefore the qPCR dye method (KAPA FAST qPCR Master Mix Kit, purchased from Roche) is used to test the amplification efficiency of the primers, and the test results are shown in the following table: The dye method test results show that the specific primers of each target can detect the corresponding pathogens, and the Ct value range is between 14 and 19. Considering the Ct value of the universal primer, the coefficient of variation CV value of the Ct value of each primer is 6% (<10%). If the universal primer is not considered, the coefficient of variation CV value of the Ct value of each target primer is 3% (<10%). Relatively speaking, the efficiency difference of the primers is small.

[0074]

[0075]

[0076] Considering that the detection target results of the present application are not only affected by whether the infection is real, but also affected by sampling, a human internal reference gene is designed for determining whether the sample is taken, and therefore a human housekeeping gene is selected as the internal reference control of the present application, and the specific internal reference gene primers are as follows:

[0077]

[0078] Through the above series of repeated optimization and screening, the primer system finally determined by the present application is as follows:

[0079]

[0080]

[0081] Among them, R, S, Y and M are all compatible bases, which respectively represent G / A, C / G, C / T and C / A.

[0082]

[0083]

[0084] After the primers are adjusted and screened, the concentrations of the primers in the primer combination are tested according to the efficiency test results, and the proportions of the primers of each site are established. The specific concentration ratio is that the target specific primer: the internal reference primer: the universal primer is 2:1:1, and the effect is optimal.

[0085] Example 2, evaluation of detection performance

[0086] In addition to good specificity, as a supplement to the conventional method that cannot be detected, it can not only determine whether the pathogen (bacteria / fungi) is infected, but also specifically determine the infected pathogen.

[0087] In addition, compared with the reagent kit on the market, another significant advantage of the present application is that one tube can simultaneously detect one or more pathogenic bacteria of human respiratory tract infection, and the detection sensitivity can reach 100 copies.

[0088] In order to embody the above-mentioned significant characteristics, the following experimental tests are carried out in this embodiment to illustrate:

[0089] Sixteen kinds of target positive bacterial DNA were selected, diluted and mixed according to 10 1 copies / ul, 5x10 1 copies / ul, 7.5x10 1 copies / ul, 10 2 copies / ul, 2.5x10 2 copies / ul, 5x10 2 copies / ul concentration gradient, and 10 ng human genomic DNA was added respectively. Each concentration gradient was repeated for 5 times of amplification detection, and the results of 5 times of each concentration sample were statistically analyzed. The average peak height of the internal reference peak and the indication peak is as follows:

[0090]

[0091] As can be seen from the above table, the variation coefficients of the indication peak and the internal reference peak of the method system are both less than 10%, which shows that the peak stability is good, and there is no large change due to the difference of sample amount, so it can well guide the interpretation of the results.

[0092] According to the test results, the average peak height of each detection peak under different concentrations was statistically analyzed, and the specific test statistical results are shown in Figure 3 . It can be seen from Figure 3 that when the sample amount is 10 2 copies or more, the average peak height of each target is above the corresponding indication peak IntFC2 and IntHC2, and the results can be clearly interpreted, and when the sample amount is less than 10 2From the results, it can also be seen that 5x10 1 copy template amount and 7.5x10 1 copy template amount can also be better distinguished.

[0093] In summary, the method system can stably detect 100 copies of each pathogen template, and can also indicate pathogens as low as 75 copies, with good sensitivity.

[0094] Example 3, preparation and application of respiratory pathogen composite detection kit

[0095] This example is equipped with a respiratory pathogen composite detection kit, which includes RSP primer mixture, PCR amplification buffer, enzyme mixture, quality control (negative and positive), molecular weight internal standard QD550h and nuclease-free water.

[0096] The kit contains a combination of primers as determined in Example 1, and all primers are mixed according to the experimental ratio to prepare 10x primer Mix.

[0097] The kit also contains an enzyme mixture, which contains Taq DNA polymerase and UDG enzyme. The former is used for PCR product amplification, and the latter is used to prevent contamination of the amplification system by dUTP fragments in the environment or to prevent contamination of subsequent PCR amplification by product escape into the environment.

[0098] In particular, the kit also contains a molecular weight internal standard QD550h, which has an exogenous fragment built in relative to the conventional internal standard, which is used to indicate the interpretation of the results.

[0099] In addition, the kit contains PCR amplification buffer, which contains dATP, dTTP, dCTP, dGTP, dUTP, and Mg 2+ , etc.

[0100] The kit is used as follows:

[0101] I. Preparation of samples:

[0102] ZYMO Quick-DNA Fungal / Bacterial Miniprep Kit extraction kit was used to extract DNA from pre-treated respiratory patient clinical samples (sputum, nasopharyngeal swab, alveolar lavage fluid), and NanoDrop2000 (Thermo) was used to determine the concentration and purity of the DNA, and the DNA was diluted to the corresponding concentration and stored at 4 degrees or -20 degrees for standby.

[0103] II. Detection steps

[0104] Step 1: Preparation of PCR amplification system (completed in the reagent preparation area)

[0105] The PCR amplification system was prepared according to the following table, and after shaking, it was divided according to the number of samples, 19ul per tube.

[0106]

[0107]

[0108] Step 2: Add template (completed in the sample preparation area)

[0109] Add 1ul of each prepared clinical DNA sample to the corresponding PCR reaction tube, and at the same time, set up quality control (quality control: 1ul quality control, negative control: 1ul nucleic acid free water).

[0110] Step 3: PCR amplification (completed in the amplification area)

[0111] Put each reaction tube into the PCR amplification instrument reaction slot, and set the reaction system to 20ul.

[0112] The PCR setup and amplification were performed according to the following reaction program:

[0113]

[0114] Step 4, detection of amplification products (completed in the product detection room)

[0115] Prepare the loading mixture of molecular weight internal standard and deionized formamide: (0.2ul molecular weight internal standard + 8.8ul formamide) x number of detection samples, vortex for 10-15 seconds; use a pipette to dispense 9ul of deionized formamide and internal standard mixture into each detection hole; take 1ul of amplification product (original solution) and add it to the deionized formamide and internal standard mixture, cover with sealing tape. According to the user manual of the genetic analyzer, the detection is carried out.

[0116] Step 5, data analysis

[0117] After the genetic analyzer completes the detection, use GeneMapper software to analyze the raw data (.fsa file) downloaded.

[0118] Step 6, interpretation of results

[0119] For the interpretation of the test results, the results of each control sample need to be interpreted first to determine whether there is contamination and abnormality of the quality control (see Figure 4, the negative control should only have the indicative peak, the quality control should have the indicative peak and the target peak in the range of each detection panel and bin, and then the detection results are checked to determine whether the peak height exceeds the threshold of the instrument during the detection of each product. If the above situation occurs, the pollution is checked, the quality of the reagent is checked, and the product is re-diluted and detected.

[0120] After the experimental quality control is checked and meets the standard, the results of the clinical samples can be interpreted:

[0121] If the human internal reference target does not peak, it indicates that the sampling is abnormal, and the corresponding results are not interpreted. The sample should be resampled.

[0122] If the human internal reference target peaks, it indicates that the sampling is successful. The detection results of the sample need to be interpreted first. If the product peak appears in the range of the universal detection panel for bacteria and fungi, and the product peak is in the bin range, it indicates that there may be pathogen infection within the detection range of the kit, and then the specific infection is interpreted. If the detection target peak height is greater than 175 rfu, and if it is also greater than the peak height of the corresponding indicative peak (IntFC2 and / or IntHC2), it indicates that there is a corresponding bacterial and / or fungal infection; if it is greater than the peak height of the corresponding indicative peak (IntFC1 and / or IntHC1) and less than the peak height of the corresponding indicative peak (IntFC2 and / or IntHC2), it can only be determined that there may be a corresponding bacterial and / or fungal infection. The sample needs to be enriched for further detection and determination, or the sampling time is delayed for further detection and determination; if it is greater than the peak height of the corresponding indicative peak (IntFC1 and / or IntHC1), it can be determined that there is no corresponding bacterial and / or fungal infection within the detection range, and further investigation is needed to determine whether there is other pathogen infection outside the detection range.

[0123] If the product peak appears in the range of the universal detection panel for bacteria and fungi, but not in the corresponding bin range, it can be determined that there is other pathogen infection outside the specific target detection range. Other methods can be used to further determine the corresponding pathogen.

[0124] If the product peak does not appear in the range of the universal detection panel for bacteria and fungi, it can be determined that no pathogen infection within the detection range is found in this detection of the sample.

[0125] Example 4, detection of clinical samples

[0126] Hospital collects clinical samples, uses the kit of the present application for amplification and capillary electrophoresis detection, and compares with NGS / Sanger sequencing results and clinical culture results, and then evaluates the effectiveness of the re-amplification system and kit of the present application for clinical testing.

[0127] Obtain the clinical diagnosis result as respiratory tract infection positive (hospital clinical culture positive) or suspected respiratory tract infection sample (respiratory tract infection detection kit detection and clinical culture are both negative, but there are respiratory tract infection clinical symptoms), use ZYMO Quick-DNA Fungal / Bacterial Miniprep Kit extraction kit to extract DNA from the processed respiratory tract patient clinical sample, and the specific operation steps are carried out according to the foregoing kit instructions. The prepared DNA sample is measured for quality and concentration by NanoDrop2000 (Thermo), and is stored at 4 degrees for standby.

[0128] According to Example 3, the extracted clinical sample DNA is amplified and detected, and the amplification and detection results are as follows:

[0129]

[0130]

[0131]

[0132] Note that "+" in the table indicates a peak or positive, "-" indicates no peak or negative or failed culture, and "*" indicates that the sample is positive after increasing the loading amount

[0133] This example detects a total of 97 clinical samples, and the above results show the results of 25 CE detection positive samples and the comparison with NGS / sanger sequencing results. The results show that one sample RSP013 is found to only amplify Streptococcus pyogenes, and the target position of Stenotrophomonas maltophilia is peaked, but the peak height is between IntFC1 and IntFC2, in the gray area, and the three CE detection repeated results are consistent (10 ng loading amount repeated results see Figure 5 ), so the sample is judged as Streptococcus pyogenes positive. In addition to this, the CE detection results of the remaining samples are included in the NGS / sanger sequencing results, and the universal primer amplification results of the CE results are consistent with the NGS / sanger sequencing results, and the corresponding culture results are mostly negative or not cultured, indicating that the kit of the present application can not only accurately detect the pathogens within the target coverage range, but also indicate the possible pathogens outside the target coverage range.

[0134] The kit can be used for detecting the clinical sample, and the high sensitivity and accuracy of the kit can be confirmed by comparing different methods.

[0135] Finally, it should be pointed out that the above embodiments are only used to illustrate the technical solutions of the present application, and are not limiting. Although the present application has been described in detail with reference to the foregoing embodiments, it should be understood by those skilled in the art that the technical solutions recorded in the foregoing embodiments can still be modified, or some or all of the technical features can be replaced by equivalents. The modification or replacement does not make the essence of the corresponding technical solution deviate from the scope of the technical solutions of the embodiments of the present application.

Claims

1. A primer composition for detecting respiratory pathogens based on capillary electrophoresis, characterized in that, The primer set targets respiratory pathogenic bacteria and respiratory pathogenic fungi.

2. The primer composition according to claim 1, characterized in that, The respiratory pathogenic bacteria include Bordetella pertussis, Citrobacter, Moraxella catarrhalis, Enterobacter cloacae, Bordetella parapertussis, Streptococcus agalactiae, Streptococcus pyogenes, Proteus vulgaris, Acinetobacter baumannii, Stenotrophomonas maltophilia, and Proteus mirabilis; the respiratory pathogenic fungi include Aspergillus flavus, Aspergillus fumigatus, Pneumocystis hominis, Cryptococcus glottii, and Cryptococcus neoformans.

3. The primer composition according to any one of claims 1-2, characterized in that, The primer sequences are shown below: R, S, and Y are all degenerate bases, representing G / A, C / G, and C / T, respectively.

4. The primer composition according to claim 3, characterized in that, The primer composition further includes universal detection primers with the following sequences: Universal upstream detection primers for bacteria: AGAGTTTGATCMTGGCTCAG (SEQ ID NO.33) Universal downstream primers for bacterial detection: ATGCCTCCCGTAGGAGTYTG (SEQ ID NO.34) Universal upstream primer for fungal detection: ACTTGGTCATTTAGAGGAAGT (SEQ ID NO.35) Universal downstream primers for fungal detection: GCTGCGTTCTTCATCGAYGY (SEQ ID NO.36) Wherein, M is a degenerate base, representing C / A.

5. The primer composition according to claim 4, characterized in that, The primers also include internal control primers with the following sequences: upstream primer for human internal reference gene 1 detection: ATCAGCTACTTTCCTGCAATGAGG (SEQ ID NO.37) Downstream detection primers for human internal reference gene 1: ATTGTACCCTTGGAGTCCAGATC (SEQ ID NO.38) Upstream detection primer for human internal reference gene 2: ATGGTGGGCATGGGTCAGACG (SEQ ID NO.39); Downstream detection primer for human internal reference gene 2: ATGTCGTCCCAGTTGGTGACG (SEQ ID NO.40).

6. The primer composition according to claim 5, characterized in that, The primers are labeled with two fluorescent markers: FAM fluorescent group labeled with FAM fluorescein and HEX fluorescent group labeled with HEX fluorescein. The FAM fluorescent group includes primers for human internal reference gene 1, bacterial primers, and universal bacterial detection primers; The HEX fluorescent group includes primers for the human internal reference gene 2, fungal primers, and universal fungal detection primers.

7. A product for the detection of respiratory pathogens using multiplex amplification assays, characterized in that, The product includes the primer composition according to any one of claims 1-6; preferably, the product is a kit.

8. The product according to claim 7, characterized in that, The product further includes: hot-start Taq DNA polymerase, UDG enzyme and 2×PCR amplification buffer, quality control, nuclease-free purified water and internal standard.

9. The use of the primer composition according to any one of claims 1-6 in the detection of respiratory pathogens, or in the preparation of a respiratory pathogen detection kit.

10. A method for detecting respiratory pathogens, characterized in that, The steps of amplifying a sample using any primer composition of claims 1-6, or detecting a sample using any kit of claims 7-8.

Images