Bacterial strain for producing beta-carotene as well as construction method and application of bacterial strain
By integrating xylose and acetyl-CoA synthesis pathway genes into the Yersinia lipolytica strain, the MYy107 strain was constructed, solving the problems of insufficient xylose utilization and limited acetyl-CoA supply, and achieving efficient production of β-carotene with a significant increase in yield.
Patent Information
- Application Number
- CN202411457531.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-18
- Publication Date
- 2025-11-25
AI Technical Summary
Existing Yeast Extract cannot efficiently utilize xylose, and the supply of acetyl-CoA is insufficient, which limits the production efficiency of β-carotene.
By integrating xylose utilization pathway genes (XYL1, XYL2, XylA3* and Yl.Xk) and acetyl-CoA synthesis pathway genes (ERG12, ERG8, ERG19, IDI1, HpGGPPS) into the Yersinia lipolytica strain, a strain MYy107 capable of simultaneously utilizing xylose and acetic acid to produce β-carotene was constructed, and the carbon source concentration was optimized.
It significantly increased the yield of β-carotene to 710.01 mg/L, improved the strain's utilization efficiency of xylose and acetic acid, and enhanced the strain's growth performance.
Smart Images

Figure CN121006375A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of synthetic biology and genetic engineering, and in particular to a β-carotene-producing strain, its construction method, and its applications. Background Technology
[0002] From the perspective of sustainable development and environmental protection, it is necessary to use inexpensive raw materials to produce high-volume, high-value-added chemicals in order to minimize production costs. Xylose is a non-food carbon source and the second largest natural sugar. It is one of the main components of lignocellulosic biomass, and its bioconversion rate is 30-40% depending on the source of the raw materials. Xylose is frequently used as a food sweetener, and with the development of fermentation processes for high-value biomass chemicals, its utilization is receiving increasing attention. Improving the application of xylose in the fermentation industry will help promote the resource utilization of xylose and reduce the fermentation industry's dependence on food-based carbon sources such as glucose.
[0003] Although xylose is abundant in nature, very few microorganisms can naturally and efficiently utilize it, often requiring the introduction of heterologous genes to enhance xylose utilization. As a model organism for lipid metabolism, *Yarrowia lipolytica* cannot naturally utilize xylose, primarily due to low expression levels of key enzymes involved in the xylose metabolic pathway. Xylose utilization pathways include the xylose redox dehydrogenase (XR-XDH) pathway and the xylose isomerization (XI) pathway. The XR-XDH pathway involves xylose reductase (XR) catalyzing the production of xylitol from xylose, which is then converted to xylulose by xylitol dehydrogenase (XDH). The XI pathway involves the direct conversion of xylose to xylulose via xylose isomerase (XI). The xylulose produced by both pathways is converted into xylulose 5-phosphate (X5P) by xylitol kinase (XK), which then enters the pentose phosphate pathway (PPP) and participates in metabolic cycling.
[0004] Although introducing a heterologous xylose utilization pathway can effectively improve the ability of *Yersinia lipolytica* to utilize xylose, increasing the supply of acetyl-CoA is also crucial for the production of terpenoids. *Yersinia lipolytica* has the natural ability to utilize acetic acid, directly converting it into Acetyl-CoA for the production of terpenoids.
[0005] Therefore, providing a strain capable of simultaneously utilizing xylose and acetic acid to produce β-carotene, thereby increasing β-carotene yield, has broad application prospects. Summary of the Invention
[0006] The purpose of this invention is to construct a MYy107 strain that can produce β-carotene using xylose and acetic acid through homologous recombination, thereby further increasing the yield of β-carotene.
[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0008] This invention provides a method for constructing a MYy107 strain that produces β-carotene, the method comprising:
[0009] Step 1: Integrate the mevalonate kinase gene ERG12, the mevalonate phosphate kinase gene ERG8, the mevalonate diphosphate decarboxylase gene ERG19, and the isopentenyl diphosphate isomerase gene IDI1 into the RT08 strain to obtain the RT10 strain.
[0010] Step 2: Xylose reductase gene XYL1, xylitol dehydrogenase gene XYL2, xylose isomerase mutant XylA3*, and xylulose kinase gene Yl.Xk were integrated into strain RT10 to obtain strain MYy107.
[0011] Preferably, in step 2, the xylose reductase gene XYL1 is derived from Scheffersomyces stipitis, and its nucleotide sequence is shown in SEQ ID No. 1; the xylitol dehydrogenase gene XYL2 is derived from Scheffersomycesstipitis, and its nucleotide sequence is shown in SEQ ID No. 2.
[0012] Preferably, the xylose isomerase mutant XylA3* in step 2 is derived from Lactobacillus pentosus, and its nucleotide sequence is shown in SEQ ID No. 3; the xylulose kinase gene Yl.Xk is derived from Yersinia lipolytica, and its nucleotide sequence is shown in SEQ ID No. 4.
[0013] The present invention also provides a MYy107 strain obtained according to the above-described construction method.
[0014] The present invention also provides an application of the above-mentioned MYy107 strain in the production of β-carotene.
[0015] The present invention also provides a method for producing β-carotene using the above-mentioned MYy107 strain, comprising the following steps:
[0016] (1) Activate the MYy107 strain and culture for 24 hours to obtain MYy107 bacterial solution;
[0017] (2) The MYy107 bacterial culture was inoculated into YPXA medium with an initial OD600 of 0.15 to 0.25 to obtain a fermentation broth containing β-carotene;
[0018] The concentration of xylose in the YPXA medium is 15–35 g / L, and the concentration of acetic acid is 0–35 g / L.
[0019] Preferably, the YPXA culture medium also contains 18–22 g / L of peptone and 8–12 g / L of yeast extract.
[0020] Preferably, the culture temperature is 28–32°C, the time is 4–6 days, and the rotation speed is 180–220 rpm.
[0021] This invention utilizes homologous recombination to introduce a heterologous xylose utilization pathway into *Yarrowia lipolytica*, constructing the MYy107 strain capable of simultaneously utilizing xylose and acetic acid to produce β-carotene. By optimizing the addition amounts of xylose and acetic acid, the optimal concentrations of xylose and acetic acid as mixed carbon sources were determined to be 25 g / L acetic acid and 25 g / L xylose, significantly increasing the yield of β-carotene to 710.01 mg / L. Attached Figure Description
[0022] Figure 1 (a) shows the xylose consumption of strains MYy107 and RT10 when xylose is the sole carbon source; (b) shows the growth of strains MYy107 and RT10 when xylose is the sole carbon source.
[0023] Figure 2 The yield and content of β-carotene per unit cell for strains MYy107 and RT10 when xylose is the sole carbon source;
[0024] Figure 3 (a) shows the β-carotene production of strain MYy107 when xylose, acetic acid, or xylose and acetic acid are used as carbon sources; (b) shows the growth of strain MYy107 when xylose, acetic acid, or xylose and acetic acid are used as carbon sources.
[0025] Figure 4 (a) shows the β-carotene production of strain MYy107 at different acetic acid concentrations with a xylose concentration of 20 g / L; (b) shows the β-carotene production of strain MYy107 at different xylose concentrations with an acetic acid concentration of 25 g / L.
[0026] Figure 5To investigate the effects of xylose alone and xylose and acetic acid co-utilization on β-carotene production in strain MYy107 under the same carbon source addition conditions. Detailed Implementation
[0027] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0028] The *Yersinia lipolytica* genetically engineered strain for producing β-carotene in this application is developed using homologous recombination. This involves knocking out ku70 (GB:CP028450.1) and integrating one copy of *Saccharomyces* into the *Yersinia lipolytica* Po1f strain. RAD52 (GB:CAI4666471.1) from *Cerevisiae* was used to obtain strain MYy46, which had increased homologous recombination efficiency. Based on strain MYy46, the endogenous truncated HMG-CoA reductase gene tHMG (GB:RDW25091.1), the endogenous acetyl-CoA acetyltransferase gene ERG10 (GB:CP017557.1), and the endogenous HMG-CoA synthase gene ERG13 (GB:CP017558.1) were integrated to obtain strain MYy71. Based on strain MYy71, the NADH-dependent HMG-CoA reductase gene HMG (GB:WP_012250240.1) from *Bordetella petrii*, the acetyl-CoA acetyltransferase gene AtoB (GB:HBE6770579.1) from *Escherichia coli*, and *Yarrowia* were further integrated. The endogenous HMG coenzyme A synthase gene ERG13 (GB:CP017558.1) from *Yarrowia lipolytica* was used to obtain strain MYy75. Based on strain MYy75, the geraniol-geraniol diphosphate synthase gene HpGGPPS (GB:AKR53701.1) from *Haematococcus pluvialis* and the endogenous flavin adenine dinucleotide gene FAD1 (GB:CP017556.1) from *Yarrowia lipolytica* were integrated to obtain strain RT05. Based on strain RT05, carB (GB:EPB83039.1) and carRP from *Mucor circinelloides* were integrated. Y24R(GB:EPB83040.1) yielded the RT08 strain, which produces β-carotene; based on the RT08 strain, the endogenous mevalonate kinase gene ERG12 (GB:CP028449.1), phosphate mevalonate kinase gene ERG8 (GB:CP028452.1), mevalonate diphosphate decarboxylase gene ERG19 (GB:CP028453.1), and isopentenyl diphosphate isomerase gene IDI1 (GB:CP017558.1) were integrated to obtain the RT10 strain, which produces β-carotene; based on the RT10 strain, the xylose reductase gene XYL1 and xylitol dehydrogenase gene XYL2 from Scheffersomyces stipites, the xylose isomerase mutant XylA3* from Lactobacillus pentosus, and the endogenous xylulose kinase gene Yl.Xk were integrated to obtain the MYy107 strain, which can produce β-carotene using xylose.
[0029] The *Yersinia lipolytica* Po1f strain was purchased from the Centre de recherche INRAE Montpellier Occitanie; the nucleotide sequence of the codon-optimized xylose reductase gene XYL1 from *Scheffersomyces stipites* is shown in SEQ ID No. 1; the nucleotide sequence of the codon-optimized xylitol dehydrogenase gene XYL2 from *Scheffersomyces stipites* is shown in SEQ ID No. 2; the nucleotide sequence of the codon-optimized xylose isomerase mutant XylA3* from *Lactobacillus pentosus* is shown in SEQ ID No. 3; and the nucleotide sequence of the codon-optimized endogenous xylulose kinase gene Yl.Xk is shown in SEQ ID No. 4.
[0030] SEQ ID No. 1:
[0031]
[0032] SEQ ID No. 2:
[0033] SEQ ID No. 3:
[0034]
[0035] SEQ ID No.4:
[0036]
[0037] Example 1: Construction of strain MYy107
[0038] (1) The linearized plasmid pMY106_INT_KU70_EXP1p_URA3_CYC1t with PmeI restriction site was transformed into Yeast lipolyticis Po1f to obtain the recombinant strain MYy39 with ku70 knocked out. The transformation was performed using the Frozen EZ YeastTransformation II™ kit (purchased from Jinan Chengtou Science and Trade Co., Ltd.) and the procedure was performed according to the instructions of the kit.
[0039] (2) Using the PmeI restriction site linearized plasmid pMY121_INT_A08_YlRad52p_ScRad52_GPDt_Loxp_URA3, the linearized fragment was transformed into Yersinia lipophila MYy39 to obtain the recombinant strain MYy46 that integrates RAD52.
[0040] (3) The linearized plasmid pMY152_INTE_1_Loxp_URA3_GPDp_tHMG1_EXP1p_ERG10_UAS1B-TEF(136)p_ERG13, which was linearized by the restriction site PmeI, was transformed into Yersinia lipophila MYy46 to obtain the recombinant strain MYy71 that integrates tHMG, ERG10 and ERG13.
[0041] (4) The codon-optimized genes HMG, AtoB and ERG13 were respectively ligated into plasmid vectors pMY36_EXP1p_CYC1, pMY35_GPDp_PEX20t and pMY34_UAS1B8_TEF(136)p_GPDt through the restriction sites NheI and XhoI, respectively, to obtain plasmids pMY36_EXP1p_HMG_cYc1t, pMY35_GPDp_AtoB_PEX20t and pMY34_UAS1B8_TEF(136)p_ERG13_GPDt.
[0042] (5) Digest the plasmid vector pMY34_UAS1B8_TEF(136)p_ERG13_GPDt obtained in step (4) with MreI and AscI, digest the plasmid pMY35_GPDp_AtoB_PEX20t with Agel and AscI, and ligate the fragment GPDp_AtoB_PEX20t to the plasmid vector to obtain the plasmid pMY155_UAS1B8_TEF(136)p_ERG13_GPDt_GPDp_AtoB_PEX20t;
[0043] (6) Digest the plasmid vector pMY155 obtained in step (5) with MreI and KpnI enzymes, and amplify the plasmid pMY154_INTC_3_Loxp_URA3_G154 with primers MYO1i_577 / MYO1i_578. Link the fragment INTC_3_Loxp_URA3 to the plasmid vector pMY155 to obtain the plasmid pMY160_INTC_3_Loxp_URA3_UAS1B8_TEF(136)p_ERG13_GPDp_AtoB;
[0044] (7) The plasmid vector pMY160 obtained in step (6) was digested with MreI and IKpnI enzymes, and the plasmid pMY36_EXP1p_HMG_CYC1t was amplified with primers MYOli_587 / MYOli_588. The fragment EXP1p_HMG_cYC1t was ligated to the plasmid vector to obtain the plasmid pMY165_INTC_3_Loxp_URA3_UAS1B8_TEF(136)p_ERG13_GPDp_AtoB_EXP1p_HMGR;
[0045] (8) Linearize the plasmid pMY165 obtained in step (7) using the PmeI restriction site, and transform the linearized fragment into the engineered yeast MYy71 to obtain the recombinant strain MYy75.
[0046] (9) Connect the fragments GPDp_HpGGPP_PEX20t and EXP1p_FAD1_CYC1t to the plasmid vector pMY153_INTC_2_Loxp_URA3 respectively to obtain the plasmid pLRT18_INTC_2_Loxp_URA3_HpGGPPS_FAD1;
[0047] (10) Linearize the plasmid pLRT18 obtained in step (9) using the PmeI restriction site, and transform the linearized fragment into the engineered yeast MYy75 to obtain the recombinant strain RT05.
[0048] (11) GPDp_carRP fragment Y24R_PEX20t and EXP1p_carB_CYC1t were ligated into the plasmid vector pMY129_INTD_1_Loxp_URA3, respectively, to obtain the plasmid pLRT21_INTD_1_Loxp_URA3_carB_carRP. Y24R ;
[0049] (12) Linearize the plasmid pLRT21 obtained in step (11) using the PmeI restriction site, and transform the linearized fragment into the engineered yeast RT05 to obtain the recombinant strain RT08.
[0050] (13) The fragments GPDp_ERG12_PEX20t, EXP1p_IDI_CYC1t, TEFinp_ERG19_PGKt and UAS1B8_TEF(136)p_ERG8_GPDt were cloned in one step and ligated into the plasmid vector pMY169_INTA_1_Loxp_URA3 to obtain the plasmid pMY178_Loxp_URA3_INTA_1_GPDp_ERG12_PEX20t_EXP1p_IDI_CYC1t_TEFinp_ERG19_PGKt_UAS1B8_TEF(136)p_ERG8_GPDt;
[0051] (14) Using the PmeI restriction site to linearize the plasmid pMY178 obtained in step (13), the linearized fragment was transformed into the engineered yeast RT08 to obtain the recombinant strain RT10.
[0052] (15) The fragments UAS1B8_TEF(136)p_XYL2_GPDt, EXP1p_XYL1_CYC1t, TEFinp_xylA3_PGKt and GPDp_ylXK_PEX20t were cloned into the plasmid vector pMY106_INT_KU70_EXP1p_URA3_CYC1t in one step to obtain the plasmid pMY187_INT_KU70_Loxp_URA3_UAS1B8_TEF(136)p_XYL2_GPDt_EXP1p_XYL1_CYC1t_TEFinp_xylA3_GPDp_ylXK_G187;
[0053] (16) Linearize the plasmid pMY187 obtained in step (15) using the PmeI restriction site, and transform the linearized fragment into the engineered yeast RT10 to obtain the recombinant strain MYy107.
[0054] Table 1 Primer sequences used in constructing strain MYy107
[0055] Primer name Sequence (5'-3') MY01i_577 TGTGAGACACCTCAGGAATTCGGGTACCAGCGCGCCGGCGTACAGTGTCTATCAACGGGG MY01i_578 CATTCATGTTAGTTGCGTACGCGTTGCATCGATCGCCGGACTAGTGGATCTGATATCAC MY01i_587 GCCCGAACAAGCCCCGTTGATAGACACTGTACGCCGGCGCGGCGATCGATGCAACGCGT MY01i_588 GTGAGACACCTCAGGAATTCGGGTACCAGACAACGGAATGCGACCGGT
[0056] Example 2: Yersinia lipolytica producing β-carotene from xylose
[0057] The MYy107 and RT10 strains were inoculated into 5mLYPD medium (composed of 20 g / L glucose, 20 g / L peptone, and 10 g / L yeast extract, with the remainder being water) and cultured for 24 hours. Then, the initial OD was used as the starting point. 600 =0.01 was inoculated into 24-well plates containing 1 mL SCX medium (composed of 1.5 g / L yeast basal nitrogen source without amino acids, 2 g / L mixed nitrogen source, 5 g / L ammonium sulfate, 0.2 mM inositol, 20 g / L xylose, with the remainder being water). The 24-well plates were placed in a Jeling growth curve analysis system at 30℃ and 800 rpm for 72 h of fermentation. The remaining xylose content was detected using a Bio-Rad 87H column in high performance liquid chromatography, and the growth of the strain was monitored in real time using the Jeling growth curve analysis system. The results are as follows. Figure 1 As shown. In SCX medium, the lag phase of strain MYy107 was significantly shorter than that of strain RT10, and the OD... 600 The highest OD value reached 11.91, and the xylose consumption was as high as 14.92 g / L. In SCX medium, strain RT10 converted trace amounts of xylose to xylulose, but could not utilize it effectively, resulting in poor strain growth and a maximum OD value of [missing value]. 600 Only 1.73.
[0058] The MYy107 and RT10 strains were inoculated into 5 mL LYPD medium and cultured for 24 hours, then the initial OD was used as the starting point. 600 =0.2g was inoculated into 50ml LYPX medium (composed of 20g / L xylose, 20g / L peptone, and 10g / L yeast extract, with the remainder being water). A 250mL shake flask was placed in a shaking incubator at 30℃ and 200rpm for 5 days of fermentation. The microstructure was analyzed using high-performance liquid chromatography (HPLC) at C10 ... 18 Qualitative and quantitative analysis of β-carotene was performed using a reversed-phase chromatography column, and the results are as follows: Figure 2 As shown, in YPX medium, the β-carotene production of strain MYy107 was 3.63 times that of strain RT10, reaching 189.65 mg / L (29.18 mg / g DCW).
[0059] Example 3: Production of β-carotene using xylose and acetic acid
[0060] The MYy107 strain was inoculated into 5 ml LYPD medium and cultured for 24 hours, then the initial OD was used as the starting point. 600 =0.2g inoculated into 50ml LYPX 20(20g / L xylose, 20g / L peptone and 10g / L yeast extract), 50ml LYPX 10 A 10 ((10 g / L xylose and 10 g / L acetic acid, 20 g / L peptone and 10 g / L yeast extract) and 50 ml LYPA 20 In a culture medium containing 20 g / L acetic acid, 20 g / L peptone, and 10 g / L yeast extract, 250 mL shake flasks were placed in a shaking shaker at 30°C and 200 rpm for 5 days. The fermentation was then performed using high-performance liquid chromatography (HPLC) at C1000 rpm. 18 Qualitative and quantitative analysis of β-carotene was performed using a reversed-phase chromatography column, and the results are as follows: Figure 3 As shown. When xylose and acetic acid were used as a mixed carbon source at 10 g / L and 10 g / L respectively, strain MYy107 exhibited higher biomass and β-carotene production, OD... 600 The value reached 38, which is higher than the OD of strain MYy107 when using a single carbon source. 600 The β-carotene yield of strain MYy107 reached 295.82 mg / L (34.02 mg / g DCW), which is 1.56 times and 1.74 times that of β-carotene produced when xylose or acetic acid were used as the sole carbon source, respectively. This indicates that acetic acid, as a supplementary carbon source to xylose, is more beneficial for β-carotene production.
[0061] Example 4: Optimization of the optimal addition amounts of xylose and acetic acid
[0062] To optimize the co-utilization of xylose and acetic acid by strain MYy107, the addition amounts of xylose and acetic acid were optimized to maximize β-carotene production. First, based on 20 g / L xylose, strain MYy107 was introduced into YPX culture with auxiliary carbon sources of 5 g / L, 10 g / L, 15 g / L, 20 g / L, 25 g / L, 30 g / L, and 35 g / L acetic acid. 20 A N Fermentation was carried out in a culture medium containing 5 g / L, 10 g / L, 15 g / L, 20 g / L, 25 g / L, 30 g / L, or 35 g / L acetic acid for 5 days in shake flasks at 30°C and 200 rpm. After fermentation, the samples were analyzed using high-performance liquid chromatography (HPLC) at C60°C. 18 The determination was performed using a reversed-phase chromatographic column, and the results are as follows: Figure 4As shown in (a), the yield of β-carotene increased with increasing acetic acid concentration, reaching a maximum of 557.31 mg / L when the acetic acid concentration was 25 g / L. With further increases in acetic acid concentration, the cytotoxicity and metabolic stress caused by acetic acid led to a gradual decrease in β-carotene yield. Therefore, based on 20 g / L xylose, the optimal acetic acid concentration was 25 g / L. Subsequently, with the acetic acid concentration fixed at 25 g / L, the optimal xylose concentration was investigated to determine the concentration of the optimal mixed carbon source for β-carotene production. Xylose concentrations of 15 g / L, 20 g / L, 25 g / L, 30 g / L, and 35 g / L were used as the mixed carbon source, and strain MYy107 was cultured in YPX... N A 25 (N represents xylose concentrations of 15 g / L, 20 g / L, 25 g / L, 30 g / L, and 35 g / L) in a culture medium, shake-flask fermentation was carried out for 5 days at 30°C and 200 rpm. After fermentation, the samples were analyzed using high-performance liquid chromatography (HPLC) at C100°C. 18 The determination was performed using a reversed-phase chromatographic column, and the results are as follows: Figure 4 As shown in (b), the yield of β-carotene increased with increasing xylose concentration, reaching a maximum of 710.01 mg / L when the xylose concentration was 25 g / L. Further increases in xylose concentration did not significantly improve the yield of β-carotene. This may be because the MYy107 strain reached its upper limit in xylose utilization; therefore, 25 g / L xylose and 25 g / L acetic acid are the optimal addition amounts for β-carotene production.
[0063] Example 5 compares the effects of mixed carbon sources and single carbon sources on β-carotene production.
[0064] After determining the optimal addition amounts of xylose and acetic acid, the effects of utilizing xylose alone and co-utilizing xylose and acetic acid on β-carotene production were compared under the same carbon source addition conditions. The MYy107 strain was inoculated into 5mLYPD medium and cultured for 24 hours, then the initial OD was used as the starting point for β-carotene production. 600 =0.2% was inoculated into 50 mL of YPX. 50 (50g / L xylose, 20g / L peptone and 10g / L yeast extract) and YPX 25 A 25 In a culture medium containing 25 g / L xylose, 25 g / L acetic acid, 20 g / L peptone, and 10 g / L yeast extract, 250 mL shake flasks were placed in a shaking incubator at 30°C and 200 rpm for 5 days. The fermentation was then performed using high-performance liquid chromatography (HPLC) at C1000 rpm. 18 Reversed-phase chromatography column is used for qualitative and quantitative analysis of β-carotene, such as... Figure 5As shown, when xylose at 50 g / L was the sole carbon source, the yield of β-carotene reached 538.89 mg / L (47.49 mg / g DCW). However, when xylose and acetic acid at 25 g / L were used as a mixed carbon source, the yield of β-carotene increased by 27.83%, reaching 710.01 mg / L (62.44 mg / g DCW). This further demonstrates that xylose and acetic acid as a mixed carbon source are more conducive to the production of β-carotene.
[0065] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A method for constructing a MYy107 strain that produces β-carotene, characterized in that, The method includes: Step 1: Integrate the mevalonate kinase gene ERG12, the mevalonate phosphate kinase gene ERG8, the mevalonate diphosphate decarboxylase gene ERG19, and the isopentenyl diphosphate isomerase gene IDI1 into the RT08 strain to obtain the RT10 strain. Step 2: Xylose reductase gene XYL1, xylitol dehydrogenase gene XYL2, xylose isomerase mutant XylA3*, and xylulose kinase gene Yl.Xk were integrated into strain RT10 to obtain strain MYy107.
2. The construction method according to claim 1, characterized in that, In step 2, the xylose reductase gene XYL1 is derived from Scheffersomyces stipitis, and its nucleotide sequence is shown in SEQ ID No. 1; the xylitol dehydrogenase gene XYL2 is derived from Scheffersomyces stipitis, and its nucleotide sequence is shown in SEQ ID No.
2.
3. The construction method according to claim 1, characterized in that, The xylose isomerase mutant XylA3* in step 2 is derived from Lactobacillus pentosus, and its nucleotide sequence is shown in SEQ ID No. 3; the xylulose kinase gene Yl.Xk is derived from Yersinia lipolytica, and its nucleotide sequence is shown in SEQ ID No.
4.
4. A MYy107 strain obtained by the construction method according to claims 1 to 3.
5. The use of the MYy107 strain according to claim 4 in the production of β-carotene.
6. A method for producing β-carotene using the MYy107 strain according to claim 4, characterized in that, Includes the following steps: (1) Activate the MYy107 strain and culture for 24 hours to obtain MYy107 bacterial solution; (2) The MYy107 bacterial culture was inoculated into YPXA medium with an initial OD600 of 0.15 to 0.25 to obtain a fermentation broth containing β-carotene; The concentration of xylose in the YPXA medium is 15–35 g / L, and the concentration of acetic acid is 0–35 g / L.
7. The method according to claim 6, characterized in that, The YPXA culture medium also contains 18–22 g / L of peptone and 8–12 g / L of yeast extract.
8. The method according to claim 7, characterized in that, The culture temperature is 28–32℃, the time is 4–6 days, and the rotation speed is 180–220 rpm.