Method for creating corn hdziv4 male sterile line by using artificial mutation
The creation of male-sterile maize lines using CRISPR/Cas9 gene editing technology has solved the problem of resource scarcity in the maize seed industry, enabling the creation of stable male-sterile lines and improving breeding efficiency, which can be applied to maize hybridization breeding and seed production.
Patent Information
- Application Number
- CN202511544514.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-28
- Publication Date
- 2025-11-25
- Estimated Expiration
- 2045-10-28
AI Technical Summary
Existing technologies make it difficult to rapidly enrich maize male-sterile line resources, resulting in a lack of stable male-sterile lines and a shortage of breakthrough varieties in the maize seed industry. Furthermore, the artificial emasculation process is costly and makes it difficult to guarantee seed quality.
Using CRISPR/Cas9 gene editing technology, male-sterile maize lines were created by inhibiting the expression and/or activity of the ZmHDZIV4 gene in the maize genome, and co-segregation molecular markers were developed for fertility identification and seed purity detection.
This has enabled the rapid creation of stable male-sterile maize lines, enriched maize GMS gene and sterility material resources, improved maize breeding efficiency and seed quality, and supported the development of maize hybrid breeding and seed production.
Smart Images

Figure CN121006380A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant biotechnology breeding, specifically involving the creation of maize using artificial mutations. hdziv4 Male-sterile line. Background Technology
[0002] As one of my country's most important food crops, maize has a planting area exceeding 670 million mu (approximately 41.3 million hectares) annually. The healthy development of the maize seed industry is of vital strategic significance for ensuring national food security. Furthermore, given its status as the world's largest market capitalization, most commercialized, and technologically advanced sector, the maize seed industry has become a key area of global seed industry competition. However, compared to international leading levels, my country still lags significantly behind in technological innovation and industrial models within the maize seed industry. On the one hand, the lack of fundamental breakthroughs in basic research on maize male sterility has challenged the protection of intellectual property rights for maize inbred lines. This has led to the long-term existence of follower and imitative breeding practices in the domestic maize seed industry in recent years, slowing down the efficiency of major new variety breeding. On the other hand, the current maize seed production industry mainly relies on manual detasseling, a labor-intensive process that is not only costly and resource-intensive but also makes it difficult to guarantee seed quality. [1] .
[0003] Maize is one of the most successful crops in utilizing heterosis, and male-sterile lines are crucial materials for achieving this heterosis, mainly including cytoplasmic male sterility (CMS) and nuclear male sterility (GMS). Although CMS has been applied in maize breeding, it faces problems such as low resource utilization, monotypic cytoplasm in sterile lines, and susceptibility to disease. In contrast, GMS can overcome the shortcomings of CMS, but its application is limited because conventional breeding methods cannot easily propagate homozygous male-sterile lines in large quantities. In recent years, with the advancement of genetic engineering and molecular design breeding technologies, especially the development of maize multi-control male sterility technology and plant universal dominant male sterility technology, new solutions have been provided to address these problems. [2] .
[0004] Compared to model organisms Arabidopsis thaliana and rice, maize has relatively few GMS genes and male-sterile materials. CRISPR / Cas9 gene editing technology, due to its low cost, ease of operation, and high efficiency, shows broad application prospects in plant gene function research, crop genetic improvement, and breeding. By using CRISPR / Cas9 technology to discover and identify candidate male-sterile genes in maize and create male-sterile materials, we can not only rapidly enrich maize GMS gene and male-sterile material resources, but also promote the development of maize sterilization breeding and seed production, thereby effectively solving the problems of a lack of stable male-sterile lines and a shortage of breakthrough varieties in my country's maize seed industry. [3] . Summary of the Invention
[0005] To address the shortcomings of existing technologies, the purpose of this invention is to provide a method for creating maize using artificial mutation. hdziv4 Male-sterile lines can be used to create male-sterile maize lines, which can then be applied to maize hybridization breeding and seed production.
[0006] To achieve the above objectives, this invention provides a method for creating male-sterile maize lines, characterized by inhibiting the expression and / or activity of proteins encoded by fertility genes in the maize genome, thereby causing the fertility genes to lose their function and obtaining male-sterile maize lines; the fertility gene is... ZmHDZIV4 ( Zm00001d030069 ); the ZmHDZIV4 ( Zm00001d030069 The nucleic acid sequence of the compound is shown in SEQ ID NO.1; ZmHDZIV4 ( Zm00001d030069 The amino acid sequence of the encoded protein is shown in SEQ ID NO.2.
[0007] In some implementations, the methods for inhibiting protein expression and / or activity include any one of gene editing, RNA interference, or T-DNA insertion.
[0008] In some implementations, the gene editing described above uses the CRISPR / Cas9 method.
[0009] In some implementations, the promoters recognized by RNA polymerase III that initiates transcription of the genes encoding the MT1-gRNA and MT2-gRNA are promoters OsU3 and TaU3, respectively.
[0010] In some implementations, a CRISPR / Cas9 vector target is designed at the second exon of the gene, and the DNA sequence of the target is shown in SEQ ID NO.3 or SEQ ID NO.4.
[0011] On the other hand, the present invention also provides a way to obtain hdziv4 The method for obtaining male-sterile lines will be achieved through the methods described above. hdziv4 Male-sterile lines are hybridized and backcrossed with target materials to obtain the desired results. hdziv4 Male infertility traits and gene mutations.
[0012] The present invention also includes those obtained by any of the above methods. hdziv4 Application of male-sterile lines in hybridization breeding and seed production. The application in hybridization breeding and seed production refers to... hdziv4 Male-sterile lines are used as the female parent in crosses with other male parents, or the resulting lines are used to obtain male-sterile lines. hdziv4 Male-sterile lines are hybridized and backcrossed with other target materials to obtain the desired results. hdziv4Male infertility traits and gene mutations.
[0013] Furthermore, this invention also provides two male-sterile maize lines. hdziv4 Molecular markers, primers, primers ZmHDZIV4 -F and ZmHDZIV4 -R, ZmHDZIV4-PF and ZmHDZIV4-PR, the sequences are shown in SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8, respectively.
[0014] The advantages and beneficial effects of this invention are as follows: This invention utilizes CRISPR / Cas9 gene editing technology to genetically transform fertility genes. ZmHDZIV4 ( Zm00001d030069 ) Specific knockout in maize, through a series of experiments, yielded three strains with novel mutation sites. hdziv4 Male-sterile lines. These sterile lines are fertile and exhibit complete abortion, allowing for the creation of maize male-sterile lines with different genetic backgrounds, which can then be applied to maize hybridization breeding and seed production. (Targeting three types...) hdziv4 Co-segregating molecular markers were developed for male-sterile lines, which can be used for identification of fertility alleles in plants, screening of target plants in marker-assisted breeding, and identification of seed purity. Attached Figure Description
[0015] Figure 1 for ZmHDZIV4 Analysis of gene expression patterns in anthers at different developmental stages of maize.
[0016] S5, sporogenous cell stage; S6, microsporocyte stage; S7, meiosis initiation stage; S8a, meiosis I, didic stage; S8b, meiosis II, tetrad stage; S8b-9, tetrad-monuclear microsporus stage; S9, mononuclear microsporus stage; S9-10, mononuclear microsporus-microsporus vacuolization stage; S10, microsporus vacuolization stage; S11, first unequal mitosis of microsporus, binuclear microsporus stage; S12, second mitosis of microsporus, trinuclear microsporus stage.
[0017] Figure 2 for pCas9-ZmHDZIV4 Physical map of the site-directed mutagenesis expression vector.
[0018] pCas9-ZmHDZIV4 From the left to the right boundary of the T-DNA are herbicide resistance genes. Bar The expression cassette of the Cas9 nuclease-encoding gene. ZmHDZIV4 Expression cassettes for gene target 2 (MT2) and target 1 (MT1).
[0019] Figure 3 Wild type ZmHDZIV4 Gene structure and DNA sequence analysis of its sterile mutant.
[0020] wild type ZmHDZIV4 (WT - ZmHDZIV4 The gene is 2652 bp in length, including 11 exons and 10 introns; ZmHDZIV4-Cas9-1 A deletion of 459 bases occurs between 688bp and 1148bp in the second and third exons. ZmHDZIV4-Cas9-2 One base is inserted at position 688bp in the second exon and one base is inserted at position 1147bp in the third exon. ZmHDZIV4-Cas9-3 One base is inserted at position 688bp in the second exon, and three bases are deleted between 1146-1150bp.
[0021] Figure 4 Wild type and hdziv4 Phenotypic analysis of tassels, anthers, and pollen grains of homozygous mutants.
[0022] Top row: Wild-type corn (WT) and ZmHDZIV4-Cas9-1 , ZmHDZIV4-Cas9-2 , ZmHDZIV4-Cas9-3 Phenotypic comparison of mutant male ears; second row shows WT and ZmHDZIV4-Cas9-1 , ZmHDZIV4-Cas9-2 , ZmHDZIV4- Cas9-3 Phenotypic comparison of mutant anthers; bottom row: WT and... ZmHDZIV4-Cas9-1 , ZmHDZIV4-Cas9-2 , ZmHDZIV4-Cas9-3 Comparison of I2-KI staining of mutant pollen grains.
[0023] Figure 5 To utilize co-separation markers ZmHDZIV4-Cas9-1 Genotyping was performed on the F2 generation plants of the sterile line.
[0024] Co-separation markers ZmHDZIV4-F / R For 6 plants ZmHDZIV4-Cas9-1 PCR and agarose gel electrophoresis results of F2 generation plants from the sterile line: a 939 bp band was amplified in homozygous wild-type (AA) plants; HDZIV4 / hdziv4 Two bands, 939 bp and 480 bp, were amplified in heterozygous (Aa) plants; hdziv4 / hdziv4 A 480 bp band was amplified in the homozygous mutant (aa) plant.
[0025] Figure 6 To utilize co-separation markers ZmHDZIV4-Cas9-2 Genotyping was performed on the F2 generation plants of the sterile line.
[0026] Co-separation markersZmHDZIV4-P-F / R For 5 plants ZmHDZIV4-Cas9-2 PCR and polyacrylamide gel electrophoresis results of F2 generation plants of the sterile line: a 54 bp band was amplified in homozygous wild-type (AA) plants; HDZIV4 / hdziv4 Two bands, 54 bp and 55 bp, were amplified in heterozygous (Aa) plants; hdziv4 / hdziv4 A 55 bp band was amplified in the homozygous mutant (aa) plant.
[0027] Figure 7 To utilize co-separation markers ZmHDZIV4-Cas9-3 Genotyping was performed on the F2 generation plants of the sterile line.
[0028] Co-separation markers ZmHDZIV4-P-F / R For 5 plants ZmHDZIV4-Cas9-3 PCR and polyacrylamide gel electrophoresis results of F2 generation plants from the sterile line: a 54 bp band was amplified in homozygous wild-type (AA) plants; HDZIV4 / hdziv4 Two bands, 54 bp and 55 bp, were amplified in heterozygous (Aa) plants; hdziv4 / hdziv4 A 55 bp band was amplified in the homozygous mutant (aa) plant. Detailed Implementation
[0029] The following embodiments are used to illustrate the present invention, but do not limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the invention. Unless otherwise specified, the synthesis and sequencing of primers and genes used in the embodiments were performed by Sangon Biotech (Shanghai) Co., Ltd. Other biochemical reagents, unless otherwise specified, are conventional commercially available reagents, and the technical means used in the embodiments are conventional means well known to those skilled in the art.
[0030] Example 1: Corn ZmHDZIV4 ( Zm00001d030069 Gene sequence and expression pattern analysis The query for corn in the maizeGDB database (https: / / www.maizegdb.org / ) yielded results. ZmHDZIV4 ( Zm00001d030069, GRMZM2G123140 The gene, whose nucleic acid sequence in B73 is shown in SEQ ID NO.1, has the following gene function annotation: HDZIV4_ OCL4 protein (HD-ZIP IV family transcription factor OCL4, HDZIV4 The protein it encodes contains 884 amino acids, and its sequence is shown in SEQ ID NO.2.
[0031] HD-ZIP transcription factors are involved in the regulation of numerous physiological processes in plants. Further research is needed to investigate these processes. ZmHDZIV4 To investigate the relationship between a gene and male reproductive development in maize and to rapidly create male-sterile lines, this invention first used qRT-PCR to analyze the expression pattern of this gene at different stages of maize anther development. The specific steps are as follows:
[0032] 1. Sampling and developmental stage identification of maize anthers Anther samples of different lengths were collected from tassels of maize inbred line B73 at different developmental stages, according to the length of the anthers. Twenty fresh anthers of similar length were collected from each sample. Three of them were fixed in FAA solution (Coolaber, China) and their specific developmental stage was determined by resin semi-thin sectioning experiment. The remaining 17 anthers were immediately frozen in liquid nitrogen for RNA extraction.
[0033] The anthers fixed for resin sectioning were dehydrated using a gradient of ethanol (50%, 70%, 90%, 100%) for 15-30 minutes per step. During dehydration, the anthers could be preserved long-term in 70% ethanol. To facilitate later embedding, 0.1% eosin could be added to 90% ethanol for staining. To ensure thorough dehydration, the material needed to be dehydrated 2-3 times in anhydrous ethanol. Resin replacement was then performed, with the anthers placed sequentially in ethanol-to-Spurr resin solutions at volume ratios of 3:1, 1:1, and 1:3 for 2-4 hours, and finally in pure resin overnight. After resin replacement, the anthers were placed in a mold, 200 µL of Spurr resin was added, and the mold was placed in an oven at 70°C for overnight polymerization. The mold was then trimmed, and sections were prepared using a Leica microtome to a thickness of 2 µm. The sections were then picked up with forceps, placed in sterile water in the center of a glass slide, and incubated overnight at 42°C. Immerse the glass slide containing the fixed sample in 0.1% toluidine blue staining solution for 1 minute, then rinse with deionized water, place on a slide stage, and dry before use for microscopic observation; alternatively, it can be mounted for long-term preservation. Analyze the resin sections and determine the specific developmental stage of each sample based on the cytological characteristics of 14 different developmental stages of maize (Stage 1-Stage 14: S1-S14).
[0034] 2. qRT-PCR analysis Total RNA was extracted from maize anthers at different developmental stages (S5-S12) using Trizol reagent (Invitrogen, USA). cDNA was then synthesized using 5X All-in-One RT Master Mix (ABM, Canada). Quantitative reverse transcription polymerase chain reaction (RT-PCR) was performed using TBGreen™ PreMix Ex Taq™ (TaKaRa, Japan) on a QuantStudio 5 Real-Time PCR System (ABI, USA). The amplification primers were: qHDZIV4-F (SEQ ID NO. 9): 5'-TCGTATCCAAGGCAAGAACC-3' and qHDZIV4-R (SEQ ID NO. 10): 5'-ACGCAGTACCTGAAGAACACC-3'. ZmActin1 was used as a reference gene, and its amplification primers were: Actin1-F (SEQ ID NO. 11): 5'-AAATGACGCAGATTATGTTTGA-3' and Actin1-R (SEQ ID NO. 10): 5'-ACGCAGTACCTGAAGAACACC-3'. NO.12): 5'-GCTCGTAGTGAGGGAGTACC-3'; each developmental stage includes three biological replicates, and each sample has three technical replicates; data are presented in 2... -ΔΔCt The methods were analyzed, and the quantitative results are presented in the form of mean ± standard deviation (Means ± SD).
[0035] ZmHDZIV4 The gene exhibits a pattern of anther development-specific expression: high expression occurs in the early S5 stage of maize anther development, then begins to decrease, and almost no expression occurs in S6-S12 stages. Figure 1 ).
[0036] Example 2: Corn ZmHDZIV4 ( Zm00001d030069 The function of genes and the creation of male-sterile maize lines using CRISPR / Cas9. To clarify corn ZmHDZIV4 ( Zm00001d030069 The function of [certain genes] in maize was investigated using CRISPR / Cas9 gene editing to mutate [certain genes]. Zm00001d030069 The gene sequence was determined to knock out the function of the gene in maize. This invention selected the maize hybrid HiII as the recipient material for gene editing. The sequences shown in SEQ ID NO. 3 and SEQ ID NO. 4, representing conserved gene regions, were selected as target regions for CRISPR / Cas9 gene editing.
[0037] 1. ZmHDZIV4 Construction of CRISPR / Cas9 gene editing vector The gene editing vector of the present invention is pBUE411-MT1T2-Cas9 The basic carrier of this carrier is pBUE411- Cas9 The intermediate carrier is pCBCmT1T2 It provides gRNA. The OsU3 and TaU3 promoter sequences are as follows: OsU3 (SEQ ID NO.13): aaggaatctttaaacatacgaacagatcacttaaagttcttctgaagcaacttaaagttatcaggcatgcatggatcttggaggaatcagatgtgcagtcagggaccatagcacaagacaggcgtcttctactggtgctaccagcaaatgctggaagccgggaacactgggtacgttggaaacca cgtgatgtgaagaagtaagataaactgtaggagaaaagcatttcgtagtgggccatgaagcctttcaggacatgtattgcagtatgggccggcccattacgcaattggacgacaacaaagactagtattagtaccacctcggctatccacatagatcaaagctgatttaaaagagttgtgcagatgatccgt TaU3 (SEQ ID NO.14): catgaatccaaaccacacggagttcaaattcccacagattaaggctcgtccgtcgcacaaggtaatgtgtgaatattatatctgtcgtgcaaaattgcctggcctgcacaattgctgttatagtt ggcggcagggagagttttaacattgactagcgtgctgataatttgtgagaaataataattgacaagtagatactgacatttgagaagagcttctgaactgttattagtaacaaaaatggaaagctgatgcacg gaaaaaggaaagaaaaagccatacttttttttaggtaggaaaagaaaaagccatacgagactgatgtctctcagatgggccgggatctgtctatctagcaggcagcagcccaccaacctcacgggccagcaat tacgagtccttctaaaaagctcccgccgaggggcgctggcgctgctgtgcagcagcacgtctaacattagtcccacctcgccagtttacagggagcagaaccagcttataagcggaggcgcggcaccaagaagc This invention involves designing target sites on primers, obtaining MT-sgRNA via PCR, and then ligating it into a basic vector via enzyme digestion. The specific construction process is as follows: (1) Design of target gRNA. ZmHDZIV4 ( Zm00001d030069 The gene sequence of the gene was input into http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR for target design. This invention selects two target regions at the second exon of the gene, and the target DNA sequences are shown in SEQ ID NO.3 and SEQ ID NO.4. The sgRNA backbone sequence of this invention is derived from the intermediate vector. pCBCmT1T2 Obtained by direct amplification.
[0038] (2) MT-sgRNA was obtained by designing target sites on primers and then amplifying it by PCR. Primers ZmHDZIV4 -MT1-F and primers ZmHDZIV4 -MT2-R amplification intermediate vector pCBCmT1T2 This was used to obtain sgRNA fragments containing the first and second targets, with a product length of 891 bp. The PCR system and conditions are as follows: template DNA (intermediate vector)pCBCmT1T2 ≥30 ng / μL) 1.2 μL; Primer F / R: 1.2 μL each; Sterile ddH₂O: 11.4 μL; 2X MCLAB enzyme (product number: I5HM-200): 15 μL. The PCR reaction program is as follows: ① 98℃ for 2 minutes; ② 98℃ for 10 seconds; ③ 58℃ for 30 seconds; ④ 72℃ for 30 seconds; ⑤ Cycle 34 times from ② to ④; ⑥ 72℃ for 5 minutes; ⑦ 25℃ for 10 minutes. Finally, recover the PCR product. The primer sequences required for vector construction are as follows: ZmHDZIV4-MT1-F (SEQ ID NO.15): 5'-ATATATGGTCTCTGGCGATTAACGTAGTCTATCAGGAGTTTTAGAGCTAGAAATAGCAA-3' ZmHDZIV4-MT2-R (SEQ ID NO.16): 5'-ATATATGGTCTCTGGCGATTAACGTAGTCTATCAGGAGTTTTAGAGCTAGAAATAGCAA-3' (3) Construct the backbone vector by enzyme digestion and ligation. pBUE411-Cas9 Vectors and recovered target-carrying sgRNA fragments are used Bsa Digestion was performed, and T4 ligase was added to ligate the vector and sgRNA fragment. The 15 μL digestion and ligation system is as follows: sgRNA fragment: 2 μL. pBUE411-Cas9 Vector (≥60 ng / μL): 2 μL, 10x NEB Buffer: 1.5 μL Bsa I endonuclease (product number: #R3733S): 1μL, T4 ligase (product number: #M0202M): 1μL, sterile ddH2O: 6μL.
[0039] Figure 2 The target gene is shown. ZmHDZIV4 ( Zm00001d030069 Dual targets (corresponding to the first and second targets), marker genes Cas9 and bar With skeleton carrier pBUE411-Cas9 Constructed expression carrier pCas9- ZmHDZIV4 .
[0040] 2. Agrobacterium-mediated genetic transformation of maize The above-constructed pCas9-ZmHDZIV4The vectors were transferred into Agrobacterium EHA105 via heat shock and identified by PCR. The bacterial culture was then stored at -80°C with glycerol. Freshly peeled immature embryos (approximately 1.5 mm in size) of maize hybrid B104 were used as recipient material. The peeled embryos were placed in 2 mL plastic centrifuge tubes containing 1.8 mL of suspension for no more than one hour, with approximately 100 embryos per tube. The suspension was removed, and the embryos were washed twice with fresh suspension, leaving a small amount at the bottom of the tube to submerge them. The tubes were then heat-shocked at 43°C for 2 minutes, followed by an ice bath for 1 minute. The remaining wash solution was aspirated from the tube bottom, and 1.0 mL of Agrobacterium infection solution was added. The tubes were gently shaken for 30 seconds and then incubated in the dark for 8 minutes. Next, the embryos and infection solution were poured onto a co-culture medium, mixed well, and excess infection solution was aspirated with a pipette. All embryos were cultured with their scutes facing upwards at 23°C in the dark for 3 days. After co-culture, the immature embryos were transferred to recovery medium using sterile forceps and cultured at 28°C for 7-14 days, during which time any emerging shoots should be removed promptly. After recovery culture, the immature embryos were placed on 1.5 mg / L Bialaphos selection medium for three rounds of selection, each round lasting two weeks, and then transferred to 2 mg / L Bialaphos selection medium for two rounds of selection, each round lasting two weeks. The resistant callus was transferred to propagation medium and cultured in the dark at 28°C for two weeks. Subsequently, the propagated resistant callus was transferred to induction medium and cultured in the dark at 28°C for two weeks. Then, it was transferred to differentiation medium and cultured under light at 25°C and 5000 lx for two weeks. After culture, the differentiated seedlings were separated into individual seedlings and placed in rooting medium at 25°C and 5000 lx under light until rooting. The seedlings were then transferred to small nutrient pots for growth. After successful growth, they were transplanted into a greenhouse, and the offspring seeds were harvested after 3-4 months.
[0041] 3. Detection of CRISPR / Cas9 mutation results in T0 generation plants To determine the CRISPR / Cas9 mutation results in T0 generation plants, the following steps were taken: This invention first uses the CTAB method to extract DNA from maize leaves. The specific method is as follows: Cut seedling leaves approximately 2 cm in length and place them in a 2 mL centrifuge tube containing steel balls; immerse the centrifuge tube containing the leaves in liquid nitrogen for 5 minutes, then crush the leaf sample using a grinder; add 700 μL of CTAB extraction buffer (containing 1% β-mercaptoethanol) to the centrifuge tube and mix vigorously; preheat in a 65°C constant temperature water bath for 20-30 min (during which time remove and invert 1-2 times, paying attention to the correspondence of the experimental sample numbers); after the centrifuge tube cools to room temperature, add 700 μL of chloroform:isoamyl alcohol (24:1) extraction solution, shake vigorously for 30 seconds, and then let stand at room temperature for a short time; centrifuge at 12000 rpm for 5 min at 4°C, and take 500 μL of the centrifuged sample. Add μL of supernatant to a new 1.5mL centrifuge tube; add an equal volume of isopropanol to the tube containing the supernatant and gently vortex to mix. Let stand at room temperature for about 10 minutes; then place the centrifuge tube containing the sample in a 4℃ centrifuge at 12000rpm for 10 minutes. Gently aspirate the supernatant, discard it, and retain the precipitate; add 800μL of 75% ethanol, wash the precipitate twice, centrifuge at 10000rpm for 5 minutes, and discard the supernatant; allow the sample to air dry at room temperature for 2-4 hours to obtain DNA precipitate. Add an appropriate amount of sterile water to dissolve the DNA, and gently vortex to fully dissolve the DNA. Store the DNA sample at -20℃. Detect the DNA concentration using Nanodrop and dilute to 10 ng / L for use as a PCR template.
[0042] Then according to ZmHDZIV4 ( Zm00001d030069 ) Design PCR primers based on gene sequence.
[0043] (1) Detection targets: MT1 and MT2; Product size: 939 bp; Primer sequences are as follows: ZmHDZIV4-TF (SEQ ID NO.17): 5'-TTTTCCCTTTCCTACACCTCT-3'; ZmHDZIV4-TR (SEQ ID NO. 18): 5'-CGGGCACTCCTTGAACAGC-3'.
[0044] Genomic DNA was extracted and amplified using the following PCR parameters: Reaction system: 15 μL MIX conventional PCR system, 0.5 μL forward primer, 0.5 μL reverse primer, 1 μL DNA, 5.5 μL sterile ddH2O, 7.5 μL 2x Taq mix (product number: 10103ES).
[0045] Reaction procedure: Conventional PCR: annealing at 58℃, extension for 1 minute, 32 cycles.
[0046] Next, the PCR product was recovered and ligated into a T vector for sequencing. By sequencing the DNA sequences of target regions of multiple T0 generation independent positive transformation events, it was determined whether gene editing had occurred in the target regions. Ultimately, the proportion of gene editing was found to reach 75% in Cas9 positive seedlings, and the editing efficiency was significantly improved compared to the same promoter. The sequences of the three selected suitable T0 transformation event target regions changed, and all were homologous mutations. The sequences before and after editing are as follows: Figure 3 As shown, there are 3 corresponding ones. ZmHDZIV4 Homologous mutants: ZmHDZIV4-Cas9-1 , ZmHDZIV4-Cas9-2 , ZmHDZIV4-Cas9-3 Sequence alignment with wild type showed... ZmHDZIV4-Cas9-1 Deletion mutations occurred at targets 1 and 2, as well as in the intervening DNA fragments. ZmHDZIV4-Cas9-2 Insertion mutations occurred at targets 1 and 2, as well as in the intervening DNA fragments. ZmHDZIV4-Cas9-3 Insertion and deletion mutations occurred at targets 1 and 2.
[0047] For 3 ZmHDZIV4 Comparative analysis of the amino acid sequences in the mutant revealed that, compared with the unedited WT, the mutant strain... ZmHDZIV4-Cas9-1 The large deletions of the encoded nucleotides at targets 1 and 2 caused frameshift mutations in their amino acids, and subsequent amino acid generation terminated prematurely. ZmHDZIV4-Cas9-2 The insertion of the encoded nucleotide at targets 1 and 2 caused frameshift mutations in the encoded amino acids, leading to premature termination of translation. ZmHDZIV4- Cas9-3 Insertion and deletion of nucleotides encoded in the strain at targets 1 and 2, respectively, caused frameshifts in amino acids, leading to premature termination of translation. Therefore, the Zm00001d030069 protein was functionally lost in these transformants.
[0048] 4. Genotyping of F1 generation plants Because greenhouse-grown T0 generation maize plants often exhibit uncoordinated development of female and male ears, and because fertility is also affected when the edited gene is associated with male development, this invention uses wild-type pollen from the maize inbred line B104 as the genetic material for propagating T0 generation plants and ensuring the inheritance of the obtained gene-edited type. ZmHDZIV4-Cas9-1 , ZmHDZIV4-Cas9-2 , ZmHDZIV4-Cas9-3 The T0 generation plants are pollinated to obtain F1 generation seeds, and the resulting plants are F1 generation plants.
[0049] The F1 generation plants consist of two segregating types: Cas9-positive plants (transgenic plants) and Cas9-negative plants (non-transgenic plants). To avoid continuous editing of the B104 wild-type allele introduced by hybridization by sgRNA and Cas9, which would lead to complex mutation types, we need to select plants from the F1 generation that do not contain the Cas9 gene but contain the T0 generation mutation type through genotyping. These plants can be self-crossed to obtain non-transgenic F2 generation plants. The genotyping steps for the F1 generation plants are as follows: After extracting leaf DNA using the CTAB method described above, PCR amplification was first performed using the specific primers for the Cas9 gene: Cas9-F (SEQ ID NO. 19): 5'-CCCGGACAATAGCGATGT-3' and Cas9-R (SEQ ID NO. 20): 5'-GATGGGCCGACGTAGTA-3'. The PCR reaction system was the same as above; the reaction procedure was: conventional PCR: annealing at 58℃, extension for 1 minute, 32 cycles. After agarose gel electrophoresis of the PCR products, Cas9-positive and Cas9-negative plants were distinguished based on the results.
[0050] Further targeting Cas9-negative plants, PCR amplification was performed using the primers ZmHDZIV4-TF and ZmHDZIV4-TR, which are used to detect MT1 and MT2 targets. After purification of the PCR products, they were ligated into a T vector and sequenced. The genetic information of the mutation type in the F1 generation was determined based on the sequencing results.
[0051] Example 3 hdziv4 Phenotypic analysis of sterile lines The F1 generation plants without the Cas9 gene identified in Example 2 above were self-pollinated to obtain F2 generation seeds, and three types of seeds were obtained. ZmHDZIV4 Mutation type ( ZmHDZIV4-Cas9-1 , ZmHDZIV4-Cas9-2 and ZmHDZIV4-Cas9-3 One self-pollinated single ear from each F2 line was sown in panicle rows, and phenotypic analysis was conducted at maturity. In all three F2 lines, the ratio of fertile to sterile plants conformed to a 3:1 segregation, further indicating... ZmHDZIV4 The sterility trait in the sterile line is controlled by a single recessive gene, and then stable non-transgenic lines are obtained by targeting the F2 generation. hdziv4 A detailed phenotypic comparison was conducted between the sterile line and the wild type.
[0052] Observation of the viability of male spikes, anthers, and pollen: Regarding vegetative growth and female spike development, hdziv4 Sterile line ( ZmHDZIV4-Cas9-1 , ZmHDZIV4-Cas9-2 and ZmHDZIV4-Cas9-3 The plants of this variety are essentially no different from the wild type; however, in terms of tassel development, hdziv4Although the sterile line can produce males normally, it cannot flower normally, and the anthers and glumes do not split open at all. Figure 4 Further I2-KI staining of pollen from wild-type and mutant plants revealed that wild-type pollen developed normally and turned black after staining, while the mutant plants did not form pollen grains. Figure 4 This indicates that... ZmHDZIV4 (Zm00001d030069 Genes control male development in maize, and males created through gene editing methods... hdziv4 The sterile line is a pollen-free sterile line, exhibiting complete sterility.
[0053] Example 4 hdziv4 Development and application of cosegregating molecular markers for the identification of sterile lines
[0054] 1. Development of co-separated molecular markers In this invention, for the three obtained hdziv4 The mutation sites of the sterile lines were identified by primer design using Primer 5.0 software, and two pairs of co-segregating molecular markers, ZmHDZIV4-F / R and ZmHDZIV4-PF / R, were developed. The genotypes of the mutants were then isolated based on the obtained bands and their size by combining PCR with agarose gel electrophoresis and polyacrylamide gel electrophoresis.
[0055] The co-separating molecular marker ZmHDZIV4-F / R comprises a first primer ZmHDZIV4-F and a second primer ZmHDZIV4-R. This marker can specifically detect maize. ZmHDZIV4-Cas9-1 Mutants and mutant genes in maize male-sterile materials derived from them ZmHDZIV4 And can distinguish between wild type at the same time. ZmHDZIV4 Genes and mutants ZmHDZIV4 Genes, targeting mutated genes ZmHDZIV4 The marker amplified bands of 939 bp and 480 bp respectively, while a 939 bp band was amplified for the wild-type HDZIV4 gene; ZmHDZIV4-PF / R consists of the first primer ZmHDZIV4-PF and the second primer ZmHDZIV4-PR, and this marker can specifically detect maize. ZmHDZIV4-Cas9-2 The mutant gene in the -3 mutant and the maize male-sterile material derived from it. ZmHDZIV4 And can distinguish between wild type at the same time. ZmHDZIV4 Genes and mutants ZmHDZIV4 Genes; targeting mutated genes ZmHDZIV4 The medium-sized cells could amplify bands of 54bp and 55bp respectively, while the wild-type cells could not. HDZIV4 The gene amplified into a 54 bp band. The primer sequences are as follows: ZmHDZIV4-F (SEQ ID NO.5): 5'-TTTTCCCTTTCCTACACCTCT-3' ZmHDZIV4-R (SEQ ID NO.6): 5'-CGGGCACTCCTTGAACAGC-3' ZmHDZIV4-PF (SEQ ID NO.7): 5'-CTTCATCCCCAACCCAGGCG-3' ZmHDZIV4-PR (SEQ ID NO.8): 5'-GCGGCGGAGGAGGAGGACAT-3'
[0056] 2. Application of co-separated molecular markers To verify the effectiveness of the above-mentioned markers, the F2 strain obtained in Example 3 was used as material for testing. ZmHDZIV4 Allele detection. The DNA extraction method, PCR amplification system and conditions are the same as in Example 2. The PCR products are separated by PAGE or agarose gel electrophoresis.
[0057] Theoretically, ZmHDZIV4-F / R and ZmHDZIV4-PF / R in ZmHDZIV4 In homozygous wild-type (AA) DNA, bands of 939 bp and 54 bp were amplified, respectively. hdziv4 / hdziv4 In the homozygous mutant material (aa), bands of 480 bp and 55 bp were amplified, respectively, while... HDZIV4 / hdziv4 In the heterozygous (Aa) material, the corresponding two bands can be amplified simultaneously. The validation results of the ZmHDZIV4-F / R molecular marker are shown in Figure 5, and the validation results of the ZmHDZIV4-PF / R molecular marker are shown in Figures 6 and 7. The results show that the detection results of the three designed functional molecular markers on the F2 plants are completely in line with expectations. HDZIV4 / HDZIV4 Homozygous wild type (AA) HDZIV4 / hdziv4 Heterozygous (Aa) and The mutant material (aa) amplified bands of corresponding sizes, which can be used as... An ideal marker for allele detection.
[0058] These molecular markers help identify mutant genotypes before flowering and pollination, enabling hybridization and backcrossing to breed male-sterile lines under different genetic backgrounds, and have important application value.
[0059] References
[0060] [1] Huang Bao. Current status, challenges and prospects of maize seed industry development in my country [J]. Seed Science and Technology, 2022, 40(21):133-135. DOI:10.19904 / j.cnki.cn14-1160 / s.2022.21.045. [2] Sun Qingquan, Rong Tingzhao. Research on male sterile maize material and its application in molecular breeding [J]. Bulletin of Botany, 2003, (02): 248-253. DOI:CNKI:SUN:ZWXT.0.2003-02-016. [3] Yin Xiangjia, Zhai Chen, Li Jing, et al. An overview of the application of CRISPR / Cas9 gene editing technology in maize molecular breeding [J]. China Seed Industry, 2023, (06): 15-19. DOI: 10.19462 / j.cnki.1671-895x.2023.06.002.
Claims
1. A method for creating male-sterile maize lines, characterized in that, Inhibiting the expression and / or activity of the protein encoded by the fertility gene in the maize genome, thereby causing the fertility gene to lose its function, yields a male-sterile maize line; the fertility gene is... ZmHDZIV4 The gene, whose nucleotide sequence is shown in SEQ ID NO.1, and whose amino acid sequence encodes the protein is shown in SEQ ID NO.
2.
2. The method for creating a male-sterile maize line according to claim 1, characterized in that, The methods for inhibiting protein expression and / or activity include any one of gene editing, RNA interference, and T-DNA insertion.
3. The method for creating a male-sterile maize line according to claim 2, characterized in that, The gene editing was performed using the CRISPR / Cas9 method.
4. The CRISPR / Cas9 method according to claim 3, characterized in that, The transcription of the genes encoding MT1-gRNA and MT2-gRNA in this CRISPR / Cas9 system was initiated using two different promoters, OsU3 and TaU3.
5. The method for creating a male-sterile maize line according to claim 3, characterized in that, exist ZmHDZIV4 Two CRISPR / Cas9 vector targets were designed at the second exon of the gene; the DNA sequences of the targets are shown in SEQ ID NO.3 or SEQ ID NO.
4.
6. A way to obtain hdziv4 The method for male-sterile lines is characterized by, Obtained by any of the methods described in claims 1-5 hdziv4 Male-sterile lines are hybridized and backcrossed with target materials to obtain the desired results. hdziv4 Male infertility traits and gene mutations.
7. Obtained by the method of claim 6 hdziv4 Application of male-sterile lines in hybridization breeding and seed production.
8. The application according to claim 7, wherein the hybridization breeding and seed production refers to the process of... hdziv4 Male-sterile lines are used as the female parent to cross with other male parents.
9. The application according to claim 8, including obtaining hdziv4 Male-sterile lines are hybridized and backcrossed with other target materials to obtain the desired results. hdziv4 Male infertility traits and gene mutations.
10. The application according to claim 9, developed for the purpose of... hdziv4 In male-sterile lines hdziv4 Molecular markers for male sterility genes, used for hdziv4 Molecular marker-assisted selection during hybridization and backcrossing of male-sterile lines with other target materials; characterized in that, The developed molecular markers include primers ZmHDZIV4-F and ZmHDZIV4-R, ZmHDZIV4-PF and ZmHDZIV4-PR, with sequences shown in SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7 and SEQ ID NO. 8, respectively.
Citation Information
Patent Citations
Male sterility gene ZmMYB84 and application of male sterility gene ZmMYB84 in creation of male sterility line of maize
CN113005128A
Maize msp1 male sterile line created by using artificial mutation
CN116875580A