SNP molecular marker related to shell length characteristics of mytilus coruscus and application thereof

Abstract

The invention belongs to the technical field of biological application, and particularly relates to a mytilus coruscus shell length characteristic related SNP molecular marker and application thereof. The nucleotide sequence of the SNP molecular marker related to the shell length characteristic of mytilus coruscus is as shown in SEQ ID NO: 1, and the mutation type is C / A mutation. The development method of the molecular marker comprises the following steps: collecting a mytilus coruscus sample, measuring phenotypic data of the shell length of the sample, combining with whole genome association analysis, screening out SNP candidate sites obviously associated with the shell length characteristic, designing specific primers, and finally determining the associated SNP marker through two-stage analysis of primary screening and cross-population verification by utilizing PCR amplification and a first-generation sequencing technology. According to the invention, a mytilus coruscus shell length characteristic SNP marking system is established, the cost is greatly reduced compared with that of traditional chip detection, and false positive interference is eliminated through large sample verification. The screening and verification method of the SNP molecular marker can be used for molecular marker-assisted breeding, accelerates breeding of improved varieties of mytilus coruscus, and provides technical support for genetic mechanism analysis of growth traits of mytilus coruscus.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological application, and particularly relates to a SNP (Single Nucleotide Polymorphism) molecular marker related to the shell length of Mytilus coruscus and application thereof. BACKGROUND

[0002] Mytilus coruscus is a bivalve mollusk widely distributed in the coastal waters of the northwest Pacific temperate zone. Its species characteristics and nutritional value make Mytilus coruscus occupy an important position in the Chinese aquaculture market of bivalve mollusks. It is an important marine economic bivalve mollusk in China, and its growth traits directly affect the breeding efficiency and industry development. The shell length of Mytilus coruscus is a key indicator for measuring growth performance, and is closely related to individual development speed, biomass accumulation and breeding cycle. In large-scale breeding production, fast-growing superior varieties can significantly shorten the breeding cycle, reduce production costs and improve economic efficiency.

[0003] At present, the genetic improvement of Mytilus coruscus mainly relies on traditional breeding methods, and the growth advantage individuals are obtained through phenotype measurement and multi-generation screening. This method has obvious limitations. First, the breeding cycle is long, and it usually takes 3-5 generations to obtain a stable strain. Environmental factors such as water temperature, feed and salinity can significantly affect the results of phenotype measurement. Moreover, the efficiency of manual screening is low, which cannot meet the demand for superior varieties in modern aquaculture.

[0004] With the development of molecular marker technology, SNP (Single Nucleotide Polymorphism) markers have become an important tool for quantitative trait genetic analysis due to their abundance, wide distribution and good stability. In the study of bivalves, SNP markers have been successfully applied to the genetic analysis of important economic traits such as growth and stress resistance. However, systematic studies on the shell length of Mytilus coruscus are still insufficient. The existing researches are mainly limited to specific geographical populations, lack of representation, and the sample size is generally small, the statistical power is insufficient, and the marker verification system is not perfect, and the practicability needs to be improved.

[0005] Genome-wide association analysis (GWAS) provides a new technical path for analyzing the genetic basis of shell length. This method can efficiently identify molecular markers with breeding value by scanning SNP sites associated with target traits in the whole genome. However, the related researches on Mytilus coruscus still face challenges. On the one hand, the genetic mechanism of growth traits is complex and is regulated by multiple genes. On the other hand, the interaction effect between environment and genes is significant, which increases the difficulty of research.

[0006] The patent CN119899845A provides a Mytilus coruscus byssal thread adhesion protein gene Mfp5 coding region SNP marker and its application. The primer designed according to the gene sequence of the coding region of McMfp5 is used for SNP marker typing. The primer is specific, stable in amplification and high in polymorphism, and can be used for genetic diversity analysis, germplasm identification and marker-assisted selection breeding of Mytilus coruscus, and provides a powerful tool for genetic breeding of Mytilus coruscus. However, the patent only designs a primer for the gene sequence of the coding region of McMfp5 and marks and breeds, and in the actual application process, people pay great attention to the shape related to the shell length of Mytilus coruscus, and the application does not have a screening method for the shell length shape.

[0007] In view of the above bottleneck, the application integrates multiple geographical population samples, adopts an extreme phenotype grouping strategy, and combines high-throughput SNP typing technology to screen molecular markers with breeding application value. The application will provide new technical support for genetic improvement of Mytilus coruscus, and has important significance for promoting the quality and efficiency of the industry. SUMMARY

[0008] In order to make up for the shortcomings of the prior art, the application aims to provide a technical scheme of a Mytilus coruscus shell length characteristic related SNP molecular marker and its application, which can be applied in the field of aquaculture. The specific technical scheme of the application is as follows:

[0009] In the first aspect, the application provides a Mytilus coruscus shell length characteristic related SNP molecular marker. The nucleotide sequence of the molecular marker is shown in SEQ ID NO: 1, and the mutation type is C / A mutation.

[0010] The SEQ ID NO: 1 of the application is 50 ATCTTGTTCCACAAATCTTACACTTATGTCATCTGAAATAATC / AAATTCATACACTAATAGTTTTCTGAAAGAAAAAAAATTACACTTATGTCATCTAAA 150.

[0011] In the second aspect, the application provides application of the Mytilus coruscus shell length characteristic related SNP molecular marker in Mytilus coruscus breeding.

[0012] In the third aspect, the application provides application of the Mytilus coruscus shell length characteristic related SNP molecular marker in screening of shell length characteristic phenotype individuals.

[0013] In the fourth aspect, the application provides a Mytilus coruscus shell length characteristic related SNP molecular marker development method, which comprises the following steps:

[0014] S.1. Collecting Mytilus coruscus samples;

[0015] S.2. Measuring shell length phenotype data of the samples;

[0016] S.3Screening out SNP candidate sites significantly associated with shell length characteristics in combination with whole genome association analysis GWAS;

[0017] S.4. Designing specific primers, using PCR amplification and first-generation sequencing technology;

[0018] S.5. Finally determining the associated SNP markers through two-stage analysis of preliminary screening and cross-population verification.

[0019] In the S.1 step of the present application, 120 Mytilus coruscus samples are collected from four sea areas of Zhejiang Shengsi, Fujian Lianjiang, Jiangsu Lianyungang and Fujian Xiamen.

[0020] In the S.2 step of the present application, the shell length data of the 120 samples are measured using a vernier caliper, the data are arranged, and the four-quartile method is used to divide them into four parts, the samples in the lower four-quartile are the low shell length group, and the samples in the upper four-quartile are the high shell length group, which are used for subsequent statistics and whole genome association analysis.

[0021] In the S.3 step of the present application, the sample adductor muscle tissue DNA is extracted, the whole genome SNP typing is performed using the genome resequencing technology, and the SNP variation sites are obtained. The variation site vcf file is combined with the phenotype data to perform genotype-phenotype association analysis by using the mixed linear model (MLM), and the SNP candidate sites and the mutation type C / A of the Mytilus coruscus shell length characteristics are obtained.

[0022] In the S.4. step of the present application, after the gel electrophoresis detection, the SNP site genotype CC / CA / AA is obtained.

[0023] Further, the nucleotide sequence of the specific primer in the S.4. is shown in SEQ ID NO: 2-3.

[0024] The forward primer of the specific primer in the present application is F: CCAACACCAACCTGTCTATGGA, the reverse primer is R: CGTTTGGACTTCAGATGACACA, the length of the amplified fragment is 300 bp, and the annealing temperature is 56℃.

[0025] Further, the nucleotide sequence of the identification primer of the Mytilus coruscus shell length characteristic related SNP molecular marker is shown in SEQ ID NO: 2-3.

[0026] Further, the application of the identification primer in identifying the Mytilus coruscus shell length characteristic related SNP molecular marker is shown in SEQ ID NO: 1.

[0027] The beneficial effects of the present application mainly embody in:

[0028] (1) The present application screens out SNP candidate sites significantly associated with shell length characteristics by collecting Mytilus coruscus samples, measuring shell length data by using vernier caliper, and using quartile method for grouping, combined with genome-wide association analysis (GWAS); further designs specific primers, adopts PCR amplification and first-generation sequencing technology, and finally determines SNP markers (p<0.05) stably associated through two-stage analysis of preliminary screening (120 individuals) and cross-population verification (200 individuals). A low-cost typing system of Mytilus coruscus shell length characteristic SNP markers is established, which greatly reduces the cost compared with traditional chip detection, and false positive interference is excluded through large sample verification.

[0029] (2) The screening and verification method of the SNP molecular marker can be directly used for molecular marker assisted breeding, accelerates the breeding of Mytilus coruscus fast-growing fine varieties, and provides technical support for the genetic mechanism analysis of Mytilus coruscus growth traits.

[0030] (3) The present application is simple to operate, high in practicability, low in cost, and beneficial to be used in actual production process. BRIEF DESCRIPTION OF DRAWINGS

[0031] Figure 1 It is a gel running map for verification of the pcr amplification product of the primer, 1: target gene; M: 2000bp DNA Marker.

[0032] Figure 2 It is a Mytilus coruscus species map.

[0033] Figure 3 It is a shell length data frequency histogram of 120 samples.

[0034] Figure 4 It is a Manhattan plot of GEMMA model of shell length trait association analysis.

[0035] Figure 5 It is a forward sequencing peak plot of SNP site. DETAILED DESCRIPTION

[0036] The following describes the embodiments of the present application through specific specific examples, and those skilled in the art can easily understand other advantages and effects of the present application from the disclosure of the present specification. The present application can also be implemented or applied by different specific embodiments, and various modifications or changes can be made based on different views and applications without departing from the spirit of the present application. It should be noted that the following examples and features in the examples can be combined with each other without conflict. The methods used in the present application embodiments are conventional methods, and the reagents used can be obtained from commercial channels.

[0037] In order to make the purpose, technical solutions and advantages of the present application clearer, the present application will be further described in detail below in combination with the drawings and specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and not to limit the present application.

[0038] Example 1: Sample collection and shell length data acquisition

[0039] 1. Sample collection and pretreatment

[0040] Sampling area: A total of 120 adult Mytilus coruscus were collected from four sea areas of Zhejiang Shengsi, Fujian Lianjiang, Jiangsu Lianyungang and Fujian Xiamen, and stored and transported to the laboratory in an ice box.

[0041] 2. Phenotype recording: Measure the shell length of each sample (vernier caliper, accuracy 0.01 mm).

[0042] Grouping standard: The shell length data of the 120 samples obtained were arranged, and the quartile method was used to divide them into four parts, and 30 samples in the lower quartile were selected as the low shell length group, and 30 samples in the upper quartile were selected as the high shell length group.

[0043] 3. Data recording

[0044] Phenotype control and statistics: The measured shell length data were statistically analyzed (Table 1).

[0045] Table 1: Statistical results of SNP site genotypes of low shell length group and high shell length group in the preliminary screening stage (with chi-square test results)

[0046]

[0047] Example 2: Mytilus coruscus resequencing extraction

[0048] Step 1: Sample lysis treatment

[0049] (1) Add pre-cooled lysis buffer GHA and proteinase K (Proteinase K) to the sample powder ground with liquid nitrogen in turn, and immediately mix thoroughly for 15 seconds using a vortex shaker.

[0050] (2) Transfer the mixed solution to a centrifuge tube and incubate in a 65°C constant temperature water bath for 15 minutes, and gently invert the centrifuge tube 3-5 times every 5 minutes during the incubation to promote complete lysis of the tissue.

[0051] Step 2: Impurity separation

[0052] (1) Centrifuge the centrifuge tube at 12000 rpm (about 13,400 x g) for 5 minutes to precipitate the unlysed tissue fragments and impurities.

[0053] (2) Use a pipette to aspirate the supernatant and transfer it to the corresponding well of a 96-well deep well plate (labeled as plate A) in the order of sample number.

[0054] (3) Inject an equal volume of isopropyl alcohol and lysis enhancement solution GHL (isopropyl alcohol and GHL can be premixed in proportion before adding) into each well of plate A.

[0055] Step 3: Construction of binding system

[0056] (1) Prepare plates B and E respectively:

[0057] Plate B: Quantitatively add binding buffer GDZ (confirm that anhydrous ethanol has been added in proportion before use) to the wells in order; Plate E: Simultaneously inject GDZ buffer of the same formula, and cover with a sealing film for standby.

[0058] (2) Prepare magnetic bead purification plate:

[0059] Plate C: Add ethanol-containing rinse solution PWD to each well in turn (shake the magnetic bead suspension for 30 seconds before use to ensure uniformity), and insert a magnetic sleeve rod; Plate F: Inject the same formula PWD rinse solution and store it sealed for standby; Plate D: Quantitatively add elution buffer TB to each well and cover with a sealing film for standby.

[0060] Step 4: Automatic purification operation

[0061] (1) Place plates A, B, C, D, E, and F in the designated card slot of the TIANGEN S96 nucleic acid purifier in order;

[0062] Start the preset program to complete the DNA binding, rinsing, and elution steps in order (the system automatically controls liquid transfer and magnetic bead adsorption).

[0063] Step 5: Product storage and record

[0064] (1) After elution, transfer the DNA solution in plate D to a sterile EP tube and label the following information:

[0065] Abbreviation of project name; last three digits of project number; sample batch code; extraction date (year, month, day).

[0066] (2) Store the DNA sample in a special storage box (such as Table 2) in a -80°C ultra-low temperature refrigerator for long-term storage.

[0067] (3) Fill out the experimental record table and register the processing parameters and quality control results of each batch of samples in detail.

[0068] Table 2 Kit composition

[0069]

[0070] Example 3: Resequencing library construction standardized operation procedure

[0071] I. Genomic DNA fragmentation treatment

[0072] (1) Pre-cooling system start

[0073] Turn on the circulating water cooling device before the experiment, set the temperature to 4°C, and wait for the water temperature to stabilize before use.

[0074] (2) DNA mechanical shearing

[0075] Take a certain amount of genomic DNA (accurately measured by Qubit), add 0.6 mL to the import centrifuge tube, and use 1x TE buffer to dilute to 100 μL (all operations on ice).

[0076] Symmetrically load the centrifuge tube with 0.65 mL of adapter and tighten, start the ultrasonic disrupter according to the preset program (based on target fragment 350 bp) for DNA fragmentation.

[0077] (3) Fragment distribution detection

[0078] Centrifuge briefly to collect the fragmented product, take 1 μL of the product for agarose gel electrophoresis (1.5% gel, 120V, 20min), and confirm that the main band is concentrated in the 300-400 bp interval.

[0079] (4) Magnetic bead purification of DNA fragments

[0080] Place the Nuzyne DNA purification magnetic beads in room temperature for 30 min in advance.

[0081] Transfer the remaining fragments to a 1.5 mL centrifuge tube, add 1x volume of magnetic bead suspension, and mix gently.

[0082] Mix at room temperature for 5 min, then centrifuge briefly and place in the magnetic stand for 5 min, then discard the supernatant.

[0083] Add 200 μL of freshly prepared 80% ethanol (pre-cooled), stand for 30 s, then discard the liquid, and repeat the washing once.

[0084] Centrifuge briefly, then aspirate the residual ethanol, and dry at room temperature with the lid open until the magnetic bead surface is matte and slightly cracked.

[0085] Add 20 μL of 0.1x TE buffer, resuspend the magnetic beads by blowing and sucking, and after standing for 5 min, separate the magnetic beads, and transfer the supernatant to a new PCR tube.

[0086] II. DNA end repair and dA tail addition

[0087] (1) Add End Repair Reaction Buffer and End Repair Enzyme Mix to the purified product, vortex well, and then centrifuge.

[0088] (2) Place the reaction tube in a PCR instrument, and complete end repair and dA tailing according to the program (20°C for 30 min→65°C for 30 min→4°C hold) to immediately proceed to the next step.

[0089] III. Sequencing adapter ligation

[0090] (1) Inject Ligation Mix and T4 DNA Ligase into the repaired product, mix well, and then centrifuge.

[0091] (2) Incubate in a metal bath at 20°C for 15 min to complete the adapter ligation reaction.

[0092] IV. Sorting and purification of the ligation product fragments

[0093] (1) Initial magnetic bead screening

[0094] Add 0.65 volumes of magnetic bead suspension, mix well, and then stand at room temperature for 5 min. Discard the supernatant after magnetic separation.

[0095] Wash twice with 80% ethanol (200 μL each time), dry, and then elute the DNA with 20 μL of 0.1×TE.

[0096] (2) Secondary magnetic bead screening

[0097] Add 0.15 volumes of magnetic beads to the eluate, mix well, and then stand for 5 min. Discard the supernatant after magnetic separation.

[0098] Repeat the ethanol washing and drying steps, and finally elute the target DNA (350±50 bp) with 15 μL of 0.1×TE and transfer to a new tube.

[0099] V. Library PCR amplification

[0100] (1) Reaction system construction

[0101] Mix high-fidelity DNA polymerase, dNTPs, amplification primers, and template DNA according to the proportions, vortex well, and then centrifuge.

[0102] (2) Amplification program setting

[0103] PCR instrument operating conditions: 98°C for 30 s→[98°C for 10 s, 60°C for 30 s, 72°C for 30 s]×8 cycles→72°C for 5 min→4°C hold.

[0104] Six, purification of the amplified product

[0105] (1) Magnetic bead enrichment of target DNA

[0106] Add 0.8 times the volume of magnetic bead suspension to the PCR product, mix well, and stand at room temperature for 5 min, then discard the supernatant after magnetic separation.

[0107] (2) Wash twice with 80% ethanol, dry, and then elute the library DNA with 20 μL of 0.1 x TE.

[0108] (3) Transfer the purified product to a 1.5 mL centrifuge tube and store at -20°C for testing.

[0109] Seven, library quality assessment

[0110] (1) Segment distribution verification: Take 1 μL of the library for Agilent 2100 bioanalyzer detection to confirm that the main peak is located at 350 bp ± 10%.

[0111] (2) Quantification and dilution: Use Qubit to determine the library concentration and dilute to 1-2 ng / μL according to the requirements of the sequencing platform.

[0112] Example 4: Sequencing and data analysis

[0113] 1. Sequencing strategy: Illumina NovaSeq platform, PE150 double-end sequencing, data volume ≥ 1 Gb per sample.

[0114] 2. SNP typing process:

[0115] (1) Data filtering: remove low-quality reads (Q20 < 90%) and reads with N content > 5%.

[0116] (2) Align the reference genome: use BWA software to align the reads to the Mytilus edulis reference genome.

[0117] (3) SNP Calling: GATK HaplotypeCaller identifies SNP sites, filtering criteria: depth ≥ 10 x, MAF ≥ 0.05, and deletion rate ≤ 10%.

[0118] 3. Association analysis:

[0119] (1) Phenotype data: import the phenotype data of shell length traits.

[0120] (2) Model selection: mixed linear model (MLM) to correct population structure (PCA results) and kinship (K matrix).

[0121] (3) Significance judgment: fixed threshold -log10(p) = 5 as the significant threshold, Manhattan plot visualizationFigure 4 ).

[0122] Example 5: Genome-wide association study (GWAS)

[0123] Genome-wide association study was performed using GEMMA (lm and lmm model), FaST-LMM, EMMAX software combined with phenotype and genotype data. The Pvalue calculated by genome-wide association study was further plotted into Manhattan and QQ quantile plots. The threshold value of candidate screening was divided by the number of effective marker sites after the above quality control as a given threshold value. In order to dig out more potential candidate intervals, the value within the fixed-log10(p) = 5 was further fixed as the candidate region. The candidate genes screened by the above threshold value were functionally annotated.

[0124] Shell length trait association analysis: one trait-associated locus was obtained by given threshold value analysis, and the mutation type of the variation site was C / A.

[0125] Example 6: DNA extraction

[0126] The tissue used for DNA extraction in this case is the adductor muscle of Mytilus coruscus. TIANamp Genomic DNA Kit blood / cell / tissue genomic DNA extraction kit (centrifugal column type) is used for extraction (before use, please add anhydrous ethanol in buffer GD and rinse PW, and the volume is referred to the label on the bottle).

[0127] Operation steps

[0128] 1. Sample pretreatment: tissue homogenate preparation

[0129] (1) Take an appropriate amount of animal tissue sample, grind it in liquid nitrogen, and then add 1 mL of normal saline, vortex to prepare a single cell suspension.

[0130] (2) Transfer the suspension to a 1.5 mL centrifuge tube, centrifuge at 10,000 rpm (about 11,200 x g) for 1 minute, discard the supernatant, and reserve the precipitate.

[0131] 2. Cell lysis and digestion

[0132] (1) Lysis system construction: add 200 μL of lysis buffer GA to the precipitate, vortex to resuspend the precipitate completely.

[0133] (2) Inject 20 μL of proteinase K solution (20 mg / mL), vortex to mix, then incubate at 56°C for 30 minutes, gently invert to mix every 10 minutes during the incubation, until the tissue is completely dissolved.

[0134] (3) Short centrifugation (5 seconds) to remove the droplets on the tube cap.

[0135] 3. Protein denaturation removal

[0136] (1) Denaturation: add 200 μL denaturation buffer GB, vortex mix, and incubate at 70°C for 10 minutes. The solution turns from turbid to clear.

[0137] (2) Briefly centrifuge to remove droplets on the cap.

[0138] 4. DNA binding and purification

[0139] (1) Ethanol precipitation: add 200 μL pre-cooled anhydrous ethanol, vortex for 15 seconds, and observe the precipitation of the flocculent DNA-protein complex.

[0140] (2) After brief centrifugation, transfer the entire mixture to the adsorption column CB3 (with a 2 mL collection tube), centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and place the adsorption column back into the collection tube.

[0141] 5. Impurity washing

[0142] (1) Add 500 μL washing buffer GD (containing ethanol) to the CB3 column, centrifuge at 12,000 rpm for 30 seconds, and discard the waste liquid.

[0143] (2) Inject 600 μL rinse solution PW (containing ethanol), centrifuge under the same conditions to discard the liquid, and repeat this step once.

[0144] (3) Centrifuge the empty column at 12,000 rpm for 2 minutes to completely remove residual ethanol, and dry at room temperature for 5 minutes with the cap open.

[0145] 6. DNA elution and collection

[0146] (1) Elution recovery: transfer the CB3 column to a clean 1.5 mL centrifuge tube, and add 50-200 μL elution solution TE (pH 8.0) to the center of the adsorption membrane, and let it stand at room temperature for 3 minutes.

[0147] (2) Centrifuge at 12,000 rpm for 2 minutes, and the DNA solution in the collection tube is the core product. Measure the concentration and purity, adjust, and store at -20°C for later use.

[0148] Example 7: SNP site verification

[0149] 1. Primer design and PCR amplification

[0150] (1) Primer sequence: design primers according to the upstream and downstream sequences of the SNP site, forward primer: CCAACACCAACCTGTCTATGGA (SEQ ID NO: 2), reverse primer: CGTTTGGACTTCAGATGACACA (SEQ ID NO: 3), and the length of the amplified fragment is 300 bp.

[0151] PCR reaction system (25 μL):

[0152] 2 × Es Taq MasterMix - 12.5 μL;

[0153] Forward / reverse primers - 1 μL each;

[0154] DNA template - 1 μL;

[0155] ddH2O - 9.5 μL.

[0156] (2) Amplification conditions:

[0157] 94°C pre-denaturation for 2 min;

[0158] 35 cycles: (94°C for 30 s, 56°C for 30 s, 72°C for 30 s);

[0159] 72°C extension for 2 min.

[0160] 2. Electrophoresis and sequencing typing

[0161] Electrophoresis detection: 2 μL of PCR product was electrophoresed on a 1% agarose gel (120 V, 30 min) to verify the band singularity Figure 1 ).

[0162] First-generation sequencing: samples with clear bands were sent to Beijing Qikang Biotechnology Co., Ltd. for Sanger sequencing to obtain SNP site genotypes (CC / CA / AA, see Figure 5 for an example, and sequencing peak chart), and the genotype data of the SNP site were counted (see Table 3 below for specific data).

[0163] Table 3. Statistical results of SNP site genotypes of low shell length group and high shell length group in rechecking stage (with chi-square test results)

[0164]

[0165] 3. Statistical analysis

[0166] (1) Chi-square test: SPSS 26.0 software was used to analyze the difference in distribution of SNP genotypes between the low shell length group and the high shell length group, and the test resulted in P = 0.0371704428966677 < 0.05, indicating that the SNP site was significantly associated with shell length characteristics.

[0167] Example 8: Cross-population verification

[0168] 1. Secondary sampling and verification

[0169] Sample collection: 200 Mytilus coruscus were collected, and the shell length was measured and sorted into groups (50 in the low shell length group and 50 in the high shell length group) using a vernier caliper according to the method of Example 1.

[0170] 2. Repeat verification: DNA extraction was performed according to the procedure of Example 6, PCR amplification and sequencing verification were performed according to the procedure of Example 7, and the genotype data of the SNP site were counted (see Table 4 below for specific data). The p value obtained by secondary testing was 0.00292120171176307 < 0.05, indicating that the SNP site was significantly associated with the shell length characteristic.

[0171] Table 4: Genotype statistical results of SNP sites in the low shell length group and the high shell length group in the retest stage (with chi-square test results)

[0172]

[0173]

[0174] SEQUENCE LISTING

[0175]

Claims

1. A Mytilus edulis shell length trait-associated SNP molecular marker, characterized in that, The nucleotide sequence of the molecular marker is shown as SEQ ID NO: 1, and the mutation type is C / A mutation.

2. The use of the Mytilus edulis shell length trait-related SNP molecular marker of claim 1 in Mytilus edulis breeding.

3. The use of the Mytilus edulis shell length trait-related SNP molecular marker of claim 1 in screening individuals with shell length trait phenotype.

4. The method of developing long feature-associated SNP molecular markers of Mytilus galloprovincialis shell according to claim 1, wherein, Comprising the following steps: S.

1. Collecting Mytilus edulis samples; S.

2. Measuring the shell length phenotype data of the samples; S.

3. Screening SNP candidate sites significantly associated with shell length trait by combining genome-wide association analysis GWAS; S.

4. Designing specific primers, using PCR amplification and first-generation sequencing technology; S.

5. Finally determining the associated SNP marker through two-stage analysis of preliminary screening and cross-population verification.

5. The method of claim 4, wherein, The nucleotide sequence of the specific primer in S.

4. is shown as SEQ ID NO: 2-3.

6. The primer for identifying the Mytilus coruscus shell length trait-associated SNP molecular marker according to claim 1, wherein, The nucleotide sequence of the identification primer is shown as SEQ ID NO: 2-3.

7. The use of the identification primer of claim 6 in identifying the Mytilus edulis shell length trait-related SNP molecular marker, the nucleotide sequence of which is shown as SEQ ID NO: 1.

Images