Application of 3-oxo-valproate coenzyme A in preparation of medicine for inhibiting lung adenocarcinoma
By activating GIMAP1 with 3-oxo-valproate-coenzyme A, the problems of low response rate of immune checkpoint inhibitors and indirect regulation by gut microbial metabolites in existing technologies are solved. This achieves targeted inhibition of lung adenocarcinoma cells and remodeling of the immune microenvironment, enhances anti-tumor immune response, and improves the efficacy of lung adenocarcinoma treatment.
Patent Information
- Application Number
- CN202511381661.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-25
- Publication Date
- 2025-11-28
AI Technical Summary
In existing technologies, immune checkpoint inhibitors have low response rates in some patients, cannot target and regulate GIMAP1-mediated immune pathways, lack small molecule compounds that specifically activate GIMAP1, and the application of gut microbial metabolites in lung adenocarcinoma is mostly focused on indirect regulation, without clarifying the direct effects of specific compounds on immune cell infiltration.
Using 3-oxo-valproate coenzyme A as a specific agonist of GIMAP1, GIMAP1 was activated to enhance the inhibition of lung cancer cell progression, enhance the activation of the tumor immune microenvironment, promote Gimap1 mRNA expression and enhance Gimap1 enzyme activity, inhibit lung cancer cell proliferation and migration, enhance the differentiation of Th1, Fr.I treg, PB, NK and NKT, inhibit SMB differentiation, promote the secretion of IFN-γ and IL-12, and inhibit the expression of immune checkpoint molecules PD-L1, CTLA-4, PD-1 and LAG-3.
It has strong targeting and precisely activates the GIMAP1-mediated immune regulatory pathway, significantly increases the infiltration of anti-tumor immune cells, reverses the immunosuppressive microenvironment of lung adenocarcinoma, improves the sensitivity of immunotherapy, effectively inhibits the proliferation and invasion of lung cancer cells, reduces the tumor's invasive ability, and has high safety and low side effects.
Smart Images

Figure CN121015684A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of biomedicine and tumor immunotherapy, specifically to the application of 3-oxo-valproic acid coenzyme A in the preparation of drugs that inhibit lung adenocarcinoma. Background Technology
[0002] Lung adenocarcinoma is a major subtype of lung cancer, with persistently high incidence and mortality rates. Current clinical treatments include surgery, chemotherapy, targeted therapy, and immunotherapy; however, problems such as low response rates to immunotherapy and immunosuppression in the tumor microenvironment remain unresolved. Remodeling the tumor immune microenvironment (TME) is crucial for improving the prognosis of lung adenocarcinoma. Studies have shown that the GTPase family of immune-related proteins (GIMAPs) is generally underexpressed in lung adenocarcinoma, and this low expression is significantly associated with tumor progression, reduced immune cell infiltration, and poor prognosis. The GIMAP family can regulate the immune microenvironment (such as CD8+)... + It infiltrates T cells and M1 macrophages, inhibiting tumor proliferation.
[0003] Gut microbial metabolites regulate lung immunity through the gut-lung axis, and their potential in tumor treatment has attracted attention. However, no specific agonist targeting GIMAP1 has been found yet, and there is a lack of effective compounds that can reshape the immune microenvironment of lung adenocarcinoma by activating GIMAP1.
[0004] In existing technologies, the regulation of the immune microenvironment in lung adenocarcinoma largely relies on immune checkpoint inhibitors (such as PD-1 / PD-L1 antibodies), but their mechanism of action is to relieve T-cell suppression, which easily leads to drug resistance during treatment. Some studies have explored the effects of natural compounds on the immune microenvironment, but none have addressed 3-oxo-valproate coenzyme A or its regulation of the GIMAPs family. Virtual screening technology has been used to discover small molecules for tumor therapy, but current screening does not focus on the interaction between gut microbial metabolites and the GIMAPs family, and has not verified the activating effect of 3-oxo-valproate coenzyme A on the immune microenvironment of lung adenocarcinoma.
[0005] The drawbacks of existing technology are:
[0006] Immune checkpoint inhibitors have low response rates in some patients and cannot target and regulate the GIMAP1-mediated immune pathway.
[0007] Small molecule compounds that lack specific activation of GIMAP1 are unlikely to improve the immune microenvironment of lung adenocarcinoma by enhancing GIMAP1 expression;
[0008] The application of gut microbial metabolites in lung adenocarcinoma has mostly focused on indirect regulation, with no clear understanding of specific compounds and their direct effects on immune cell infiltration. Summary of the Invention
[0009] To address the aforementioned problems, this invention provides the application of 3-oxo-valproic acid coenzyme A in the preparation of drugs that inhibit lung adenocarcinoma. This invention is achieved through the following technical solution.
[0010] The application of 3-oxo-valproate coenzyme A in the preparation of drugs for inhibiting lung adenocarcinoma, wherein 3-oxo-valproate coenzyme A, as a specific agonist of GIMAP1, enhances the inhibition of lung cancer cell progression and enhances the activation of the tumor immune microenvironment by activating GIMAP1.
[0011] As a further embodiment of the present invention, when the 3-oxo-valproic acid coenzyme A acts as a specific agonist of GIMAP1, it specifically binds to GIMAP1, promotes Gimap1 mRNA expression, and enhances Gimap1 enzyme activity.
[0012] As a further aspect of the present invention, when the 3-oxo-valproic acid coenzyme A enhances the inhibition of lung cancer cell progression, it inhibits the proliferation and migration of lung cancer cells in human lung adenocarcinoma cell lines.
[0013] As a further aspect of the present invention, the inhibitory effect of 3-oxo-valproic acid coenzyme A in human lung adenocarcinoma cell lines A549 and H1299 is as follows:
[0014] It inhibited the proliferation of lung adenocarcinoma cells by more than 50% in the concentration range of 10-20 μM;
[0015] It significantly inhibited the migration and invasion of lung adenocarcinoma cells A549 and H1299 within the concentration range of 10-20 μM.
[0016] As a further aspect of the present invention, when the 3-oxo-valproic acid coenzyme A enhances the activation of the tumor immune microenvironment, it does so by increasing the infiltration of anti-tumor immune cells.
[0017] As a further aspect of the present invention, the specific manifestation of 3-oxo-valproic acid coenzyme A enhancing the activation of the tumor immune microenvironment by activating GIMAP1 is as follows:
[0018] It enhances the differentiation of Th1, Fr.I treg, PB, NK and NKT, and inhibits the differentiation of SMB;
[0019] Promotes the secretion of IFN-γ and IL-12;
[0020] It inhibits the expression of immune checkpoint molecules PD-L1, CTLA-4, PD-1 and LAG-3.
[0021] As a further embodiment of the present invention, the 3-oxo-valproic acid coenzyme A can be administered alone or in combination with one or more other therapeutic agents.
[0022] The beneficial effects of this invention are as follows:
[0023] 1. High targeting: 3-oxo-valproic acid coenzyme A specifically binds to GIMAP1, precisely activating its mediated immune regulatory pathways and avoiding widespread impact on normal cells.
[0024] 2. Immune microenvironment remodeling: Significantly increases the infiltration of anti-tumor immune cells, reverses the immunosuppressive microenvironment of lung adenocarcinoma, and improves the sensitivity to immunotherapy.
[0025] 3. Inhibits tumor progression: Effectively inhibits lung cancer cell proliferation (in in vitro experiments, cell proliferation rate decreased by ≥50% after treatment with 10-20 μM 3-oxo-valproic acid coenzyme A), reducing tumor invasiveness.
[0026] 4. Naturally derived: As a derivative of intestinal microbial metabolites, it has high safety and fewer side effects than chemically synthesized drugs. Attached Figure Description
[0027] To more clearly illustrate the technical solution of the present invention, the accompanying drawings used in the description of the specific embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0028] Figure 1 Schematic diagram of 3-oxo-valproate-coenzyme A activating Gimap1 expression;
[0029] Figure 2 Results of the effects of 3-oxo-valproate coenzyme A on the progression of lung adenocarcinoma and normal cells;
[0030] Figure 3 Flow cytometry results;
[0031] Figure 4 ELISA test results;
[0032] Figure 5 The results of animal models verifying that 3-oxo-valproate coenzyme-A enhances anti-tumor immunity by activating Gimap1. Detailed Implementation
[0033] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0034] The application of 3-oxo-valproate coenzyme A in the preparation of drugs for inhibiting lung adenocarcinoma, wherein 3-oxo-valproate coenzyme A, as a specific agonist of GIMAP1, enhances the inhibition of lung cancer cell progression and enhances the activation of the tumor immune microenvironment by activating GIMAP1. Specific embodiments are included.
[0035] Example 1
[0036] When 3-oxovalproate coenzyme A acts as a specific agonist of GIMAP1, it specifically binds to GIMAP1, promoting Gimap1 mRNA expression and enhancing Gimap1 enzyme activity.
[0037] like Figure 1 As shown, Figure 1 In the image: A shows the molecular docking model of 3-oxo-valproate coenzyme A with GIMAP1, with gray representing the GIMAP1 protein; B shows the amino acid sequence of 3-oxo-valproate coenzyme A binding to GIMAP1; C shows RT-qPCR demonstrating that 3-oxo-valproate coenzyme A promotes Gimap1 mRNA expression; D shows 3-oxo-valproate coenzyme A activating Gimap1 activity (**p<0.01 and ***p<0.001 vs. 0).
[0038] A two-step screening of a small molecule database was performed using a computer. The first step involved rigid docking using QuickVina 2, selecting small molecule drugs with docking scores <-7 kJ / mol. The second step used AutoDock Vina for flexible docking. The top 6 drugs were then selected for molecular dynamics simulations and bioactivity tests. 3-oxo-valproate coenzyme A (3-oxo-valproate coenzyme A) was found to have a high docking score of -10.6912. The interacting amino acids between 3-oxo-valproate coenzyme A and GIMAP1 include: Asn45, Ser55, Arg123, Gln127, and Arg153. Figure 1 A, B), RT-qPCR and enzyme activity assays showed that 3-oxo-valproic acid coenzyme A promoted Gimap1 mRNA expression and enhanced Gimap1 enzyme activity. Figure 1 C, D), are agonists of Gamap1.
[0039] 1) Compound screening and validation
[0040] Experimental materials
[0041] Molecular databases: You can choose a database specific to gut microbial metabolites (such as the Human Microbial Metabolome Database) or a general small molecule database (such as ZINC15, https: / / zinc15.docking.org / ).
[0042] GIMAP1 protein structure: Its three-dimensional structure was obtained from the PDB database (e.g., number 6X8L) and preprocessed using PyMOL software (to remove water molecules and ligands).
[0043] Molecular docking software: QuickVina 2 (open source software, https: / / github.com / QVina / QuickVina2), AutoDock Vina (open source software, https: / / vina.scripps.edu / ).
[0044] Molecular dynamics simulation tools: GROMACS 2021 (open source software) or AMBER 20 (commercial software).
[0045] Operating steps
[0046] Rigid docking screening: The GIMAP1 protein structure was docked with a small molecule database, with the grid center set as the active pocket (based on the coordinates of key amino acids Asn45 and Ser55), a grid size of 20×20×20 Å, and a step size of 0.375 Å. The docking score was calculated using QuickVina 2, and small molecules with a score < -7 kJ / mol were screened.
[0047] Flexible docking verification: For the small molecules obtained from the initial screening, AutoDock Vina was used for flexible docking (allowing protein side chain rotation), the docking score was recalculated, and the top 6 small molecules with the highest scores were selected.
[0048] Molecular dynamics simulations: 100 ns molecular dynamics simulations were performed on the complexes of the top 6 small molecules and GIMAP1 to analyze parameters such as RMSD and hydrogen bond occupancy, and to screen for conformationally stable candidate compounds.
[0049] Bioactivity assay: The activation ability of candidate compounds for GIMAP1 was verified by in vitro enzyme activity assay. Finally, 3-oxo-valproic acid coenzyme A (doping fraction -10.6912 kJ / mol, interacting amino acids are Asn45, Ser55, Arg123, Gln127, Arg153) was determined to be the optimal molecule.
[0050] 2) Validation of the regulation of GIMAP1 expression by 3-oxo-valproate coenzyme A
[0051] Experimental materials
[0052] Cell lines: human lung adenocarcinoma cell lines A549 (ATCC® CCL-185™), H1299 (ATCC® CRL-5803™), and normal lung epithelial cells Beas-2B (ATCC® CRL-9609™), all purchased from ATCC, USA.
[0053] Reagents: 3-O-valproic acid coenzyme A (Sigma-Aldrich, catalog number O7500), DMSO (Sigma, catalog number D2650), TRIzol reagent (Invitrogen, catalog number 15596026), qPCR primers (synthesized by Sangon Biotech, sequences: GIMAP1-F: AGGTCACTGCTACCTGCTCTCG; GIMAP1-R: CTTCCTGGTGAAGACGATGACC).
[0054] Operating steps
[0055] Cell culture: A549, H1299, and Beas-2B cells were seeded in RPMI-1640 medium (Gibco, catalog number 31800-022) containing 10% fetal bovine serum (Gibco, catalog number 10099-141) and cultured in a 37°C, 5% CO2 incubator to the logarithmic growth phase.
[0056] Grouping treatment: The cells were divided into 7 groups and 0 μM of 3-oxo-valproate coenzyme A was added to each group (control group, DMSO treatment), 1, 5, 10, 20, 50, and 100 μM respectively, with 3 replicates per group.
[0057] RNA extraction and detection: After 48 h of treatment, total RNA was extracted using TRIzol reagent, and the concentration and purity (OD260 / 280=1.8~2.0) were detected by Nanodrop 2000 (Thermo Fisher).
[0058] qPCR detection: cDNA was synthesized according to the TaKaRa reverse transcription kit (catalog number RR047A) instructions and amplified using SYBR®-Green (TaKaRa, catalog number RR420A) on a Bio-Rad CFX96 qPCR instrument. Reaction conditions: 95℃ pre-denaturation for 30 s, 40 cycles (95℃ 5 s, 60℃ 30 s). GAPDH was used as an internal control. - The relative expression level of GIMAP1 mRNA was calculated using the ΔΔCt method.
[0059] Example 2
[0060] When 3-oxovalproate-coenzyme A enhances the inhibition of lung cancer cell progression, it also inhibits lung cancer cell proliferation and migration / invasion in human lung adenocarcinoma cell lines.
[0061] Preferably, the inhibitory effect of 3-oxo-valproate coenzyme A in human lung adenocarcinoma cell lines A549 and H1299 is as follows:
[0062] It inhibited the proliferation of lung adenocarcinoma cells by more than 50% in the concentration range of 10-20 μM;
[0063] It significantly inhibited the migration and invasion of lung adenocarcinoma cells A549 and H1299 within the concentration range of 10-20 μM.
[0064] like Figure 2 As shown, Figure 2 In the experiment: A represents the cell proliferation assay (CCK-8 assay), where cells were divided into different concentration groups (0, 1, 5, 10, 20, 50, 100 μM), treated with 3-oxo-valproic acid coenzyme A for 48 hours, and cell viability was detected to plot the dose-response curve; B represents the migration and invasion identification assay (transwell assay), where cells were treated with metabolites (0, 5, 10, 20 μM), and the migration and invasion rates were detected (*p<0.05, **p<0.01, and ***p<0.001 vs. 0).
[0065] In human lung adenocarcinoma cell lines A549 and H1299, CCK8 assays showed that 3-oxo-valproate coenzyme A inhibited lung cancer cell proliferation (the inhibition rate increased with increasing concentration). 3-oxo-valproate coenzyme A showed an inhibition rate exceeding 50% against lung adenocarcinoma cells in the 10-20 μM range, but caused minimal damage to normal cells. Figure 2 A). Migration and invasion (transwell assay) showed that 3-oxo-valproate coenzyme A significantly inhibited the migration and invasion of lung adenocarcinoma cells A549 and H1299 in the range of 10-20 μM. Figure 2 B).
[0066] 1) Inhibition experiment of 3-oxo-valproate coenzyme A on the proliferation of lung adenocarcinoma cells.
[0067] Experimental materials
[0068] Reagents: CCK8 kit (Tongren Chemical, catalog number CK04), 96-well plate (Corning, catalog number 3599).
[0069] Operating steps
[0070] Cell seeding: A549 and H1299 cells were seeded at 5 × 10³ cells / well in 96-well plates and cultured at 37°C for 24 h until adherence.
[0071] Drug treatment: Add different concentrations of 3-oxo-valproic acid coenzyme A (0, 1, 5, 10, 20, 50, 100 μM), with 3 replicates per group.
[0072] Viability assay: At 0 h, 24 h, 48 h and 72 h, 10 μL of CCK8 reagent was added to each well and incubated at 37℃ for 2 h. The absorbance at 450 nm was then measured using a Bio-Rad iMark microplate reader.
[0073] Results calculation: Cell viability inhibition rate = (1 - OD value of experimental group / OD value of control group) × 100%, plot the dose-response curve.
[0074] 2) Transwell experiments (migration and invasion)
[0075] Experimental materials
[0076] Reagents: Transwell chambers (8 μm pore size, Corning, catalog number 3422), Matrigel (BDBiosciences, catalog number 356234), 0.25% trypsin (Gibco, catalog number 25200056), hematoxylin staining solution (Sigma, catalog number H9627).
[0077] Operating steps
[0078] Cell preparation: A549 and H1299 cells in logarithmic growth phase were digested with 0.25% trypsin and the concentration of serum-free RPMI-1640 medium was adjusted to 1×10⁻⁶. 6 cells / mL.
[0079] Migration experiment: 500 μL of culture medium containing 10% fetal bovine serum was added to the lower chamber, and 200 μL of cell suspension was added to the upper chamber. The cells were incubated at 37°C for 48 h.
[0080] Invasion test: Melt Matrigel at 4°C in advance, dilute with serum-free medium at a ratio of 1:8, add 50 μL Matrigel to the upper chamber of each well, solidify at 37°C for 30 min, and follow the same steps as the migration test.
[0081] Staining and counting: Discard the culture medium, fix with methanol for 15 min, stain with hematoxylin for 10 min, wipe away unmigrated cells in the upper chamber with a cotton swab, and count the transmembrane cells in 5 random fields under a microscope (×200), and take the average value. The experiment was repeated 3 times, with 3 replicates per group.
[0082] Example 3
[0083] When 3-oxo-valproic acid coenzyme A enhances the activation of the tumor immune microenvironment, it does so by increasing the infiltration of anti-tumor immune cells.
[0084] Preferably, 3-oxo-valproate coenzyme A enhances the activation of the tumor immune microenvironment by activating GIMAP1, specifically in the following ways:
[0085] It enhances the differentiation of Th1, Fr.I treg, PB, NK and NKT, and inhibits the differentiation of SMB;
[0086] Promotes the secretion of IFN-γ and IL-12;
[0087] It inhibits the expression of immune checkpoint molecules PD-L1, CTLA-4, PD-1 and LAG-3.
[0088] like Figure 3 and Figure 4 As shown.
[0089] Figure 3 In this study, A549 cells treated with 3-oxo-valproate-coenzyme A were co-cultured with peripheral blood mononuclear cells, and the differentiation of peripheral blood immune cells was detected by flow cytometry (n=6) (*p<0.05, **p<0.01).
[0090] Figure 4 In the middle: A represents the cytokine levels (IFN-γ, IL-12, IL-10, TGF-β) detected by ELISA; B represents the expression of immune checkpoint molecules PD-L1, CTLA-4, PD-1, and LAG-3 detected by RT-qPCR (*p<0.05, **p<0.01).
[0091] (I) Co-culture of A549 cells and peripheral blood mononuclear cells showed that 3-oxo-valproate coenzyme A enhances the activation of the tumor immune microenvironment by activating GIMAP1.
[0092] A549 cells transfected with si-NC or si-Gimap1 were co-cultured with peripheral blood mononuclear cells. Flow cytometry was used to detect the differentiation of peripheral blood immune cells. The results showed that 3-oxovalproate-coenzyme A significantly enhanced the differentiation of Th1, Fr.I. treg, PB, NK, and NKT cells, and inhibited the differentiation of SMB cells. This effect could be reversed by si-Gimap1. Figure 3 ELISA was used to detect cytokine levels (IFN-γ, IL-12, IL-10, TGF-β) in the co-culture system. Results showed that 3-oxovalproate-coenzyme A promoted the secretion of IFN-γ and IL-12, an effect that could be reversed by si-Gimap1. Figure 4 A); RT-qPCR was used to detect the expression of immune checkpoint molecules PD-L1, CTLA-4, PD-1, and LAG-3. The results showed that 3-oxo-valproate coenzyme A inhibited the expression of PD-L1, CTLA-4, PD-1, and LAG-3, and this effect could be reversed by si-Gimap1. Figure 4 B).
[0093] 1) Cell co-culture
[0094] Experimental materials
[0095] Sample source: Peripheral blood from healthy volunteers (approved by the Ethics Committee, number YZ2023-012).
[0096] Reagents: Lymphocyte separation medium (GE Healthcare, catalog number 17-1440-02), si-NC (negative control siRNA, GenePharma, catalog number SI03650318), si-Gimap1 (GenePharma, sequence: 5'-GCAUUGAGCUUGACUACUUTT-3'), Lipofectamine 3000 (Invitrogen, catalog number L3000015).
[0097] Operating steps
[0098] BMCs isolation: Take 20 mL of peripheral blood, dilute it with an equal volume of PBS, and slowly stack it on top of 10 mL of lymphocyte separation medium. Centrifuge at 2000 rpm for 20 min, aspirate the middle white membrane layer, wash twice with PBS, and adjust the concentration to 2×10⁻⁶. 6 cells / mL.
[0099] A549 cell transfection: A549 cells were seeded into 6-well plates and transfected with si-NC or si-Gimap1 (final concentration 50 nM) at 50% density. Transfection was mediated by Lipofectamine 3000 and the cells were co-cultured after 48 h.
[0100] Co-culture system: Transfected A549 cells and PBMCs were seeded at a ratio of 1:5 in a Transwell co-culture plate (A549 in the upper chamber and PBMCs in the lower chamber) and cultured at 37°C for 48 h.
[0101] 2) Flow cytometry detection of differentiation of peripheral blood immune cells
[0102] Experimental materials
[0103] Antibodies: anti-human CD3-PE, CD8-FITC, CD4-APC, NK1.1-PE-Cy7, NKT-APC-Cy7 (all purchased from BDBiosciences).
[0104] Instrument: BD FACSCanto II flow cytometer.
[0105] Operating steps
[0106] Cell collection: After co-culturing for 48 h, PBMCs from the lower chamber were collected, washed twice with PBS, and the concentration was adjusted to 1×10⁻⁶. 6 cells / mL.
[0107] Antibody staining: Add 100 μL of cell suspension to each tube, add the above fluorescent antibody (1:100 dilution), incubate at 4°C in the dark for 30 min, wash twice with PBS, and resuspend in 300 μL of PBS.
[0108] Detection and analysis: Flow cytometry was used to detect the proportions of various immune cell subsets (such as CD8). + T cells and NK cells were analyzed using FlowJo 10 software.
[0109] 3) ELISA detection of cytokine levels in the co-culture system
[0110] Experimental materials
[0111] Kits: Human IFN-γ ELISA Kit (R&D Systems, catalog number DY285), IL-12 Kit (catalog number DY1217), IL-10 Kit (catalog number DY217B), TGF-β Kit (catalog number DY240).
[0112] Operating steps
[0113] Sample collection: Collect the co-culture supernatant, centrifuge at 12000 rpm for 10 min at 4℃, and aliquot and freeze the supernatant at -80℃.
[0114] Detection procedure: Follow the instructions in the kit, set up a standard gradient (0-2000 pg / mL), add 100 μL of sample or standard to each well, incubate at 37℃ for 2 h, wash the plate, add the detection antibody, incubate at 37℃ for 1 h, add substrate for color development for 30 min, stop the reaction, measure the absorbance at 450 nm with a microplate reader, and calculate the cytokine concentration.
[0115] 4) RT-qPCR experiment
[0116] Experimental materials
[0117] Reagents: TRIzol (Invitrogen, catalog number 15596026), TaKaRa reverse transcription kit (catalog number RR047A), SYBR®-Green (TaKaRa, catalog number RR420A), GAPDH primers (Sangon Biotech, sequence: F: 5'-GAAGGTGAAGGTCGGAGTC-3'; R: 5'-GAAGATGGTGATGGGATTTC-3').
[0118] Operating steps
[0119] RNA extraction: Total RNA was extracted from cells or tissues according to the method described in Example 1.
[0120] Reverse transcription: Take 1 μg of RNA and synthesize cDNA using the TaKaRa reverse transcription kit. Reaction conditions: 37℃ for 15 min, 85℃ for 5 s.
[0121] qPCR amplification: The reaction system was 20 μL (cDNA 2 μL, forward and reverse primers 0.8 μL each, SYBR®-Green 10 μL, ddH2O 6.4 μL), and the reaction conditions were the same as in Example 1. The relative gene expression level was calculated using GAPDH as an internal reference.
[0122] Figure 5In the figures: A represents tumor volume; B represents tumor weight; C represents CTL activity detected by LDH method; D represents Gimap1 mRNA expression and activity detected by RT-qPCR and enzyme activity assay kit; E represents the proportion of CD8+ and Gimap1+ cells in tumor tissue detected by indirect immunofluorescence technique; F represents the expression of immune checkpoint molecules PD-L1, CTLA-4, PD-1, and LAG-3 in tumor tissue detected by RT-qPCR (*p<0.05, **p<0.01, ***p<0.001 vs. Control).
[0123] (ii) In animal models, 3-oxo-valproate coenzyme A enhances the activation of the tumor immune microenvironment by activating GIMAP1.
[0124] A subcutaneous xenograft model of nude mice was constructed using A549-Luc (fluorescently labeled) lung adenocarcinoma cells (n=20). The mice were randomly divided into two groups (n=10 per group): control group: intraperitoneal injection of PBS; 3-oxo-valproate coenzyme A: intraperitoneal injection of 20 mg / kg 3-oxo-valproate coenzyme A. The drugs were administered once daily for 35 days. Tumor volume was measured weekly (caliper method). The tumor volume was calculated using the formula: tumor volume = major diameter × (width²) / ². Results showed that 3-oxo-valproate coenzyme A significantly inhibited tumor growth. Figure 5 A).
[0125] Mice were sacrificed at the end of the experiment, and tumor tissue was collected and tumor weight was recorded. The results also showed that 3-oxo-valproate coenzyme A significantly inhibited tumor growth. Figure 5 B); Spleen cells were isolated, and CTL activity was detected by LDH method. The results showed that 3-oxo-valproic acid coenzyme A significantly enhanced the killing activity of CTL (B). Figure 5 C); RT-qPCR and enzyme activity assay kits were used to detect the expression and activity of Gimap1 mRNA in tumor tissues, indicating that 3-oxo-valproate coenzyme A activates Gimap1 mRNA expression and activity in the tissues. Figure 5 D); Indirect immunofluorescence assays showed that the proportions of CD8+ and Gimap1+ cells in tumor tissues significantly increased after treatment with 3-oxo-valproate-coenzyme A. Figure 5 E). RT-qPCR was used to detect the expression of immune checkpoint molecules PD-L1, CTLA-4, PD-1, and LAG-3 in tumor tissues. The results showed that 3-oxo-valproate coenzyme A significantly inhibited the expression of PD-L1, CTLA-4, PD-1, and LAG-3. Figure 5 F).
[0126] 1) Tumor model construction
[0127] Experimental materials
[0128] Animals: BALB / c nude mice (6-8 weeks old, male, Beijing Vital River, license number SCXK2022-0003).
[0129] Cells: A549-Luc (fluorescently labeled cells, PerkinElmer, catalog number 124052).
[0130] Operating steps
[0131] Model construction: 1×10⁻⁶ mice were subcutaneously injected into the right back of each nude mouse. 7 A549-Luc cells (suspended in 100 μL PBS).
[0132] Grouping and administration: Seven days after vaccination, participants were randomly divided into two groups (n=10): control group (intraperitoneal injection of 100 μL PBS / day) and administration group (intraperitoneal injection of 20 mg / kg 3-oxo-valproic acid coenzyme A, dissolved in PBS), and administered the drugs continuously for 35 days.
[0133] Tumor monitoring: The long diameter (L) and short diameter (W) of the tumor were measured weekly using calipers, and the volume was calculated using the formula V=L×W² / 2. The tumor tissue was weighed at the end of the experiment.
[0134] 2) LDH method for detecting CTL activity
[0135] Experimental materials
[0136] Reagents: Cytotox96 non-radioactive cytotoxicity assay kit (Promega, catalog number G1780), mouse IL-2 (PeproTech, catalog number 212-12), RPMI-1640 medium (Gibco).
[0137] Operating steps
[0138] Spleen cell isolation: Nude mice were sacrificed, and spleens were aseptically harvested, ground, and passed through a 70 μm sieve. The spleens were treated with erythrocyte lysis buffer for 5 min, washed twice with PBS, and the concentration was adjusted to 1×10⁻⁶. 7 cells / mL.
[0139] CTL induction: 500 ng / mL IL-2 was added to spleen cells and cultured at 37°C for 5 days to create effector cells (CTLs).
[0140] Killing experiment: Target cells (A549) were adjusted to 1×10⁻⁶ 5Cells / mL were added to 96-well plates at effective-to-target ratios of 50:1, 25:1, and 12.5:1, with a total volume of 200 μL per well. The plates were incubated at 37°C for 2 h.
[0141] LDH detection: According to the kit instructions, take 100 μL of supernatant from each well, add 100 μL of substrate, react at room temperature for 30 min, add 30 μL of stop solution, measure the OD value at 570 nm, and calculate the killing rate: (OD of experimental wells - spontaneous OD of effector cells - spontaneous OD of target cells) / (maximum OD of target cells - spontaneous OD of target cells) × 100%.
[0142] 3) Indirect immunofluorescence
[0143] Experimental materials
[0144] Antibodies: Anti-GIMAP1 monoclonal antibody (Abcam, catalog number ab239456), anti-CD8 + Antibody (CST, catalog number 98941S), Alexa Fluor 488 labeled secondary antibody (Invitrogen, catalog number A11008), DAPI (Sigma, catalog number D9542), anti-fluorescence quencher (Solarbio, catalog number S2100).
[0145] Operating steps
[0146] Section preparation: Tumor tissue was flash-frozen in liquid nitrogen, and then continuously frozen into sections (3-5 μm) and mounted on glass slides.
[0147] Staining procedure: Fix with acetone at 4℃ for 10 min, block with 5% goat serum for 15 min, add primary antibody (1:50 dilution) and incubate overnight at 4℃, wash 3 times with PBS (5 min each time), add fluorescent secondary antibody (1:50 dilution) and incubate at room temperature in the dark for 1 h, wash with PBS, stain nuclei with DAPI for 5 min, mount with anti-fluorescence quencher, observe and photograph with a fluorescence microscope (Olympus BX53).
[0148] (iii) The statistical analysis methods used in this application are as follows:
[0149] Statistical software: SPSS 17.0 (IBM); graphing software: GraphPad Prism 5 (GraphPad Software).
[0150] Analysis methods: Data are expressed as mean ± standard deviation (x±s). Normality tests (Shapiro-Wilk method) and homogeneity of variance tests (Levene method) were performed first. Independent samples t-tests were used for comparisons between two groups, one-way ANOVA was used for comparisons among multiple groups, and LSD-t method was used for pairwise comparisons. P < 0.05 was considered statistically significant. Graphs and tables were created using GraphPad Prism 5.
[0151] Preferably, 3-oxo-valproic acid coenzyme A can be administered alone or in combination with one or more other therapeutic agents.
[0152] The preferred embodiments of the present invention disclosed above are merely illustrative of the invention. These preferred embodiments do not exhaustively describe all details, nor do they limit the invention to any specific implementation. Clearly, many modifications and variations can be made based on the content of this specification. This specification selects and specifically describes these embodiments to better explain the principles and practical applications of the invention, thereby enabling those skilled in the art to better understand and utilize the invention.
Claims
The application of 1,3-oxo-valproic acid coenzyme A in the preparation of drugs for inhibiting lung adenocarcinoma, characterized in that, The 3-oxo-valproate coenzyme A, as a specific agonist of GIMAP1, enhances the inhibition of lung cancer cell progression and enhances the activation of the tumor immune microenvironment by activating GIMAP1.
2. The application of 3-oxo-valproic acid coenzyme A according to claim 1 in the preparation of drugs for inhibiting lung adenocarcinoma, characterized in that, When the 3-oxo-valproate coenzyme A acts as a specific agonist of GIMAP1, it specifically binds to GIMAP1, promoting Gimap1 mRNA expression and enhancing Gimap1 enzyme activity.
3. The application of 3-oxo-valproic acid coenzyme A according to claim 1 in the preparation of drugs for inhibiting lung adenocarcinoma, characterized in that, When the 3-oxo-valproic acid coenzyme A enhances the inhibition of lung cancer cell progression, it inhibits lung cancer cell proliferation and migration invasion in human lung adenocarcinoma cell lines.
4. The application of 3-oxo-valproic acid coenzyme A according to claim 2 in the preparation of drugs for inhibiting lung adenocarcinoma, characterized in that, The inhibitory effect of 3-oxovalproate coenzyme A in human lung adenocarcinoma cell lines A549 and H1299 is as follows: It inhibited the proliferation of lung adenocarcinoma cells by more than 50% in the concentration range of 10-20 μM; It significantly inhibited the migration and invasion of lung adenocarcinoma cells A549 and H1299 within the concentration range of 10-20 μM.
5. The application of 3-oxo-valproic acid coenzyme A according to claim 1 in the preparation of drugs for inhibiting lung adenocarcinoma, characterized in that, When the 3-oxo-valproic acid coenzyme A enhances the activation of the tumor immune microenvironment, it does so by increasing the infiltration of anti-tumor immune cells.
6. The application of 3-oxo-valproic acid coenzyme A according to claim 5 in the preparation of drugs for inhibiting lung adenocarcinoma, characterized in that, The specific manifestations of 3-oxo-valproate coenzyme A enhancing the activation of the tumor immune microenvironment by activating GIMAP1 are as follows: It enhances the differentiation of Th1, Fr.I treg, PB, NK and NKT, and inhibits the differentiation of SMB; Promotes the secretion of IFN-γ and IL-12; It inhibits the expression of immune checkpoint molecules PD-L1, CTLA-4, PD-1 and LAG-3.
7. The application of 3-oxo-valproic acid coenzyme A according to claim 1 in the preparation of drugs for inhibiting lung adenocarcinoma, characterized in that, The 3-oxo-valproic acid coenzyme A can be administered alone or in combination with one or more other therapeutic agents.