Lactobacillus murinus MF26 and use thereof in preventing and treating heart failure
By using *Lactobacillus MF26* from mice to regulate the gut microbiota, the multi-organ syndrome of HFpEF was resolved, and problems such as diastolic function, myocardial fibrosis, hypertension and glucose metabolism disorders were improved, thus achieving effective treatment for heart failure with preserved ejection fraction.
Patent Information
- Application Number
- CN202511218578.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-28
- Publication Date
- 2026-05-01
- Estimated Expiration
- 2045-08-28
AI Technical Summary
Current technologies lack effective treatments for heart failure with preserved ejection fraction (HFpEF), and related problems such as gut microbiota imbalance and increased inflammation leading to diastolic dysfunction, myocardial fibrosis, hypertension, and glucose metabolism disorders have not been effectively addressed.
Using Lactobacillus MF26 as a probiotic, the gut microbiota was regulated, the intestinal barrier permeability was improved, the inflammation level was reduced, the serum GLP-1 level was increased, and the symptoms of HFpEF mice were improved by oral or parenteral administration.
It significantly improved left ventricular diastolic function in HFpEF mice, reduced myocardial fibrosis, lowered blood pressure, improved glucose metabolism, restored intestinal barrier function, and reduced inflammation levels.
Smart Images

Figure HDA0005570883560000011 
Figure HDA0005570883560000021 
Figure HDA0005570883560000022
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to Lactobacillus MF26 of the mouse strain and its application in the prevention and treatment of heart failure. Background Technology
[0002] Heart failure (HF) is a complex clinical syndrome resulting from the progression of various heart diseases to their end-stage, affecting more than 60 million people worldwide. It is characterized by high morbidity and mortality rates, and poor quality of life. In 2021, the European Society of Cardiology (ESC) classified heart failure into three types based on left ventricular ejection fraction (LVEF): heart failure with reduced ejection fraction (HFrEF), heart failure with intermediate ejection fraction (HFmrEF), and heart failure with preserved ejection fraction (HFpEF). In recent years, with the aging population and the increasing prevalence of comorbidities such as hypertension, obesity, metabolic syndrome, and diabetes, the incidence of HFpEF has been rising annually. Epidemiological studies show that HFpEF accounts for approximately half of all heart failure (HF) cases, making it the most common type of heart failure. HFpEF is a complex cardiovascular syndrome involving multiple organs and systems, clinically manifested as an ejection fraction greater than 50%, slow left ventricular diastole, and increased left ventricular stiffness. Its annual mortality rate is between 10% and 30%, constituting a significant public health burden. Although HFpEF and HFrEF share similar symptoms and / or signs, such as dyspnea, decreased exercise capacity, and fatigue, their pathological mechanisms are significantly different. Currently, neither pharmacological nor non-pharmacological treatments for HFrEF have shown significant improvement in HFpEF. Therefore, in-depth research into the pathogenesis of HFpEF and the development of effective treatment strategies are crucial issues that urgently need to be addressed, and have significant research value and significance.
[0003] Changes in the circulation levels of gut microbiota and its derivatives are associated with various chronic metabolic diseases in humans, including cardiovascular disease (CVD) and obesity. Studies have found significant alterations in the gut microbiota diversity of patients with high heart rate and post-inflammatory hyperplasia (HFpEF), with increased abundance of inflammation-related microbiota, decreased abundance of anti-inflammatory microbiota, and excessive consumption of short-chain fatty acid (SCFA)-producing bacteria. Therefore, whether effective intervention for HFpEF can be achieved through gut probiotic supplementation, and which probiotic strains to select as candidate intervention strains, remain key issues to be addressed. Summary of the Invention
[0004] In view of the problems and deficiencies in the existing technology, the present invention aims to provide Lactobacillus murineis MF26 and its application in the prevention and treatment of heart failure.
[0005] To achieve the objectives of this invention, the technical solution adopted is as follows:
[0006] The first aspect of this invention provides a mouse-associated lactobacillus ( Ligilactobacillusmurinus The Lactobacillus MF26 described herein has the accession number CCTCC NO: M 20251548; the depository institution is the China Center for Type Culture Collection (CCTCC), located at No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province, China Center for Type Culture Collection, Wuhan University; the deposit date is July 8, 2025.
[0007] The screening and identification process for *Lactobacillus MF26* in mice was as follows: feces from healthy mice were dissolved in sterile PBS and resuspended by shaking. After centrifugation at 200 rpm / min for 1 min, the supernatant was collected and serially diluted to 10⁻⁶. -5 The diluted solution was added to MRS liquid medium, a selective medium for lactic acid bacteria, and incubated at 37°C for 48 h. The bacterial culture was then aspirated and serially diluted to 10⁻⁶. -5 Then, take 200 μL of the diluted solution and spread it evenly onto MRS solid medium. Incubate at 37°C until clear single colonies appear. Figure 2 Single colonies were picked and cultured in MRS liquid medium at 37°C for 24 hours. 0.5 ml of the bacterial suspension was then centrifuged at 8000g for 2 minutes at 4°C, the supernatant was discarded, and the bacterial pellet was resuspended in sterile water. The 16S rRNA sequence of the bacterial suspension was amplified using universal primers for the bacterial 16S rRNA gene (27F: 5'-AGAGTTTGATCCTGGCTCAG-3' and 1492R: 5'-TACGGCTACCTTGTTACGACTT-3'). The amplified products were sent to Qingke Biotechnology Co., Ltd. for sequencing. The 16S rRNA sequencing results were sequenced using the NCBI BLAST database. Sequence homology analysis confirmed that the isolated strain was *Lactobacillus murineis*, and it was named *Lactobacillus murineis* MF26.
[0008] The second aspect of this invention provides the use of the *Lactobacillus murineis* MF26 described in the first aspect in the preparation of a medicament for the prevention, relief, and / or treatment of heart failure.
[0009] The third aspect of this invention provides the use of the *Lactobacillus murineis* MF26 described in the first aspect in the preparation of a medicament for the prevention, relief, and / or treatment of myocardial fibrosis accompanying the progression of heart failure.
[0010] The fourth aspect of this invention provides the use of the *Lactobacillus murineis* MF26 described in the first aspect in the preparation of a medicament for the prevention, relief, and / or treatment of hypertension accompanying the progression of heart failure.
[0011] The fifth aspect of this invention provides the use of the *Lactobacillus murineis* MF26 described in the first aspect in the preparation of a medicament for the prevention, relief, and / or treatment of heart failure caused by glucose metabolism disorders.
[0012] The sixth aspect of this invention provides the use of the *Lactobacillus murineis* MF26 described in the first aspect in the preparation of a medicament for the prevention, relief, and / or treatment of intestinal mucosal barrier damage accompanying the progression of heart failure.
[0013] According to any one of the second to sixth aspects of the present invention, preferably, the heart failure is a heart failure with preserved ejection fraction.
[0014] A seventh aspect of the present invention provides a medicament, the active ingredient of which comprises *Lactobacillus MF26* and / or a post-genetic agent of *Lactobacillus MF26* as described in the first aspect, the medicament being used to prevent, alleviate, and / or treat heart failure.
[0015] Preferably, the drug is administered orally, by gavage, or by parenteral administration.
[0016] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0017] The *Lactobacillus assemblica* MF26 obtained by screening in this invention can significantly improve left ventricular diastolic dysfunction, reduce myocardial fibrosis, alleviate hypertension in HFpEF mice, significantly improve intestinal barrier permeability, reduce systemic inflammation, and significantly increase serum GLP-1 levels, thereby effectively improving fasting blood glucose levels and glucose tolerance in HFpEF mice. Therefore, *Lactobacillus assemblica* MF26 of this invention can be used to prepare drugs for the prevention, relief, and / or treatment of heart failure with preserved ejection fraction. Attached Figure Description
[0018] Figure 1 The results of differential analysis of mouse gut microbiota and identification of human samples are presented. A shows the analysis of mouse gut microbiota Alpha diversity (Chao1 index); B shows the principal coordinate analysis (PCoA) results of mouse gut microbiota Beta diversity; C shows the top 15 heatmaps of relative abundance of mouse gut microbiota community structure; D shows the boxplot analysis results of relative abundance of the top 10 differentially abundant species in mouse gut microbiota; E shows the Venn analysis results of the top 15 relative abundances and the top 10 differentially abundant species; F shows the absolute content (log value of gene copy number) of *Lactobacillus murinus* in feces of HFpEF and control populations; G shows the relative content of *Lactobacillus murinus* in feces of HFpEF and control populations.
[0019] Figure 2The following are examples of screening, culturing, and identification of *Lactobacillus assemblica* MF26: A shows a schematic diagram of the screening, culturing, and identification process; B shows a photograph of *Lactobacillus assemblica* MF26 colonies on MRS solid plates; C shows TEM observation of the morphology of *Lactobacillus assemblica* MF26; D shows the growth curve of *Lactobacillus assemblica* MF26; and E shows the artificial gastric juice tolerance test of *Lactobacillus assemblica* MF26.
[0020] Figure 3 The results show the complete genome map and phylogenetic tree of Lactobacillus assemblica MF26, where A is the complete genome map of Lactobacillus assemblica MF26; and B is the phylogenetic tree constructed based on the 16S rRNA gene of Lactobacillus assemblica MF26.
[0021] Figure 4 Echocardiographic results of mice with improved cardiac function by combining Lactobacillus MF26 with HFpEF are shown. A is a schematic diagram of the mouse modeling and intervention experimental process; B is the left ventricular EF value of the mouse heart; CE is the analysis of left ventricular diastolic function of the mouse heart; F is the detection of serum BNP level; G is a representative image of pulse and tissue Doppler detection in mouse cardiac echocardiography.
[0022] Figure 5 The staining results of heart tissue sections from mice after intervention with Lactobacillus MF26 (H&E, WGA and Sirius red staining).
[0023] Figure 6 The combined use of Lactobacillus MF26 to treat HFpEF mice improved systolic blood pressure (Figure A) and diastolic blood pressure (Figure B).
[0024] Figure 7 To improve glucose tolerance and fasting blood glucose levels in HFpEF mice using Lactobacillus MF26 combined with oral glucose tolerance test (GTT) in mice; B shows the detection of fasting blood glucose (FBG); and C shows the detection of serum GLP-1 levels.
[0025] Figure 8 The study aimed to improve intestinal permeability and inflammation levels in HFpEF mice using Lactobacillus MF26 in combination with other methods. A represents the results of the FITC dextran assay; BD represents the detection of serum LPS, TNF-α, and CRP levels; E represents H&E staining of mouse colon pathological sections, immunofluorescence detection of occuldin levels and distribution, and alcic acid blue staining analysis of intestinal goblet cell mucin content. Detailed Implementation
[0026] To make the objectives, technical solutions, and advantages of the embodiments of this application clearer, the technical solutions of this application will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are only some embodiments of this application, not all embodiments. Based on the embodiments of this application, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this application.
[0027] The embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.
[0028] Example 1: Study on the expression of *Lactobacillus assemblica* in the intestine of HFpEF mice
[0029] 1. Differences in gut microbiota between mice with heart failure with preserved ejection fraction (HFpEF) and normal mice:
[0030] (1) Laboratory animals and their housing environment:
[0031] Twenty-four 6-8 week old male C57BL / 6N mice were used to establish the model. The mice were purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd.
[0032] Husbandry environment: Mice were housed at the Experimental Animal Center of Henan Cardiovascular Disease Center (Central China Branch of National Cardiovascular Disease Center). The mice were housed in a specific pathogen-free (SPF) environment and under constant temperature (24±2℃) and humidity for 12 hours of light / dark cycle.
[0033] (2) Construction of a mouse HFpEF disease model:
[0034] The mouse HFpEF disease model was established by a diet feeding method, which involved feeding the mice daily with a high-fat diet (Research Diets, D12492) and water containing L-NAME (levo-nitroarginine methyl ester) at a final concentration of 0.5 g / L. The entire modeling process lasted for 12 weeks.
[0035] (3) Experimental grouping and treatment:
[0036] Twenty-four mice were randomly divided into two groups: the NC group (normal control group) and the HFpEF group (disease group), with eight mice in each group, and fed for 12 weeks. Mice in the HFpEF group were modeled according to the above-described method for constructing a mouse HFpEF disease model, while the NC group received no treatment.
[0037] Fecal samples were collected from each group of mice at 12 weeks of modeling to ensure no cross-contamination between individual samples. Following the DNA extraction, amplification, and library construction methods of Shanghai Ouyi Biomedical Technology Co., Ltd., the 16S RNA of the fecal intestinal flora of normal mice (designated as NC group) and HFpEF mice was sequenced and analyzed using Illumina NovaSeq6000.
[0038] For the raw data obtained from 16S RNA sequencing, the primer sequences were first cut out using Cutadapt software. Then, DADA2 was used to perform quality control analyses, including quality filtering, noise reduction, splicing, and chimera removal, on the qualified paired-end raw data from the previous step using the default parameters of QIIME2 (2020.11), resulting in representative sequences and an ASV abundance table. Representative sequences for each ASV were selected using the QIIME2 software package, and all representative sequences were aligned and annotated against the Silva (version 138) database. Species alignment and annotation were performed using the q2-feature-classifier software with default parameters.
[0039] The QIIME2 software was used for α and β diversity analysis. First, the Chao1 index algorithm was used to assess the α diversity of microorganisms in feces. The results are as follows: Figure 1 As shown in Figure A, there was no significant difference in alpha diversity (Chao1) of the gut microbiota between the NC group and the HFpEF group. Principal coordinate analysis (PCoA) was performed using the unweighted Unifrac distance matrix calculated with R software to assess the β diversity of the samples. The results are as follows... Figure 1 As shown in Figure B, PCoA analysis revealed a significant difference in Beta diversity of gut microbiota between the NC group and the HFpEF group.
[0040] Further, based on the relative abundance levels of species, Top 15 heatmaps of community structure were drawn, group by group. Figure 1 C). Simultaneously, based on the R software package, the microbial multivariate statistical algorithms ANOVA / KruskalWallis / Ttest / Wilcoxon were used to conduct species difference analysis. At the species level, the top 10 species with the highest differential abundance were selected for boxplotting to obtain comparisons of abundance differences of dominant differential species within and between groups. Figure 1 D), and then perform Venn analysis on the above two analysis results to find the intersection ( Figure 1 E). By Figure 1 C, 1D, and 1E indicate that *Lactobacillus assemblica* (…) Ligilactobacillusmurinus The relative abundance of ) was significantly reduced in HFpEF mice, and the relative abundance of differential species also decreased significantly, suggesting that the changes in their abundance are closely related to the occurrence and development of HFpEF.
[0041] 2. Fecal samples from HFpEF-positive and control groups L. murinus Analysis of differences in content:
[0042] (1) Experimental fecal samples were collected from patients who visited the Department of Heart Failure at Fuwai Central China Cardiovascular Hospital from November 2024 to April 2025. The relevant ethics approval number is FZX-LUNLI-2024009.
[0043] Inclusion criteria for the HFpEF group: 1) According to domestic and international clinical diagnostic guidelines for HFpEF, patients with left ventricular ejection fraction (LVEF) ≥50% and sinus rhythm: NT-proBNP ≥125 pg / ml or BNP ≥35 pg / ml; the threshold is higher for patients with atrial fibrillation (NT-proBNP ≥365 pg / ml). 2) Structural heart disease or diastolic dysfunction: ultrasound showing left ventricular hypertrophy (LVH), left atrial enlargement (LAE), E / e' ratio ≥15 (reflecting elevated left ventricular filling pressure), and decreased left ventricular diastolic function. 3) In addition, some patients with severe heart failure and significantly decreased left ventricular systolic and diastolic function, significantly decreased LVEF (≤45%), and significantly increased NT-proBNP levels (≥1000 pg / ml) were also included.
[0044] Inclusion criteria for the Ctrl group (control group): 1) LVEF value ≥50%, NT-proBNP ≤100 pg / ml; 2) Ultrasound diagnosis showed no diastolic dysfunction in the left ventricle and no significant changes in systolic function; none of the above individuals had a history of antibiotic use in the past two weeks.
[0045] (2) Experimental methods and results:
[0046] Using mouse-associated lactobacillus L. murinus Specific primers (LactoMF: TCGAACGAAACTTCTTTATCACC (SEQ ID NO.1); LactoMR: CGTTCGCCACTCAACTCTTT (SEQ ID NO.2)) and bacterial 16S RNA specific primers (16S-337F: ACTCCTACGGGAGGCAGCAGT (SEQ ID NO.3); 16S-518R: GTATTACCGCGGCTGCTGGCAC (SEQ ID NO.4)) were used to detect bacterial 16S RNA in feces from the HFpEF and Ctrl groups. L. murinus The content of [specific component] was analyzed by quantitative PCR (absolute and relative content), and the results are as follows: Figure 1 As shown in F and 1G.
[0047] Depend on Figure 1Based on F and 1G, it can be seen that in the feces of the HFpEF group... L. murinus Compared with the Ctrl group, the content, whether in absolute terms ( Figure 1 F), or in terms of the ratio of relative copy number ( Figure 1 G) levels were significantly reduced, suggesting that supplementation with this bacterium may help alleviate diastolic dysfunction caused by HFpEF. This lays the foundation for further research into the effects of *Lactobacillus murineis* on HFpEF.
[0048] Example 2: Obtaining and identifying *Lactobacillus assemblica*.
[0049] The screening, culture, and identification process for Lactobacillus MF26 in mice is as follows: Figure 2 As shown in Figure A, the specific procedure is as follows: Healthy mouse feces were dissolved in sterile PBS and resuspended by shaking. After centrifugation at 200 rpm / min for 1 min, the supernatant was collected and serially diluted to 10⁻⁶. -5 The diluted solution was added to MRS liquid medium, a selective medium for lactic acid bacteria, and incubated at 37°C for 48 h. The bacterial culture was then aspirated and serially diluted to 10⁻⁶. -5 Then, take 200 μL of the diluted solution and spread it evenly onto MRS solid medium. Incubate at 37°C until clear single colonies grow. Figure 2 B).
[0050] Single colonies were picked and cultured in MRS liquid medium at 37°C for 24 hours. 0.5 mL of the bacterial suspension was then centrifuged at 8000g for 2 minutes at 4°C, the supernatant was discarded, and the bacterial pellet was resuspended in sterile water. The bacterial 16S rRNA sequence was amplified using universal primers (27F: 5'-AGAGTTTGAT CCTGGCTCAG-3' (SEQ ID NO.5) and 1492R: 5'-TACGGCTACCTTGTTACGACTT-3' (SEQ ID NO.6)). The amplified product was sent to Qingke Biotechnology Co., Ltd. for sequencing. The 16S rRNA sequencing results were used for sequence alignment using the NCBI BLAST database. Finally, sequence homology analysis confirmed that the isolated strain was *Lactobacillus murineis*, and it was named *Lactobacillus murineis* MF26.
[0051] Bacterial morphology was observed using transmission electron microscopy (TEM). A small amount of logarithmic-phase bacterial suspension was diluted to an appropriate concentration with PBS. A copper mesh with a supporting membrane (membrane side down) was held with forceps and placed in contact with the bacterial suspension for 1-2 min, then excess liquid was aspirated. The copper mesh, membrane side down, was then placed in 2% PTA staining solution (pH 6.5-7.0) for 30-60 s, excess staining solution was aspirated, and the mixture was allowed to dry at room temperature for 10 min. Bacterial morphology was observed using TEM, and the results are shown below. Figure 2As shown in C, *Lactobacillus assemblica* MF26 is rod-shaped, has a cell wall, is approximately 2.8 μm long, and has a diameter of approximately 1.1 μm.
[0052] Add *Lactobacillus aspergillum* MF26 activated to the logarithmic phase to normal MRS liquid culture medium at a ratio of 1‰ (v / v), and measure OD every 2 hours. 600 Absorbance values, and the resulting growth curves are shown below. Figure 2 As shown in D, Figure 2 D shows that its preparation period is from 0 to 4 hours, the logarithmic growth period is from 4 to 8 hours, and the stationary period is from 8 to 20 hours.
[0053] Simultaneously, 1% (w / v) pepsin was added to MRS medium, and the pH was adjusted to 2.5 with hydrochloric acid to prepare artificial gastric fluid. Logarithmic-phase *Lactobacillus assemblica* MF26 was inoculated into the artificial gastric fluid at a ratio of bacterial suspension:artificial gastric fluid = 1:9 (v / v) and anaerobically cultured at 37°C for 3 hours. The bacterial cells were then collected by centrifugation, washed twice in sterile physiological saline, and resuspended in MRS medium. The bacteria were diluted 10-fold and plated onto MRS agar plates. After incubation at 37°C for 12 hours, bacterial colonies on the plates were counted to determine tolerance to the artificial gastric fluid. Results are as follows: Figure 2 As shown in Figure E, the results indicated that the bacterial colony count of *Lactobacillus assemblica* MF26 at 0 hours (before artificial gastric fluid treatment) was approximately 6.63 ± 0.32 × 10⁻⁶. 8 The bacterial colony count was approximately 5.83 ± 0.19 × 10⁻⁶ CFU / mL after 3 hours of treatment. 7 It has a CFU / mL concentration and good tolerance to artificial gastric juice.
[0054] Figure 3 Figure A shows the completed genome sequencing of Lactobacillus assemblica MF26. Figure 3 B is a phylogenetic tree constructed based on the 16S rRNA gene sequence of *Lactobacillus assemblica* strain MF26. Whole-genome sequencing showed that the full-length genome of this bacterium is 2,170,802 bp. Phylogenetic analysis of its 16S rRNA gene showed that it is related to... Ligilactobacillusmurinus GCF_001591685.1 is the most closely related, but currently... Ligilactobacillusmurinus No relevant research reports have been published for GCF_001591685.1. Therefore, it is necessary to further investigate the biological functions of *Lactobacillus murineis* MF26. Next, we will discuss the isolated strain of this strain. Ligilactobacillusmurinus MF26 ( L. murinus MF26 is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M 20251548.
[0055] Example 3: Animal experiment to verify the effect of combined Lactobacillus MF26 in improving heart failure with preserved ejection fraction (HFpEF) in mice.
[0056] 1. Laboratory animals and their housing environment:
[0057] Twenty-four 6-8 week old male C57BL / 6N mice were used to establish the model. The mice were purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd.
[0058] Husbandry environment: Mice were housed at the Experimental Animal Center of Henan Cardiovascular Disease Center (Central China Branch of National Cardiovascular Disease Center). The mice were housed in a specific pathogen-free (SPF) environment and under constant temperature (24±2℃) and humidity for 12 hours of light / dark cycle.
[0059] 2. Experimental grouping and treatment:
[0060] Twenty-four mice were randomly divided into three groups: the NC group (normal control group), the HFpEF group (disease group), and the HFpEF+MF26 group (MF26 treatment group), with eight mice in each group. They were fed for 12 weeks. Mice in the HFpEF and HFpEF+MF26 groups underwent HFpEF disease model construction according to the method described in Example 1 above. The NC group received no treatment. The HFpEF+MF26 group received MF26 treatment immediately after model establishment. L. murinus MF26 bacterial suspension was administered via gavage every two days until the modeling process was completed. L. murinus The MF26 bacterial suspension was administered via gavage at a dose of 200 μL, while the NC and HFpEF groups received the same dose of PBS via gavage. Treatment of mice in each group was as follows: Figure 4 As shown in Figure A. L. murinus The method for preparing MF26 bacterial suspension is as follows: Lactobacillus MF26 is cultured in MRS liquid medium to the logarithmic growth phase. After collecting the bacterial cells, they are washed twice with sterile PBS, and finally resuspended in sterile PBS to prepare a concentration of 1*10⁻⁶. 8 CFU / mL bacterial suspension.
[0061] 3. Effects of MF26 on cardiac function in mice
[0062] Starting from week 6, echocardiography (ECHO) was performed on mice in each group every two weeks. The ECHO monitoring results at week 12 are as follows: Figure 4 As shown in B~4G. From Figure 4 As shown in B, there was no significant difference in EF values among the groups of mice, indicating that left ventricular systolic function was normal. Figure 4As shown in C-4E, compared with the NC group, the E / A ratio was significantly lower in the HFpEF group, while the E / e' and IVRT were significantly increased, which is typical of left ventricular diastolic dysfunction. In contrast, compared with the HFpEF group, the E / A ratio was restored in the HFpEF+MF26 group (MF26 treatment group), while the IVRT and E / e' values were significantly lower.
[0063] Figure 4 F represents the ELISA detection of the heart failure marker BNP after blood collection and serum separation at 12 weeks (Yuanju Bio, YJ34538). Serum BNP levels are shown in the figure. Compared with the HFpEF group (MF26 treatment group), the HFpEF+MF26 group showed a significant decrease in serum BNP levels.
[0064] Figure 4 G-mode ultrasound results showed that the HFpEF+MF26 group (MF26 treatment group) significantly improved left ventricular diastolic dysfunction in HFpEF mice.
[0065] Mice were euthanized at 12 weeks and tissues were collected. Heart tissue sections from each group of mice were stained with H&E, WGA, and Sirius Red. The results are as follows: Figure 5 As shown, Figure 5 The results showed no significant difference in overall heart morphology. The size of myocardial cells in the HFpEF group tended to be larger than that in the other two groups. At the same time, the myocardial tissue in the HFpEF group showed obvious collagen deposition, indicating that fibrosis was aggravated, while myocardial fibrosis was reduced in the HFpEF+MF26 group.
[0066] 4. Effects of MF26 on blood pressure in mice
[0067] Non-invasive blood pressure monitoring was performed on mice in each group at weeks 6, 8, and 10 after modeling. Figure 6 The results show the blood pressure monitoring results of mice at week 10. The results showed that compared with the NC group, the HFpEF group had significantly increased systolic blood pressure (SBP) and diastolic blood pressure (DBP), while compared with the HFpEF group, the HFpEF+MF26 group (MF26 treatment group) had significantly decreased systolic and diastolic blood pressure. These results indicate that MF26 intervention can significantly improve hypertension in HFpEF mice.
[0068] 5. Effects of MF26 on glucose tolerance and fasting blood glucose levels in mice
[0069] (1) Oral glucose tolerance test (OGTT): In the 11th week of modeling, mice were fasted for 16 hours one day in advance while maintaining normal water intake. 8g of glucose was dissolved in 40mL of physiological saline to prepare a 20% glucose solution. The mice were weighed first, and then their basal blood glucose level was measured. The tail tip blood collection method was used, cutting off 1-2mm from the tip of the mouse's tail, discarding the first drop of blood, and using the second drop of blood to monitor blood glucose. The operation should be as gentle as possible to avoid stress-induced hyperglycemia. After measuring the fasting blood glucose, the volume of glucose to be administered (2g / kg) was calculated based on the mouse's weight and administered via intraperitoneal injection. The timer was started 20 minutes after the first mouse was successfully injected intraperitoneally, and all mice were ensured to be injected during this period. The first mouse was able to be monitored for blood glucose at the first time point, i.e., 20 minutes, at the moment the timer rang. The above steps were repeated, and blood glucose was monitored at 40, 60, 90, and 120 minutes.
[0070] The curves of the test results for each group of mice are as follows: Figure 7 As shown in the left figure, the area under the curve is as follows: Figure 7 As shown in the right figure. (From...) Figure 7 As shown in Figure A, compared with the NC group, the glucose metabolism capacity of the HFpEF group was significantly decreased, while the glucose metabolism capacity of the HFpEF+MF26 group (MF26 treatment group) was significantly increased compared with the HFpEF group. The glucose tolerance test results showed that oral administration of MF26 could significantly improve the glucose metabolism capacity of HFpEF mice.
[0071] (2) Fasting blood glucose test: Fasting blood glucose test was performed in the 11th week after modeling. Mice were fasted for 16 hours at 5 pm the day before the experiment, but were allowed normal water intake. Fasting blood glucose was measured at 9 am the following morning using the tail tip blood sampling method. 1-2 mm of blood was cut from the tip of the mouse's tail, the first drop of blood was discarded, and the second drop of blood was used to monitor blood glucose. The procedure should be performed as gently as possible to avoid stress-induced hyperglycemia. The fasting blood glucose (FBG) test results are as follows: Figure 7 As shown in B. Figure 7 B shows that compared with the NC group, the HFpEF group had a significantly increased fasting blood glucose level, while the HFpEF+MF26 group (MF26 treatment group) had a significantly decreased fasting blood glucose level compared with the HFpEF group. Further analysis using ELISA to detect serum GLP-1 levels (Yuanju Bio, YJ33833) yielded the following results: Figure 7 As shown in C. Figure 7 As shown in C, the serum GLP-1 level in the MF26 treatment group was significantly higher than that in the HFpEF group. These experimental results indicate that oral administration of MF26 can significantly improve fasting blood glucose and glucose tolerance in HFpEF mice by increasing GLP-1 levels.
[0072] 6. Effects of MF26 on intestinal permeability and inflammation levels in mice
[0073] FITC-glucan permeability assay confirmed changes in intestinal barrier permeability: Intestinal barrier permeability was analyzed at week 8 of modeling. FITC-glucan was dissolved in PBS, shaken thoroughly to prepare a concentration of 25 mg / mL. Mice were fasted for 4 hours before gavage, followed by gavage at a rate of 20 mL / kg. Three hours later, blood was collected via the orbital vein method. The plasma was then diluted with PBS at a ratio of 1:2. 100 μL of the diluted standard and sample were transferred to a black 96-well plate, and the fluorescence value was read using a fluorescence reader. The FITC-labeled glucan content was calculated using a standard curve.
[0074] The standard curve was plotted as follows: Ex (excitation): 490 nm, Em (emission): 520 nm. Wavelength bandwidth (excitation and emission): 9 nm. Next, 10 μL of 25 mg / mL FITC-Dextran was added to 990 μL of PBS (final FITC-Dextran concentration: 250 μg / mL). Then, 12.5 μL of diluted FITC-Dextran was added to 237.5 μL of PBS (final FITC-Dextran concentration: 12.5 μg / mL). This process was repeated to prepare standard solutions with final concentrations of 3.13 μg / mL, 1.56 μg / mL, 0.78 μg / mL, 0.39 μg / mL, and 0.20 μg / mL. 100 μL of each diluted standard and sample was transferred to a black 96-well plate, and data were read using a fluorescence reader. A standard curve was plotted with the concentrations of the ITC-Dextran standard (12.5, 6.25, 3.13, 1.56, 0.78, 0.39, 0.20 μg / mL) on the x-axis and the FI values of the standard on the y-axis.
[0075] FITC-labeled glucan content, such as Figure 8 As shown in A, by Figure 8 As shown in Figure A, compared with the NC group, the serum FITC-labeled dextran level was significantly increased in the HFpEF group, indicating impaired intestinal mucosal barrier. However, compared with the HFpEF group, the serum FITC-labeled dextran level was significantly decreased in the HFpEF+MF26 group (MF26 treatment group), indicating that oral MF26 can repair intestinal barrier integrity. The FITC-dextran permeability assay showed that oral MF26 can significantly improve intestinal mucosal barrier permeability.
[0076] Mice in each group were euthanized at 12 weeks. Peripheral blood was collected at 12 weeks, and serum levels of LPS (MLbio, ML720839), TNF-α (Yuanju Bio, YJ002095), and CRP (Yuanju Bio, YJ34813) were measured. The results are as follows: Figure 8 As shown in B-8D, the serological indicators in the HFpEF group mice were significantly elevated, while the levels in the HFpEF+MF26 group (MF26 treatment group) were restored, indicating that oral administration of MF26 can significantly improve the level of inflammation in the body.
[0077] After 12 weeks, mice in each group were euthanized, and their colons were collected. After fixation in paraformaldehyde for 24 hours, the colons were dehydrated and embedded in paraffin. Hematologic and inflammatory morphology of the intestinal tissue was analyzed using hematologic and inflammatory methods; Occludin-1 expression was analyzed using immunofluorescence; and the number of goblet cells in the intestinal epithelium was analyzed using alicin blue staining. The results are as follows: Figure 8 As shown in E.
[0078] H&E staining revealed that, compared with the NC group mice, the HFpEF group mice showed significant inflammatory cell infiltration and tissue proliferation in the colon. Immunofluorescence results showed that the protein expression level of the tight junction protein Occludin-1 in the intestinal epithelium of the HFpEF group mice was significantly decreased. Alixin blue staining results showed that the number of goblet cells in the intestinal epithelium of the HFpEF group mice was significantly reduced, while the HFpEF+MF26 group (MF26 treatment group) could improve the above phenotypes.
[0079] All of the above results confirm that oral administration of MF26 can significantly improve intestinal barrier permeability and the level of inflammation in the body.
Claims
1. A type of *Lactobacillus murineis* MF26, characterized in that, The mouse-associated lactobacillus ( Ligilactobacillus murinus The accession number of MF26 is CCTCC NO: M 20251548, the depository is the China Center for Type Culture Collection (CCTCC), the address of which is China Center for Type Culture Collection, Wuhan University, No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province; the deposit date is July 8, 2025.
2. The use of Lactobacillus MF26 of claim 1 in the preparation of a medicament for the prevention, relief and / or treatment of heart failure, wherein the heart failure is a heart failure with preserved ejection fraction.
3. The use of the *Lactobacillus murineis* MF26 of claim 1 in the preparation of a medicament for the prevention, relief, and / or treatment of myocardial fibrosis accompanying the progression of heart failure, wherein the heart failure is a heart failure with preserved ejection fraction.
4. The use of the *Lactobacillus murineis* MF26 of claim 1 in the preparation of a medicament for the prevention, relief, and / or treatment of hypertension accompanying the progression of heart failure, wherein the heart failure is a heart failure with preserved ejection fraction.
5. The use of the *Lactobacillus murineis* MF26 of claim 1 in the preparation of a medicament for the prevention, relief, and / or treatment of heart failure caused by glucose metabolism disorders, wherein the heart failure is a heart failure with preserved ejection fraction.
6. The use of the *Lactobacillus murineis* MF26 of claim 1 in the preparation of a medicament for the prevention, relief, and / or treatment of intestinal mucosal barrier damage accompanying the progression of heart failure, wherein the heart failure is preservative ejection fraction heart failure.
7. A drug, characterized in that, The active ingredient of the drug comprises *Lactobacillus MF26* as described in claim 1 or / and a postgenetic agent of *Lactobacillus MF26*, and the drug is used to prevent, alleviate or / and treat heart failure, wherein the heart failure is preservative ejection fraction heart failure.
8. The medicament according to claim 7, characterized in that, The drug is administered orally, by gavage, or by parenteral administration.
Citation Information
Patent Citations
Murine combined lactobacillus as well as composition and application thereof
CN116970539A
Lactobacillus casei M2b and application thereof
CN119162011A