Zebra fish model for non-alcoholic fatty liver and construction method thereof

Abstract

The invention provides a non-alcoholic fatty liver disease zebra fish model and a construction method thereof, and relates to the technical field of genetic engineering and molecular biology. The sgRNA of the targeted zebrafish fads2 gene contains a guide sequence which can be specifically combined with a nucleotide sequence shown as SEQ ID NO.4 in the fads2 gene. The sgRNA targeting the fads2 gene of the zebrafish can accurately and efficiently target and knock out the fads2 gene of the zebrafish, so that a non-alcoholic fatty liver model which is caused by DHA (docosahexaenoic acid) deficiency and is represented by liver lipid accumulation is successfully constructed, and the sgRNA is a key technical tool for constructing a specific disease model.

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and molecular biology, and more specifically, to a zebrafish model of non-alcoholic fatty liver and its construction method. Background Technology

[0002] Nonalcoholic fatty liver disease (NAFLD) is a prevalent chronic liver disease worldwide, primarily characterized by abnormal lipid accumulation in hepatocytes and unrelated to excessive alcohol consumption. The disease spectrum is broad, progressing from simple fatty liver to nonalcoholic steatohepatitis (NASH), cirrhosis, and even hepatocellular carcinoma. Its pathogenesis is complex, involving multiple factors such as genetic susceptibility, insulin resistance, oxidative stress, and lipid metabolism disorders. In lipid metabolism pathways, long-chain polyunsaturated fatty acids (LC-PUFAs), particularly docosahexaenoic acid (DHA), play a crucial role in maintaining liver health, regulating inflammatory responses, and improving the lipid profile. DHA biosynthesis depends on the catalysis of a series of key enzymes, among which fatty acid desaturase 2 (Fads2) is the rate-limiting enzyme catalyzing the conversion of precursor fatty acids into DHA and other long-chain polyunsaturated fatty acids. Therefore, establishing animal models that accurately mimic diseases caused by specific metabolic pathway defects is of great significance for a deeper understanding of the pathogenesis of NAFLD and the development of effective intervention strategies.

[0003] Currently, animal models for studying non-alcoholic fatty liver disease (NAFLD) are mainly established through high-fat, high-sugar diets or chemical treatment. For example, long-term feeding of high-fat diets can induce pathological features similar to human NAFLD in rodents such as mice and rats, including obesity, insulin resistance, and hepatic steatosis. Furthermore, hepatotoxic chemicals such as carbon tetrachloride (CCl4) can also induce liver damage and fibrosis. In recent years, with the development of genetic engineering technology, genetically modified animal models constructed through gene knockout or transgenic techniques have been widely used. Zebrafish, as an important model vertebrate, exhibits unique advantages in disease model construction due to its short reproductive cycle, transparent embryos, rapid development, and clear genetic background. The emergence of gene-editing technologies such as CRISPR / Cas9 has made it possible to achieve precise and efficient targeted modification of specific genes in model organisms such as zebrafish, providing strong technical support for constructing animal models that accurately simulate human genetic diseases.

[0004] However, existing animal models of NAFLD all have limitations to varying degrees. While dietary induction models can simulate metabolic syndrome caused by unhealthy lifestyles in humans, their induction period is long and costly, and significant individual variability leads to poor reproducibility of experimental results. More importantly, these models result from the combined effects of multiple metabolic disorders, making it difficult to isolate the independent role of single genetic or metabolic pathway defects in disease development. Chemical induction models primarily simulate liver damage and fibrosis, but their pathological characteristics differ significantly from the initial stage of NAFLD—simple fatty liver. Furthermore, chemical substances may cause toxic side effects on extrahepatic tissues, interfering with the accuracy of experimental results. Although some genetic modification models exist, there is still a lack of an animal model that can accurately simulate the pathological phenotype of non-alcoholic fatty liver disease caused by the loss of Fads2 enzyme function, which directly leads to impaired endogenous DHA synthesis.

[0005] In summary, existing animal models for NAFLD research are significantly inadequate in mimicking the specific genetic and molecular mechanisms of the disease. Neither externally induced metabolic disorder models nor existing genetic models can clearly and directly reveal the direct causal relationship between functional defects in a single key gene (such as fads2) and the deficiency of downstream specific metabolites (such as DHA) and the final disease phenotype (NAFLD). This lack of precise models severely limits in-depth exploration of the disease's intrinsic pathogenesis and hinders the screening of drugs targeting specific metabolic pathways and the development and evaluation of precision nutritional intervention strategies. Therefore, there is an urgent need in this field for a stable, reproducible animal model of NAFLD that can accurately mimic specific molecular etiologies.

[0006] In view of this, the present invention is hereby proposed. Summary of the Invention

[0007] The purpose of this invention is to provide a zebrafish model of non-alcoholic fatty liver and its construction method. The sgRNA targeting the zebrafish fads2 gene can accurately and efficiently target and knock out the zebrafish fads2 gene, thereby successfully constructing a non-alcoholic fatty liver model caused by DHA deficiency and characterized by lipid accumulation in the liver. This is a key technical tool for constructing this specific disease model.

[0008] In order to achieve the above-mentioned objectives of the present invention, the following technical solution is adopted: In a first aspect, the present invention provides an sgRNA targeting the zebrafish fads2 gene, wherein the sgRNA targeting the zebrafish fads2 gene contains a guide sequence capable of specifically binding to the nucleotide sequence shown in SEQ ID NO.4 of the fads2 gene.

[0009] In an optional embodiment, the nucleotide sequence shown in SEQ ID NO.4 is located on exon 3 of the zebrafish fads2 gene; and / or, The nucleotide sequence of the sgRNA targeting the zebrafish fads2 gene is shown in SEQ ID NO.1.

[0010] Secondly, the present invention provides a primer sequence for constructing an sgRNA template targeting the zebrafish fads2 gene as described in the foregoing embodiments, comprising a forward primer with a nucleotide sequence as shown in SEQ ID NO.2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.3.

[0011] Thirdly, the present invention provides a method for constructing a zebrafish model of non-alcoholic fatty liver disease, comprising: The sgRNA and Cas9 protein or mRNA encoding the Cas9 protein as described in the foregoing embodiments were injected into zebrafish single-cell stage fertilized eggs to knock out the endogenous fads2 gene. The fertilized eggs that have undergone knockout treatment are cultured and bred to produce offspring. Individuals with homozygous mutations in the fads2 gene are selected and used as a zebrafish model of non-alcoholic fatty liver disease. Preferably, before injecting the sgRNA and Cas9 protein or the mRNA encoding the Cas9 protein as described in the foregoing embodiments into the fertilized eggs of zebrafish in the single-cell stage, the method further includes: performing a PCR reaction using the primer sequence described in the foregoing embodiments to obtain an sgRNA template for in vitro transcription, and then performing in vitro transcription of the sgRNA template to obtain the sgRNA.

[0012] In an optional implementation, the screening to obtain individuals with homozygous mutations in the fads2 gene includes: The injected fertilized eggs were raised to sexual maturity to obtain F0 generation samples, and then bred to obtain F1 generation samples. Individuals carrying the fads2 gene mutation were obtained by screening the F1 generation samples and then self-crossed after being raised to sexual maturity to obtain the F2 generation samples. The F2 generation samples were screened to identify individuals with homozygous mutations in the fads2 gene; Preferably, in the step of screening F1 and / or F2 generation samples, the forward primers with nucleotide sequences as shown in SEQ ID NO.5 are used for Sanger DNA sequencing.

[0013] In an optional implementation, the step involves culturing and reproducing the knockout-treated fertilized eggs, screening for individuals with homozygous mutations in the fads2 gene, and using a forward primer with the nucleotide sequence shown in SEQ ID NO. 5 and a reverse primer with the nucleotide sequence shown in SEQ ID NO. 6; and / or, The number of fertilized embryos injected into zebrafish during the single-cell stage is 200 to 500.

[0014] Fourthly, the present invention provides a non-alcoholic fatty liver zebrafish model, which is constructed using the non-alcoholic fatty liver zebrafish model construction method described in any of the foregoing embodiments.

[0015] Fifthly, the present invention provides a method for detecting mutations in the fads2 gene in zebrafish, comprising: The zebrafish genome to be tested was used as a template; PCR was performed using a forward primer with the nucleotide sequence shown in SEQ ID NO.5 and a reverse primer with the nucleotide sequence shown in SEQ ID NO.6 to obtain PCR products; The PCR product was sequenced, and the presence of a mutation in the fads2 gene was confirmed based on the sequencing results.

[0016] In a sixth aspect, the present invention provides a kit comprising a zebrafish fads2 gene targeting as described in the foregoing embodiments; and / or a primer sequence as described in the foregoing embodiments; and / or a forward primer with a nucleotide sequence as shown in SEQ ID NO. 5 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO. 6.

[0017] In a seventh aspect, the present invention provides the application of sgRNA targeting the zebrafish fads2 gene as described in the foregoing embodiments in constructing a zebrafish fads2 mutant model.

[0018] This invention provides a zebrafish model of non-alcoholic fatty liver and a method for constructing the same. The sgRNA targeting the zebrafish fads2 gene contains a specific guide sequence capable of specifically recognizing and binding to a specific site in the zebrafish fads2 gene (as shown in SEQ ID NO. 4). This high specificity ensures the precision of the gene editing process, accurately guiding the Cas9 protein to the predetermined gene location for manipulation, thereby effectively reducing off-target effects and avoiding unintended interference to other parts of the genome. It is precisely because of this precise guidance that the sgRNA can efficiently mediate the knockout of the fads2 gene.

[0019] Experimental results showed that zebrafish individuals exhibiting loss of function in the fads2 gene and displaying DHA synthesis deficiency and hepatic lipid accumulation were successfully obtained using this sgRNA. This demonstrates its reliability and effectiveness in evoking the expected biological effects. Therefore, this sgRNA is a key starting tool for constructing a novel animal model of non-alcoholic fatty liver disease caused by DHA deficiency, providing a foundation for subsequent research on lipid metabolism, disease mechanisms, and drug screening. Attached Figure Description

[0020] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0021] Figure 1 This is a flowchart illustrating the method for constructing a zebrafish model of non-alcoholic fatty liver in an embodiment of this application. Figure 2 This is a schematic diagram of the fads2 knockout target and mutation site in the embodiments of this application; Figure 3 This application example demonstrates the detection of fads2 expression in 5-day-old juvenile fish using embryo in situ hybridization. Figure 4 This application example demonstrates the use of RT-PCR to detect the expression of fads2 in 5-day-old juvenile fish. Figure 5 This application example demonstrates the use of in situ hybridization to detect the expression of fads2 in the liver. Figure 6 Fatty acid profile analysis and comparison of fats2 mutant and wild-type livers in the embodiments of this application; Figure 7 Oil Red O staining was used in this embodiment of the application to detect lipid droplet accumulation in the livers of fads2 mutant and wild-type livers; Figure 8 KEGG analysis of differentially expressed genes in the liver of the fads2 mutant and wild-type in this application embodiment; Figure 9 This is a demonstration of differentially expressed genes in the liver of the fads2 mutant and wild-type in this application. Detailed Implementation

[0022] The embodiments of the present invention will be described in detail below with reference to examples. However, those skilled in the art will understand that the following examples are for illustrative purposes only and should not be considered as limiting the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer are followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0023] This application provides an sgRNA targeting the zebrafish fads2 gene, wherein the sgRNA targeting the zebrafish fads2 gene contains a guide sequence capable of specifically binding to the nucleotide sequence shown in SEQ ID NO.4 of the fads2 gene.

[0024] The aforementioned sgRNA refers to a single guide RNA (sgRNA) used for gene editing, specifically an sgRNA targeting the zebrafish fads2 gene. This sgRNA is a key component of the CRISPR / Cas9 gene editing system, and its core function is to guide the Cas9 nuclease to precisely locate a specific position in the genome for cleavage, thereby achieving the knockout of the target gene.

[0025] The sgRNA contains a specific guide sequence that specifically recognizes and binds to a nucleotide sequence in the fads2 gene, as shown in SEQ ID NO.4. Specifically: SEQ ID NO. 4: 5'-GGAGAGCCACTGGTTTGTTTGG-3'.

[0026] This high sequence specificity is fundamental to achieving precise gene editing. It ensures that the Cas9 protein can be accurately guided to the pre-defined target site of the fads2 gene, enabling effective cleavage and subsequent gene knockout, while minimizing the risk of impacting other non-target sites in the genome (i.e., off-target effects). Gene knockout mediated by this sgRNA leads to loss of function of the fads2 gene, resulting in a significant reduction in downstream DHA synthesis and hepatic lipid accumulation, ultimately leading to the phenotype of non-alcoholic fatty liver disease.

[0027] In one specific implementation, the target sequence shown in SEQ ID NO.4 is located on exon 3 of the zebrafish fads2 gene. In practical applications, this sgRNA, along with the mRNA encoding the Cas9 protein, is microinjected into single-cell fertilized eggs of zebrafish to initiate the gene editing process, ultimately constructing a disease model that can be used for lipid metabolism research, disease mechanism exploration, and drug screening.

[0028] In an optional embodiment, the nucleotide sequence of the sgRNA targeting the zebrafish fads2 gene is shown in SEQ ID NO. 1. Specifically, SEQ ID NO. 1 is: 5'-TGTAATACGACTCACTATAGGAGAGCCACTGGTTTGTTTGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT -3'.

[0029] In this embodiment, a primer sequence for constructing an sgRNA template targeting the zebrafish fads2 gene as described in the foregoing embodiments is provided, comprising a forward primer with a nucleotide sequence as shown in SEQ ID NO.2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.3. See Table 1 for details: Table 1. Primer sequences for template construction

[0030] refer to Figure 1 In this embodiment of the application, a method for constructing a zebrafish model of non-alcoholic fatty liver is provided, comprising: Step S1: Inject the sgRNA and Cas9 protein or the mRNA encoding the Cas9 protein as described in the foregoing embodiments into the fertilized eggs of zebrafish in the single-cell stage to knock out the endogenous fads2 gene.

[0031] In this step, the sgRNA prepared in the previous step is mixed with the mRNA encoding the Cas9 protein. Subsequently, this mixture is injected into zebrafish single-cell stage fertilized eggs using microinjection technology to initiate the knockout process of the endogenous fads2 gene.

[0032] Step S2: The fertilized eggs after knockout treatment are cultured and reproduced to obtain individuals with homozygous mutations in the fads2 gene, which are used as zebrafish models of non-alcoholic fatty liver disease.

[0033] Furthermore, step S2, screening for individuals with homozygous mutations in the fads2 gene, includes: Step S21: The injected fertilized eggs are raised to sexual maturity to obtain F0 generation samples, and then reproduced to obtain F1 generation samples.

[0034] This step involves culturing the injected fertilized eggs under suitable conditions to allow them to develop and grow to sexual maturity, resulting in F0 generation adult fish.

[0035] F0 generation adult fish were bred to obtain their offspring, namely F1 generation samples. The F1 generation samples were then screened to identify individuals that successfully carried the fads2 gene mutation.

[0036] Step S22: Select individuals carrying the fads2 gene mutation from the F1 generation samples, raise them to sexual maturity, and then self-fertilize them to obtain the F2 generation samples.

[0037] Step S23: Screen the F2 generation samples to identify individuals with homozygous mutations in the fads2 gene.

[0038] The selected F1 generation individuals carrying the mutation were raised to sexual maturity and then self-crossed to obtain F2 generation samples. Finally, the F2 generation samples were screened again to identify homozygous mutant individuals with both chromosomes showing mutations in the fads2 gene. These homozygous mutant zebrafish are the final zebrafish model of non-alcoholic fatty liver disease.

[0039] In an optional embodiment, before injecting the sgRNA and Cas9 protein or the mRNA encoding the Cas9 protein as described in the foregoing embodiments into the fertilized egg of a zebrafish in the single-cell stage, step S1 further includes: Step S3: Perform a PCR reaction using the primer sequence described in the aforementioned embodiments to obtain an sgRNA template for in vitro transcription, and then perform in vitro transcription of the sgRNA template to obtain the sgRNA.

[0040] In this step, the primer sequences defined in the aforementioned embodiments (including the forward primer of SEQ ID NO.2 and the reverse primer of SEQ ID NO.3) are used to perform a PCR reaction to obtain an sgRNA template for in vitro transcription.

[0041] Then, the obtained sgRNA template was transcribed in vitro to synthesize and purify the sgRNA that specifically targets the fads2 gene.

[0042] In an optional implementation, in the step of screening F1 and / or F2 generation samples, a forward primer with a nucleotide sequence as shown in SEQ ID NO.5 is used for Sanger DNA sequencing.

[0043] In an optional implementation, the step involves culturing and breeding the fertilized eggs after knockout treatment, screening for individuals with homozygous mutations in the fads2 gene, and using a forward primer with a nucleotide sequence as shown in SEQ ID NO.5 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.6.

[0044] Table 2. Primer sequences for PCR amplification

[0045] In an optional implementation, the number of fertilized egg embryos injected from zebrafish at the single-cell stage is 200 to 500. For example, it can be 200, 300, 400, 500, etc.

[0046] For example, methods for constructing a zebrafish model of non-alcoholic fatty liver disease may include: (1) Design and synthesize sgRNA sequences for the target sites of the fads2 gene, wherein the sgRNA has a nucleotide sequence as shown in SEQ ID NO.1; (2) Synthesize primers for constructing gRNA transcription templates, including forward primer sequences such as SEQ ID NO.2 and reverse primer sequences such as SEQ ID NO.3; (3) Using the primers synthesized in step S2, PCR was performed with pMD19T-gRNA as the template for the PCR reaction. The PCR product was purified and recovered, and the purified product was used as the template for in vitro transcription of gRNA. (4) The gRNA in vitro transcription template prepared in step (3) is transcribed in vitro using T7 transcriptase to finally obtain purified gRNA; (5) The gRNA and Cas9 mRNA obtained in step (4) are mixed and microinjected into zebrafish single-cell stage fertilized eggs; (6) After the injection in step (5) is completed, culture for 24 hours, collect some single-cell zebrafish fertilized eggs after microinjection, culture for 24 hours, extract the genome of the embryo, PCR amplify the target sequence containing the target site and sequence it with forward primers; (7) The injection batch of embryos with random peaks near the target site in the sequencing results are put into the feeding system and fed until sexual maturity; the next generation of embryos are screened to detect the effective mutation type of zebrafish, thereby obtaining the fads2 deletion mutant zebrafish, that is, the retinal disease zebrafish model.

[0047] For example, specific zebrafish model construction methods can be adopted, including: Step S10: Based on the CRISPR / Cas9 knockout principle, design and synthesize the sgRNA sequence of the fads2 gene target site, wherein the sgRNA has a nucleotide sequence as shown in SEQ ID NO.1; Step S20: Synthesize PCR primers for constructing a synthetic sgRNA template. The primer sequences include the forward primer sequence as shown in SEQ ID NO.2 and the reverse primer sequence as shown in SEQ ID NO.3. Step S30: Using the primers synthesized in step S20, PCR is performed with pMD19T-gRNA as the template for the PCR reaction. The PCR product is purified and recovered, and the purified product is used as the template for in vitro transcription of gRNA. Preferably, the purification and recovery in this step is performed using the GeneJET PCR Purification Kit (Thermo Fisher Scientific, K0701), and the operation method is in accordance with the kit instructions. Step S40: The gRNA in vitro transcription template prepared in step S30 is transcribed in vitro using T7 transcriptase to obtain purified gRNA. Preferably, this in vitro transcription step uses the domestic Novizan T7 HighYield RNA Transcription Kit (TR101-01), and the operation method is performed according to the kit instructions. The transcribed product is digested with DNase I. The digested product is purified and recovered using the SigmaSpin™ Sequencing Reaction Clearance Kit (Sigma, S5059-70EA), and the operation method is performed according to the kit instructions. Step S50: The gRNA and Cas9 mRNA obtained in step S40 are mixed and microinjected into zebrafish single-cell stage fertilized eggs. Step S60: After the injection in step S5 is completed, the cells are cultured for 24 hours. A portion of the microinjected single-cell zebrafish fertilized eggs are collected. After 24 hours of culture, the genome of the embryos is extracted, and the target sequence containing the target site is amplified by PCR and sequenced. Preferably, the culture environment in this step is to place a portion of the microinjected single-cell zebrafish fertilized eggs in 0.3 x Danieau's buffer. In step S70, embryos from the injection batch that showed disordered peaks near the target site in the sequencing results were introduced into the rearing system and reared until sexual maturity. A testcross with wild-type embryos was conducted to obtain F1 heterozygous mutants. After the F1 generation reached sexual maturity, the effective mutation type was detected by tail fin analysis, yielding two effective mutant lines. The F1 generation was then self-crossed to select homozygous mutant lines for the F2 generation, thereby obtaining zebrafish with the fads2 deletion mutation.

[0048] Furthermore, after step S7, the following steps can also be set: (1) Take the fads2 deletion mutant zebrafish and wild-type zebrafish juveniles from step S7 for fads2 gene expression analysis; (2) Take the livers of the fads2 deletion mutant zebrafish and wild-type zebrafish from step S7 for fads2 gene expression analysis; (3) Fatty acid profile analysis was performed on the livers of zebrafish with the fads2 deletion mutant and wild-type zebrafish from step S7. (4) Frozen sections of liver from fads2 deletion mutant and wild-type zebrafish from step S7 were stained with Oil Red O. (5) Take liver tissue from zebrafish with fads2 deletion mutation and wild-type zebrafish from step S7 for transcriptome analysis; (6) By analyzing and summarizing the data obtained in steps (1) to (5), the changes in DHA content and non-alcoholic fatty liver phenotype of fads2 deletion mutant zebrafish are described.

[0049] In this embodiment of the application, a non-alcoholic fatty liver zebrafish model is provided, which is constructed using the non-alcoholic fatty liver zebrafish model construction method described in any of the foregoing embodiments.

[0050] This application provides a method for detecting mutations in the zebrafish fads2 gene, including: Step S100: Use the zebrafish genome to be tested as a template; Step S200: A PCR reaction is performed using a forward primer with a nucleotide sequence as shown in SEQ ID NO.5 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.6 to obtain the PCR product; Step S300: Sequencing the PCR product to confirm whether there is a mutation in the fads2 gene based on the sequencing results.

[0051] In this application embodiment, a kit is provided, comprising a zebrafish fads2 gene targeting as described in the foregoing embodiments; and / or a primer sequence as described in the foregoing embodiments; and / or a forward primer with a nucleotide sequence as shown in SEQ ID NO.5 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.6.

[0052] In this application embodiment, the application of sgRNA targeting the zebrafish fads2 gene as described in the foregoing embodiments is provided in the construction of a zebrafish fads2 mutant model.

[0053] The above models can be used for zebrafish models of DHA synthesis deficiency and zebrafish models of non-alcoholic fatty liver disease.

[0054] The present invention will be further illustrated below with specific embodiments. However, it should be understood that these embodiments are merely for the purpose of more detailed illustration and should not be construed as limiting the present invention in any way.

[0055] Example 1 In this embodiment, gRNA was obtained.

[0056] Experimental methods: 1. Based on the CRISPR / Cas9 knockout principle, design and synthesize sgRNA sequences containing the fads2 gene target site sequence, where the fads2 gene target site is as follows: Figure 2As shown in the figure (the underlined sequence in the gene sequence is the target sequence, and the four bases in the box: TTTG are the specific sequence of the deletion mutation), preferably, the target sequence of the gRNA is located on exon 10 of the fads2 gene, and the site sequence is the nucleotide sequence shown in SEQ ID NO.4. The sgRNA has the nucleotide sequence shown in SEQ ID NO.1. Wherein, SEQ ID NO.1: 5'-TGTAATACGACTCACTATAGGAGAGCCACTGGTTTGTTTGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT-3'.

[0057] S2: Synthesize PCR primers for constructing a template for synthesizing sgRNA. The synthesized primer sequences include the forward primer sequence as shown in SEQ ID NO.2 and the reverse primer sequence as shown in SEQ ID NO.3. SEQ ID NO.2: 5'-TGTAATACGACTCACTATAGGAGAGCCACTGGTTTGTTGTTTTAGAGCTAGAAATAGC -3'; SEQ ID NO.3: 5'-AGCACCGACTCGGTGCCACTTTTTC-3'.

[0058] 3. Using the primers synthesized in step 2, perform PCR with pMD19T-gRNA as the template for the PCR reaction, purify and recover the PCR product, and prepare the gRNA in vitro transcription template. To obtain the gRNA template, perform PCR amplification using the following reaction system: Table 3. Reaction System

[0059] Prepare a 200 μL PCR system and follow the PCR program as follows: 94 ºC for 5 min; 94 ºC for 30 s; 60 ºC for 30 s; 72 ºC for 30 s, 30 cycles; 72 ºC for 10 min.

[0060] The purification and recovery steps for PCR products are as follows: (1) Column equilibration step: Add 500 μL of equilibration solution BL to the adsorption column CB2 (the adsorption column is placed in the collection tube), centrifuge at 12,000 rpm (~13,400×g) for 1 min, discard the waste liquid in the collection tube, and put the adsorption column CB2 back into the collection tube.

[0061] (2) Estimate the volume of the PCR reaction solution or enzyme digestion reaction solution, add 5 times the volume of binding solution PB, and mix thoroughly.

[0062] (3) Add the solution obtained in the previous step to an adsorption column CB2 (place the adsorption column in the collection tube), place at room temperature for 2 min, centrifuge at 12,000 rpm (~13,400×g) for 30-60 sec, discard the waste liquid in the collection tube, and place the adsorption column CB2 into the collection tube.

[0063] (4) Add 600 μL of washing solution PW to the adsorption column CB2 (please check whether anhydrous ethanol has been added before use), centrifuge at 12,000 rpm (~13,400×g) for 30-60 seconds, discard the waste liquid in the collection tube, and put the adsorption column CB2 into the collection tube.

[0064] (5) Repeat step (4).

[0065] (6) Place the adsorption column CB2 back into the collection tube and centrifuge at 12,000 rpm (~13,400×g) for 2 min to remove as much of the washing solution as possible. Place the adsorption column CB2 at room temperature for several minutes to dry it thoroughly to prevent residual washing solution from affecting the next step of the experiment.

[0066] (7) Place the adsorption column CB2 into a clean centrifuge tube, add 30-50 μl of elution buffer EB to the middle of the adsorption membrane, and incubate at room temperature for 2 min. Centrifuge at 12,000 rpm (~13,400×g) for 2 min to collect the DNA solution.

[0067] 4. The gRNA in vitro transcription template obtained in step 3 is transcribed in vitro using T7 transcriptase, and the gRNA is purified and recovered.

[0068] T7 RNA transcriptase was used to transcribe gRNA in vitro. The components were then added to the following mixture and thoroughly combined: Table 4. Reaction System

[0069] After reacting at 37 ºC for 1 hour, the synthesized gRNA was purified, and the specific steps are as follows: (1) DNase I treatment: Add 2.5 μL 10X buffer and 2 μL DNase I, and react at 37 ºC for 15 min to remove DNA template; (2) Then use SigmaSpin TMPurification was performed using the Sequencing reaction clean-up kit: the purification column was placed in a 2 mL collection tube and centrifuged at 2800 rpm for 15 s; (3) Twist off the bottom sealing column of the tube, then discard the tube cap, put the purification column back into the collection tube, and centrifuge at 2800 rpm for 2 min; (4) Place the purification column into a new RNase-free EP tube and discard the collection tube; (5) Add the gRNA synthesis solution to the purification column and centrifuge at 2800 rpm for 4 min; (6) Collect the column solution, perform electrophoresis to detect and determine the concentration, and store it in a -80 ºC refrigerator for later use.

[0070] Example 2 In this embodiment, Cas9 mRNA is synthesized.

[0071] Experimental methods: 1. The plasmid containing the full-length Cas9 sequence optimized with zebrafish codons was linearized by restriction endonuclease digestion and purified using the GeneJET PCR Purification Kit for use as a transcription template.

[0072] The purification and recovery steps for PCR products are as follows: (1) Column equilibration step: Add 500 μL of equilibration solution BL to the adsorption column CB2 (the adsorption column is placed in the collection tube), centrifuge at 12,000 rpm (~13,400×g) for 1 min, discard the waste liquid in the collection tube, and put the adsorption column CB2 back into the collection tube.

[0073] (2) Estimate the volume of the PCR reaction solution or enzyme digestion reaction solution, add 5 times the volume of binding solution PB, and mix thoroughly.

[0074] (3) Add the solution obtained in the previous step to an adsorption column CB2 (place the adsorption column in the collection tube), place at room temperature for 2 min, centrifuge at 12,000 rpm (~13,400×g) for 30-60 sec, discard the waste liquid in the collection tube, and place the adsorption column CB2 into the collection tube.

[0075] (4) Add 600 μL of washing solution PW to the adsorption column CB2 (please check whether anhydrous ethanol has been added before use), centrifuge at 12,000 rpm (~13,400×g) for 30-60 seconds, discard the waste liquid in the collection tube, and put the adsorption column CB2 into the collection tube.

[0076] (5) Repeat step (4).

[0077] (6) Place the adsorption column CB2 back into the collection tube and centrifuge at 12,000 rpm (~13,400×g) for 2 min to remove as much of the washing solution as possible. Place the adsorption column CB2 at room temperature for several minutes to dry it thoroughly to prevent residual washing solution from affecting the next step of the experiment.

[0078] (7) Place the adsorption column CB2 into a clean centrifuge tube, add 30-50 μL of elution buffer EB to the center of the adsorption membrane, and incubate at room temperature for 2 min. Centrifuge at 12,000 rpm (~13,400×g) for 2 min to collect the DNA solution. Use the Ambion mMessage mMachine in vitro transcription kit to synthesize Cas9 mRNA in vitro.

[0079] The reaction system is as follows: Table 5. Reaction System

[0080] After the reaction system is prepared, mix it well and incubate it in a water bath at 37 ℃ for 2 hours.

[0081] 2. Purify and recover Cas9 mRNA according to the following steps: (1) Add 1 μL of the DNase provided in the kit to the reaction system, mix well, and incubate in a water bath at 37 °C for 15 minutes; (2) Add 20 μL of 5 M ammonium acetate, mix well, and place on ice for 10 minutes; (3) Centrifuge at 4 ℃ and 12000 rpm for 15 minutes. The white precipitate is mRNA. (4) Discard the supernatant, wash the precipitate with 75% ethanol, and centrifuge at 7500 rpm for 5 minutes at 4 ℃; (5) Discard the supernatant, air dry the precipitate, and add 10 μL of enzyme-free water to dissolve the precipitate; (6) Take 0.5 μL of RNA, dilute it 20 times, and test its concentration and purity. Then take 10 μL of the dilution solution for agarose gel electrophoresis to test the degree of degradation.

[0082] Example 3 In this embodiment, fads2 The construction and selection of individuals are completely lacking.

[0083] Experimental methods: 1. The gRNA and Cas9 mRNA obtained in the aforementioned steps were mixed and microinjected into single-cell stage zebrafish fertilized eggs, with 1 nL injected into each embryo.

[0084] 2. After the gRNA and Cas9 mRNA are synthesized, prepare the injection sample according to the following system. The injection system is as follows: 3 μL: Table 6. Injection System

[0085] The number of single-cell stage zebrafish fertilized egg embryos injected ranges from 200 to 500. In this embodiment, the number of single-cell stage zebrafish fertilized egg embryos injected is 500.

[0086] 3. After injection, culture for 24 hours, collect embryos obtained from single-cell stage zebrafish fertilized eggs after microinjection, extract the genome, amplify the target sequence containing the target site by PCR and sequence it; Perform PCR amplification of the target sequence containing the target site using the following reaction system: Table 7. Injection System

[0087] The PCR program was as follows: 94 ºC for 5 min; 94 ºC for 30 s; 60 ºC for 30 s; 72 ºC for 30 s, 35 cycles; 72 ºC for 10 min. The primer sequences used for sequencing include the forward primer sequence of SEQ ID No. 5 and the reverse primer sequence of SEQ ID No. 6: SEQ ID No.5: 5'-ATCGAAAATCAACTGTGA-3'; SEQ ID No.6: 5'-CCAGTCGTTGAAGGCAGA-3'; For example, the primer in SEQ ID No. 5 is also a primer used for Sanger DNA sequencing.

[0088] 4. Embryos with random peaks near the target site in the sequencing results were introduced into the rearing system and raised until sexual maturity. Effective mutant types of zebrafish were detected by screening the tail fins of the F1 generation. After reaching sexual maturity, the F1 generation was self-crossed to obtain F2 individuals. Individuals with homozygous mutants were then selected and identified through tail fin screening, thus obtaining… fads2 A completely missing individual.

[0089] Example 4 In this embodiment, fads2 Functional validation and phenotypic analysis of individuals with complete absence of function.

[0090] Experimental methods: 1. Take the sample prepared in the above examples. fads2 The various organizations of a completely missing individual fads2 Gene expression analysis; like Figure 2 As shown, the target sequence of the gRNA is located on exon 10 of the fads2 gene. Knockout results in the mutant fads2 having 4 bases missing at the target site, which leads to premature termination of translation of the Fads2 protein.

[0091] 2. Five days after fertilization, juvenile zebrafish with the fads2 gene mutation from Example 3 and wild-type zebrafish were used to detect fads2 expression using whole-mount in situ hybridization (WHS). The WHS technique was described in Whole-Mount In Situ Hybridization-Thisse Lab (2012). Figure 3 As shown, the expression of fads2 is completely absent in the fads2 mutant.

[0092] 3. Juvenile zebrafish with the fads2 gene mutation from Example 3 and wild-type zebrafish, 5 days after fertilization, were used to detect the expression of fads2 using RT-PCR. For example... Figure 4 As shown, the mRNA level of fads2 in the mutant was significantly lower than that in the wild type (*** indicates P<0.001).

[0093] 4. Liver samples from adult wild-type zebrafish and the mutated fads2 gene from Example 3 were frozen, sectioned, and subjected to in situ hybridization to detect fads2 expression. (For example...) Figure 5 As shown, fads2 expression is completely absent in the mutant liver.

[0094] The results of steps 2-4 above demonstrate that the fads2 gene mutation constructed in this embodiment can effectively mutate the gRNA target sequence located on exon 10 of the fads2 gene, resulting in a significant reduction or absence of fads2 expression in the mutant.

[0095] 5. The livers of adult zebrafish with the fads2 gene mutation from Example 3 and wild-type zebrafish were ground and the total fatty acids were extracted. The changes in the n-6 and n-3 fatty acid content of C18, C20, and C22 zebrafish were detected by HPLC. Figure 6 As shown, compared with wild-type zebrafish, the fads2 gene mutant zebrafish constructed using this embodiment has significantly reduced DHA content in its liver, indicating that the fads2 mutation leads to DHA synthesis defects. 6. Liver tissue from the fads2 gene mutation and wild-type zebrafish in Example 3 was subjected to Oil Red O histological observation. For example... Figure 7 As shown, compared to wild-type zebrafish, the fats2 gene mutant zebrafish constructed using this embodiment showed a significant increase in the number of lipid droplets in their livers.

[0096] 7. Transcriptome analysis was performed on the livers of the gene mutation and wild-type zebrafish from Example 3 to screen for differentially expressed genes, and KEGG analysis was conducted on these differentially expressed genes. For example... Figure 8 As shown, the absence of fads2 leads to changes in the unsaturated fatty acid synthesis pathway, arachidonic acid metabolism pathway, and insulin metabolism pathway.

[0097] 8. Analyze the transcriptome data from step 7. The results are as follows: Figure 9 As shown, in the liver of the fads2 mutant, the expression of genes related to fatty acid synthesis, srebf1 and scd, was upregulated, while the expression of genes related to fatty acid transport, apoa1 and apob, was significantly decreased, indicating that the fads2 mutation increases fatty acid synthesis and reduces fatty acid transport.

[0098] 9. By analyzing and summarizing the data obtained in steps 2-6, it is shown that the fads2 gene mutation leads to a defect in DHA synthesis in the liver, thereby causing the disease phenotype of non-alcoholic fatty liver disease. This demonstrates that the fads2 constructed in this embodiment is a good model for studying non-alcoholic fatty liver disease.

[0099] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. An sgRNA targeting the zebrafish fads2 gene, characterized in that, The sgRNA targeting the zebrafish fads2 gene contains a guide sequence that can specifically bind to the nucleotide sequence shown in SEQ ID NO.4 of the fads2 gene.

2. The sgRNA targeting the zebrafish fads2 gene as described in claim 1, characterized in that, The nucleotide sequence shown in SEQ ID NO.4 is located on exon 3 of the zebrafish fads2 gene; and / or, The nucleotide sequence of the sgRNA targeting the zebrafish fads2 gene is shown in SEQ ID NO.

1.

3. A primer sequence for constructing an sgRNA template targeting the zebrafish fads2 gene as described in claim 1 or 2, characterized in that, This includes a forward primer with a nucleotide sequence as shown in SEQ ID NO.2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.

3.

4. A method for constructing a zebrafish model of non-alcoholic fatty liver disease, characterized in that, include: The sgRNA as described in claim 1 or 2, along with the Cas9 protein or the mRNA encoding the Cas9 protein, was injected into zebrafish zygotes in the single-cell stage to knock out the endogenous fads2 gene. The fertilized eggs that have undergone knockout treatment are cultured and bred to produce offspring. Individuals with homozygous mutations in the fads2 gene are selected and used as a zebrafish model of non-alcoholic fatty liver disease. Preferably, before injecting the sgRNA and Cas9 protein or the mRNA encoding the Cas9 protein as described in claim 1 or 2 into a zebrafish single-cell stage fertilized egg, the step further includes: performing a PCR reaction using the primer sequence as described in claim 3 to obtain an sgRNA template for in vitro transcription, and then performing in vitro transcription of the sgRNA template to obtain the sgRNA.

5. The method for constructing the non-alcoholic fatty liver zebrafish model as described in claim 4, characterized in that, Individuals with homozygous mutations in the fads2 gene obtained through screening include: The injected fertilized eggs were raised to sexual maturity to obtain F0 generation samples, and then bred to obtain F1 generation samples. Individuals carrying the fads2 gene mutation were obtained by screening the F1 generation samples and then self-crossed after being raised to sexual maturity to obtain the F2 generation samples. The F2 generation samples were screened to identify individuals with homozygous mutations in the fads2 gene; Preferably, in the step of screening F1 and / or F2 generation samples, the forward primers with nucleotide sequences as shown in SEQ ID NO.5 are used for Sanger DNA sequencing.

6. The method for constructing the non-alcoholic fatty liver zebrafish model as described in claim 4, characterized in that, The step involves culturing and reproducing the fertilized eggs after the knockout treatment, screening for individuals with homozygous mutations in the fads2 gene, and using a forward primer with the nucleotide sequence shown in SEQ ID NO. 5 and a reverse primer with the nucleotide sequence shown in SEQ ID NO. 6; and / or, The number of fertilized embryos injected into zebrafish during the single-cell stage is 200 to 500.

7. A zebrafish model of non-alcoholic fatty liver disease, characterized in that, The model was constructed using the method described in any one of claims 4-6 for constructing a zebrafish model of non-alcoholic fatty liver.

8. A method for detecting mutations in the fads2 gene in zebrafish, characterized in that, include: The zebrafish genome to be tested was used as a template; PCR was performed using a forward primer with the nucleotide sequence shown in SEQ ID NO.5 and a reverse primer with the nucleotide sequence shown in SEQ ID NO.6 to obtain PCR products; The PCR product was sequenced, and the presence of a mutation in the fads2 gene was confirmed based on the sequencing results.

9. A reagent kit, characterized in that, Includes the target zebrafish fads2 gene as described in claim 1 or 2; and / or, the primer sequence as described in claim 3; and / or, the forward primer with the nucleotide sequence shown in SEQ ID NO. 5 and the reverse primer with the nucleotide sequence shown in SEQ ID NO.

6.

10. The application of the sgRNA targeting the zebrafish fads2 gene as described in claim 1 or 2 in constructing a zebrafish fads2 mutant model.

Images