Gene, recombinant vector and regulation method for regulating cotton plant height

Abstract

The invention provides a gene for regulating cotton plant height, a recombinant vector and a regulation method, and belongs to the technical field of gene engineering. The invention provides a gene GbGA2ox2f for regulating and controlling the plant height of cotton. The gene GbGA2ox2f comprises a nucleotide sequence as shown in SEQ ID No. 1. It is found that after the expression quantity of the gene GbGA2ox2f is over-expressed in arabidopsis thaliana, the main root length of transgenic arabidopsis thaliana is remarkably shortened, and the plant height is remarkably shortened; after the expression quantity of the gene GbGA2ox2f is reduced in the sea island cotton, the plant height and the active gibberellin content are obviously increased. In addition, the invention finds that the GbKNOX can be specifically combined on the TATTTTTAAAAA site of the GbGA2ox2f promoter. According to the invention, valuable genes, carriers and regulation methods are provided for breeding gossypium barbadense varieties with suitable plant heights, and a foundation is laid for deeply exploring the action mechanism of GbGA2ox2f for regulating the plant heights.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering, in particular to a gene for regulating cotton plant height, a recombinant vector and a regulation method. BACKGROUND

[0002] Plant height is one of the important agronomic traits of high crops, and over-high plants are prone to lodging and yield reduction, while dwarf plants have strong anti-lodging ability and high yield; meanwhile, reasonable plant type is the growth basis and morphological characteristics of high-yield varieties, and dwarf trait is an important aspect of ideal plant type, so dwarf breeding is of great significance for cultivating ideal plant type.

[0003] Cotton is an important economic crop, and natural cotton fiber is the main raw material for the world's textile industry, and Gossypium barbadense L. is the best cotton cultivar in fiber quality. Cotton plants are relatively high, and are easily affected by strong winds and waterlogging, which leads to lodging and affects fiber quality. Through dwarf breeding to control plant height, the problem of lodging can be effectively solved, so as to realize the stable yield of cotton varieties. In addition, with the increasing labor cost year by year, the cost of cotton planting increases, and the income of cotton farmers decreases, and the implementation of mechanical cotton picking technology is an effective means to reduce the cost of cotton planting and increase the income of cotton farmers. However, mechanical cotton picking has certain requirements for the plant type of cotton: the first fruit branch is 20-25 cm from the ground, the internode length of the main stem is 6-7 cm, and the plant height is 65-70 cm. Although chemical regulation can achieve this goal, the use of a large amount of mepiquat chloride will increase the economic burden of cotton farmers.

[0004] Xinjiang is the main producing area of cotton industry development in China, and its mechanical picking is an important direction of cotton variety improvement in Xinjiang cotton industry. Among the many mechanical picking related traits of cotton, plant height is closely related to yield, lodging resistance and mechanization. Over-high plant height increases the risk of crop lodging, and over-low plant height affects biomass, but there is no report on the regulation gene of Gossypium barbadense plant height. SUMMARY

[0005] The present application provides a gene for regulating cotton plant height, a recombinant vector and a regulation method, which is significantly related to gibberellin content, and lays a foundation for breeding Gossypium barbadense varieties with suitable plant height and further studying the action mechanism of GbGA2ox2f regulating plant height.

[0006] The present application provides a gene GbGA2ox2f for regulating cotton plant height, which comprises the nucleotide sequence shown in SEQ ID No. 1, or a nucleotide sequence having 85% or more homology with the sequence shown in SEQ ID No. 1.

[0007] The application further provides a primer pair for amplifying the gene GbGA2ox2f.

[0008] In one specific embodiment of the application, the nucleotide sequence comprises an upstream primer shown in SEQ ID No. 2 and a downstream primer shown in SEQ ID No. 3.

[0009] The application further provides a recombinant vector comprising the gene GbGA2ox2f.

[0010] In one specific embodiment of the application, the recombinant vector comprises a recombinant vector for increasing plant height and a recombinant vector for decreasing plant height.

[0011] The recombinant vector for decreasing plant height comprises a recombinant vector for overexpressing the gene GbGA2ox2f.

[0012] The recombinant vector for increasing plant height comprises a recombinant vector for inhibiting expression of the gene GbGA2ox2f.

[0013] The application further provides application of the gene GbGA2ox2f or the recombinant vector in regulating plant height and / or active gibberellin content.

[0014] In one specific embodiment of the application, the active gibberellin comprises GA1 and / or GA4.

[0015] The application further provides a method for regulating plant height and active gibberellin content, comprising transforming a target plant with the recombinant vector.

[0016] The application further provides a method for increasing cotton plant height and improving active gibberellin content, comprising silencing expression of the gene GbGA2ox2f in cotton genome.

[0017] The application further provides a method for decreasing plant height, comprising overexpressing the gene GbGA2ox2f in a target plant genome.

[0018] Beneficial Effects: This invention uses endogenous hormone assays and transcriptomic analysis on compact and loose-type Island cotton materials to screen for differentially expressed genes, GbGA2ox2f, which are significantly correlated with gibberellin content in different plant types of Island cotton. The nucleotide sequence of the GbGA2ox2f gene is shown in SEQ ID No. 1. Subcellular localization results show that the GbGA2ox2f gene is located in the nucleus and cytoplasm. This invention verifies its function in regulating plant height using heterologous overexpression and virus-mediated gene silencing (VIGS). Specifically, heterologous overexpression of the GbGA2ox2f gene in Arabidopsis thaliana significantly reduced root length and plant height; downregulation of the GbGA2ox2f gene expression level in Island cotton significantly increased plant height and active gibberellin content. Furthermore, this invention discovers that GbKNOX specifically binds to the TATTTTTTAAAAA site of the GbGA2ox2f promoter. Attached Figure Description

[0019] Figure 1 Figure 1 shows the results of GbGA2ox2f gene expression and endogenous gibberellin content determination in sea-island cotton (H1 and H4) with different plant types. A: Plant type of compact sea-island cotton H1 and loose sea-island cotton H4, scale bar = 50 cm; B: Detection of relative expression level of GbGA2ox2f gene in H1 and H4; C: Determination of endogenous gibberellin content in H1 and H4; D: Correlation analysis between endogenous gibberellin and GbGA2ox2f gene in H1 and H4; *, **, and *** indicate significant differences at the P<0.05, 0.01, and 0.001 levels, respectively.

[0020] Figure 2 A schematic diagram of the construction of the subcellular localization vector, where A: schematic diagram of the subcellular localization vector structure; B: target fragment for bacterial PCR; C: EcoRI digestion fragment of the target fragment;

[0021] Figure 3 This is a diagram showing the subcellular localization results of GbGA2ox2f;

[0022] Figure 4 Phenotypic analysis of transgenic Arabidopsis thaliana heterologously overexpressing GbGA2ox2f, where A: taproot length phenotype of 8-day-old Arabidopsis thaliana seedlings; B: relative expression level of transgenic Arabidopsis thaliana; C: root length measurement of transgenic Arabidopsis thaliana; D: plant phenotype of transgenic Arabidopsis thaliana; E: plant height measurement of transgenic Arabidopsis thaliana; *, **, and *** represent significant differences at the P<0.05, 0.01, and 0.001 levels, respectively.

[0023] Figure 5The table shows the phenotypes of VIGS cotton, where A: phenotype 2 weeks after VIGS injection; B: relative expression levels of the GbGA2ox2f gene in different VIGS treatment groups; C: plant height measurement 2 weeks after VIGS injection; D: detection of active gibberellin content in different VIGS treatment groups; different lowercase letters indicate significant differences between different treatment groups (P<0.05); *, **, and *** indicate significant differences at the P<0.05, 0.01, and 0.001 levels, respectively.

[0024] Figure 6 To screen for potential upstream regulators of the GbGA2ox2f gene promoter using yeast one-hybrid assays, A: yeast self-activation detection of the GbGA2ox2f promoter; B: yeast one-hybrid assay to verify the interaction between transcription factor KNOX and the GbGA2ox2f promoter.

[0025] Figure 7 Gel migration assays were used to verify the binding site of KNOX to the GbGA2ox2f promoter, where A: His-KNOX protein purification verification; B: EMSA verification. Detailed Implementation

[0026] The present invention provides a gene GbGA2ox2f that regulates cotton plant height, wherein the gene GbGA2ox2f includes the nucleotide sequence shown in SEQ ID No. 1, or has a nucleotide sequence having more than 85% homology with the sequence shown in SEQ ID No. 1.

[0027] This invention screened for differentially expressed genes, GbGA2ox2f, significantly correlated with gibberellin content in compact and loose-type Island cotton materials by measuring endogenous gibberellin content and performing transcriptome analysis. Subcellular localization analysis of GbGA2ox2f in Arabidopsis protoplasts showed that GbGA2ox2f is located in the nucleus and cytoplasm. Heterologous overexpression of GbGA2ox2f in Arabidopsis significantly reduced root length and plant height; downregulation of GbGA2ox2f expression in Island cotton significantly increased plant height and active gibberellin content. Furthermore, yeast one-hybrid and gel migration assays confirmed that GbKNOX specifically binds to the GbGA2ox2f promoter site shown in SEQ ID No. 26, where SEQ ID No. 26: TATTTTTTAAAAA.

[0028] The nucleotide sequence of the gene GbGA2ox2f described in this invention is shown in SEQ ID No. 1 in one embodiment; its encoded amino acid sequence is shown in SEQ ID No. 4. In one embodiment of this invention, the 2000 bp sequence upstream of the GbGA2ox2f promoter is shown in SEQ ID No. 5.

[0029] This invention also provides primer pairs for amplifying the above-mentioned gene GbGA2ox2f.

[0030] In one embodiment of the present invention, primer pairs are designed based on the sequence shown in SEQ ID No. 1, and the designed primer pair sequences are shown in SEQ ID No. 2 and SEQ ID No. 3, specifically as follows:

[0031] Upstream primer (SEQ ID No. 2): ATGGTTGTGTTGTCACAGCCAC;

[0032] Downstream primer (SEQ ID No. 3): TCATAGGCTTGCATTAGCAGTTTTC.

[0033] The present invention also provides a recombinant vector containing the above-mentioned gene GbGA2ox2f.

[0034] In one specific embodiment of the present invention, the recombinant vector includes a recombinant vector that increases plant height and a recombinant vector that decreases plant height; wherein the recombinant vector that increases plant height includes a recombinant vector that inhibits the expression of the gene GbGA2ox2f; and the recombinant vector that decreases plant height includes a recombinant vector that overexpresses the gene GbGA2ox2f.

[0035] In one embodiment of the present invention, the expression of the gene GbGA2ox2f is suppressed by VIGS, and VIGS primers are designed based on the cDNA sequence of the GbGA2ox2f gene. After amplification, the primers are ligated to the Xba I and BamH I sites of the TRV2 vector to construct a recombinant vector that can increase the height of cotton plants.

[0036] In one embodiment of the present invention, the expression of the gene GbGA2ox2f is promoted by overexpression. Specifically, the gene GbGA2ox2f is inserted into the Sal I and BamH I sites of the plant overexpression vector WMV067 to construct a recombinant vector that can reduce the height of Arabidopsis thaliana. Then, the gene GbGA2ox2f is overexpressed by genetic transformation. The plant overexpression vector WMV067 has been disclosed in a previous article (Zhan, J., et al. The GhWL1-GhH1-GhGA2OX1 transcriptional module regulates cotton leafmorphology. Adv. Sci. 2025, 12, 2410783.).

[0037] This invention also provides the application of the above-mentioned gene GbGA2ox2f or the above-mentioned recombinant vector in regulating plant height and / or the content of active gibberellin.

[0038] In one specific embodiment of the present invention, the active gibberellin includes GA1 and / or GA4.

[0039] The present invention also provides a method for regulating plant height, comprising transforming plants using the above-mentioned recombinant vector to obtain recombinant plants with regulated plant height.

[0040] In one embodiment of the present invention, it was demonstrated that downregulating the expression level of the gene GbGA2ox2f in sea island cotton can increase plant height and gibberellin content, i.e., the purpose of increasing cotton plant height can be achieved by using gene expression inhibition. Meanwhile, in another embodiment, overexpression of the gene in Arabidopsis thaliana resulted in significantly shorter root length and significantly reduced plant height.

[0041] The present invention also provides a method for increasing cotton plant height and improving the content of active gibberellin, including silencing the expression of the above-mentioned gene GbGA2ox2f in the cotton genome.

[0042] The present invention does not specifically limit the method of silencing; conventional methods in the art, such as VIGS, can be used.

[0043] The present invention also provides a method for reducing plant height, comprising overexpressing the above-mentioned gene GbGA2ox2f in the genome of the target plant.

[0044] To further illustrate the present invention, the following detailed description, in conjunction with embodiments, of a gene, recombinant vector, and regulation method for regulating cotton plant height provided by the present invention, should not be construed as limiting the scope of protection of the present invention.

[0045] Example 1: Obtaining the sequence information of the GbGA2ox2f gene

[0046] The cDNA sequence of the GbGA2ox2f gene (Gbar_D06G015470) obtained from the Gossypium 3-79 genome sequence (https: / / www.cottongen.org / species / Gossypium_barbadense / HAU-AD2_genome_v2.0) is shown in SEQ ID No. 1, the amino acid sequence of its encoded protein is shown in SEQ ID No. 4, and the promoter sequence 2000 bp upstream is shown in SEQ ID No. 5.

[0047] Example 2: Expression of the plant height regulating gene GA2ox2f in sea island cotton with different plant types

[0048] To investigate the role of the GbGA2ox2f gene in the regulation of cotton plant architecture, this invention selected a compact ( Figure 1 (A, H1) and a loose type ( Figure 1 In the two plant types of Sea Island cotton varieties (A, H4), the expression abundance of the GbGA2ox2f gene differed significantly. Figure 1 (B). H1 and H4 are both described in the article (Zhao, N., et al. Genomic and GWAS analyses demonstrate phylogenomic relationships of Gossypium barbadense in China and selection for fibre length, lint percentage and Fusarium wiltresistance. Plant Biotechnol. J. 2022, 20(4): 691-710.), and a commitment has been made to release the material to the public within 20 years from the application date for use in reproducing the experiments of this invention.

[0049] The endogenous gibberellin content of H1 and H4 was detected, and the results showed that the endogenous GA content in compact island cotton H1 was high. 19 The GA8 content was significantly lower in the loose form than in the GA8 form. 53 and GA 15 The content is the opposite ( Figure 1 (C). Further correlation analysis was performed on the expression level of the GbGA2ox2f gene and the endogenous gibberellin content in different plant types of sea-island cotton, and it was found that GbGA2ox2f was significantly correlated with the endogenous gibberellin content in sea-island cotton. Figure 1The results (D) indicate that endogenous hormone levels and GA2ox2f gene expression may play a role in regulating cotton plant architecture.

[0050] Example 3: Subcellular localization analysis of the GbGA2ox2f gene

[0051] *Escherichia coli* DH5α (DL1001) and *Agrobacterium* GV3101 (AC1001) were purchased from Shanghai Weidi Biotechnology Co., Ltd.; the subcellular localization vector pAN580-GFP was purchased from Wuhan Boyuan Biotechnology. A brief visualization of the subcellular localization vector pAN580-35S::GbGA2ox2f-GFP is shown below. Figure 2 As shown in Figure A.

[0052] 3.1 Construction of vectors for subcellular localization of the GbGA2ox2f gene

[0053] The GbGA2ox2f target gene was constructed into the pAN580 vector using homologous recombination. Using sea island cotton cDNA as a template, primer sequences are shown in Table 1. PCR amplification was performed using TKS Gflex DNA Polymerase (TAKALA, R060A).

[0054] Table 1 Primer sequence list

[0055]

[0056] The amplification system was as follows: 5 μL cDNA, 25 μL 2×Gflex PCR buffer, 2 μL GA2ox2f-GFP-F, 2 μL GA2ox2f-GFP-R, 1 μL TKS Gflex DNA Polymerase, and Nuclease-free ddH2O to a final volume of 50 μL. PCR reaction conditions: 94℃ for 1 min; 98℃ for 10 s, 60℃ for 15 s, 68℃ for 1 min, 30 cycles; incubation at 10℃.

[0057] After the PCR reaction, agarose gel electrophoresis was performed to observe the target bands. PCR products with the correct fragment size after electrophoresis were purified using the Novizan gel extraction kit (DC301). Refer to the instruction manual for specific procedures.

[0058] The pAN580-GFP vector was digested with Xba I and BamHI, and then purified using a gel extraction kit, following the same method as above.

[0059] The purified PCR product and the enzyme digestion vector plasmid were ligated using the Novizan ClonExpress II One Step Cloning Kit (C112), and the ligation product was then transformed into E. coli DH5α. For specific operating procedures, please refer to the instruction manual.

[0060] The transformed single colonies were subjected to bacterial PCR detection. 1 mL of liquid LB medium containing kanamycin was added to a sterile 1.5 mL centrifuge tube. Plump single colonies were selected and placed into the centrifuge tube, and cultured at 37℃ with a shaker at 200 rpm until the bacterial culture became turbid. PCR was then performed to detect the size of the target fragment. Novizan Master Mix (P213) was used for PCR detection. The PCR system was as follows: 1 μL bacterial culture, 10 μL 2×Taq Plus MasterMix II, 1 μL GA2ox2f-GFP-F, 1 μL GA2ox2f-GFP-R, and 7 μL Nuclease-free ddH2O. PCR reaction conditions: 94℃ for 5 min; 94℃ for 25 s, 60℃ for 25 s, 72℃ for 1 min, 30 cycles; incubation at 10℃. The size of the target fragment (981 bp) was detected by electrophoresis, and EcoRI was used for restriction enzyme digestion. Bacterial cultures with the correct fragment size were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. Figure 2 (B and C). Transform the plasmid with the correct sequencing results into Agrobacterium competent cells GV3101. Refer to the instruction manual for specific transformation procedures.

[0061] 3.2 Subcellular localization of Arabidopsis protoplasts

[0062] The subcellular localization experiment of Arabidopsis protoplasts was performed according to the method described in the literature (Yoo, S., et al. Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat. Protoc. 2007, 2, 1565-1572.).

[0063] Subcellular localization results as follows Figure 3 As shown, GbGA2ox2f is located in the cytoplasm and nucleus.

[0064] Example 4: Verification of the function of the GbGA2ox2f gene using heterologous overexpression of Arabidopsis thaliana

[0065] Overexpression primers (SEQ ID NO. 9, SEQ ID NO. 10) were designed based on the full-length cDNA sequence of the GbGA2ox2f gene. The primer sequences are shown in Table 1. PCR amplification was performed using the plasmid with correct sequencing from Example 3 as a template, following the same construction steps as in Example 3. The recombinant plasmid with correct sequencing was transformed into Agrobacterium competent cells GV3101 for subsequent experiments.

[0066] 4.1 Arabidopsis transformation:

[0067] (1) Preparation of conversion solution: 2.215g MS salt, 50g sucrose, 200μL Silwet-77, and distilled water to a final volume of 1L.

[0068] (2) Planting of dyed plant materials

[0069] Columbia wild-type Arabidopsis thaliana (Col-0) was sown on MS medium. After 2 weeks of growth, the seedlings were transplanted into a soil matrix containing potting soil:vermiculite:perlite (3:1:1) and grown at 22°C under a 16-hour light / 8-hour dark cycle with a light intensity of approximately 80 μmol / m². -2 s -1 They are cultivated in a greenhouse until bolting, and the top is pinched off a week later to encourage the growth of more branches. When they bloom, they are used for transformation experiments.

[0070] 4.2 Agrobacterium infection experiment

[0071] (1) The plasmid (35S::GbGA2ox2f) containing the target gene, which was correctly identified, was transformed into GV3101 Agrobacterium competent cells by electroporation. Correctly identified Agrobacterium single clones were picked and inoculated into 50 mL of liquid culture medium containing the corresponding antibiotic. The culture was carried out at 220 rpm at 28°C until saturation. The culture was then transferred to 250 mL of YEB liquid culture medium containing the corresponding antibiotic at a 1:100 ratio and shaken until OD500 was reached. 600 =1.2~1.8. Centrifuge at 8500 rpm for 15 min, collect the bacterial cells, resuspend in transformation buffer, and adjust to OD value. 600 =0.8; Before dyeing, add Silwet-77 and mix well.

[0072] (2) Cut off the siliques and open flowers of wild-type Arabidopsis thaliana, leaving the unopened tender flower buds; place the plant upside down in the conversion solution, rotating the solution continuously during the process. After soaking for 3 minutes, gently wipe the remaining conversion solution on the outside of the inflorescence with absorbent paper; place the plant in a small pot on its side and in the dark for 16-24 hours before culturing under normal conditions. Repeat the soaking once a week later.

[0073] 4.3 Identification of transgenic Arabidopsis thaliana

[0074] 4.3.1 Disinfection of Arabidopsis thaliana seeds

[0075] Place the Arabidopsis thaliana seeds to be disinfected into a 1.5 mL EP tube, add 900 μL of 75% ethanol and 100 μL of hypochlorous acid (10%), invert and mix well to ensure the seeds are in full contact with the disinfectant solution. After 5 minutes, completely remove the liquid from the EP tube, add 1 mL of anhydrous ethanol, invert and mix well, then discard the liquid. Repeat 5 times, air dry overnight in a clean bench, and seal for later use.

[0076] 4.3.2 Screening of positively transformed plants

[0077] (1) Screening of T0 generation transgenic lines: Prepare a solution containing the corresponding antibiotic (50mg L) -1 Kanamycin) was used to select T0 generation seeds on MS selection medium. The seeds were sterilized and sown on selection plates, treated at 4°C in the dark for 3 days, and then transferred to an incubator (22°C, 16h light / 8h dark, light intensity 80–120 μmol / m²). -2 s -1 After culturing in the medium for 7–10 days, select normally germinating transformed plants and transplant them into nutrient soil for growth. Harvest T1 generation seeds from a single plant.

[0078] (2) Screening of T1 generation single-copy insert lines: T1 generation seeds were sown on screening medium. After one week of growth, the germination segregation ratio was counted. The number of seeds that grew normally and those that did not on the screening medium was calculated by chi-square (χ²). 2 After testing, the lines that meet the 3:1 ratio are the single-copy insertion lines. A certain number of T1 generation single-copy insertion lines are selected for propagation, and T2 generation seeds are harvested from each plant.

[0079] (3) Screening of homozygous T2 generation lines: Take an appropriate amount of T2 generation seeds and sow them on the screening medium. Observe their growth status after one week. The T2 generation seedlings with 100% resistance are homozygous transformed plants, which can be used for subsequent experiments. At the same time, harvest the seeds of T3 generation homozygous lines.

[0080] 4.4 Detection of expression levels in transgenic Arabidopsis thaliana

[0081] For specific RNA extraction methods, refer to the instruction manual of the Novizan FastPure UniversalPlant Total RNAIsolation Kit (RC411). The obtained RNA was stored at -20℃ for later use or directly used for reverse transcription. RNA concentration was measured using a Nanodrop 2000 instrument. For specific procedures on reverse transcription of RNA, refer to the instruction manual of the Novizan HiScript IIQ RT SuperMix for qPCR (R223). The obtained cDNA was used for gene cloning, real-time quantitative PCR, or stored at -20℃ for later use. The qRT-PCR primers for GbGA2ox2f are shown in Table 1, and AtACTIN was selected as the internal control gene. qRT-PCR experiments were performed using the Novizan ChamQ Blue Universal SYBR qPCR MasterMix (Q312), and the experiments were conducted in the dark.

[0082] The specific procedure is as follows: Add 1 μL cDNA, 10 μL 2×Universal SYBRqPCR MasterMix, 0.4 μL Primer 1 (10 μM upstream primer), 0.4 μL Primer 2 (10 μM downstream primer), and 8.2 μL Nuclease-free ddH2O to each well of a 96-well quantitative PCR plate. Primer sequences are shown in Table 1. Set the reaction on the real-time quantitative PCR instrument as follows: 95℃ 30s, 95℃ 10s, 60℃ 30s, 95℃ 15s, 60℃ 60s, 95℃ 15s, 40℃ 30s. Quantification at 95℃ 10s and 60℃ 30s was run for 40 cycles, and melting curve analysis at 95℃ 15s, 60℃ 60s, and 95℃ 15s was run for one cycle. (Based on 2...) -△CT Calculate the expression level of the GbGA2ox2f gene in transgenic Arabidopsis thaliana.

[0083] 4.5 Phenotypic observation of transgenic Arabidopsis thaliana

[0084] Wild-type col-0 and T3 generation GbGA2ox2f overexpression transgenic Arabidopsis seeds were sterilized, hydrated at low temperature for 2 days, and then sown in 1 / 2 MS solid culture dishes. Root growth was observed by vertical placement, and root length was measured using ImageJ after 8 days. Two weeks later, the wild-type and overexpression materials were transplanted into a substrate of nutrient soil:vermiculite:perlite (3:1:1) and placed in a plant growth chamber for growth. Arabidopsis growth was observed, and the height of the main stem was measured with a steel ruler at the flowering stage.

[0085] The results are as follows Figure 4 As shown, transgenic Arabidopsis thaliana that heterologously overexpresses GbGA2ox2f has a shorter taproot and shorter plant height compared to the wild type.

[0086] Example 5 uses virus-induced gene silencing (VIGS) experiments to verify the function of the GbGA2ox2f gene.

[0087] VIGS primers (SEQ ID NO.11, SEQ ID NO.12) were designed based on the cDNA sequence of the GbGA2ox2f gene. The primer sequences are shown in Table 1. PCR amplification was performed using the plasmid with correct sequencing from Example 3 as a template. The amplified fragment was 364 bp, and the restriction enzyme sites were Xba I and BamHI. The vector construction steps were the same as in Example 3. The recombinant plasmid with correct sequencing was transformed into Agrobacterium competent cells GV3101 for subsequent experiments.

[0088] 5.1 VIGS Experiment

[0089] TRV1 empty vector, TRV2 empty vector, TRV2-GhCLA1 (positive control), and TRV2-GbGA2ox2f Agrobacterium, stored at -80℃, were pre-spread on LB medium containing kanamycin, rifampin, and gentamicin and thawed at 28℃ for 2 days. TRV2-GhCLA1 has been previously published (Wang Xinyu, Lü Kun, Cai Caiping, Xu Jun, Guo Wangzhen. Establishment and application of TRV virus-mediated gene silencing system in cotton. Acta Agronomica Sinica. 2014, 40(8):1356-1363.).

[0090] Single colonies were picked and incubated overnight at 28°C with LB liquid medium containing kanamycin and rifampicin. Then, the activated bacterial culture was transferred at a ratio of 1% to 25 mL of LB liquid medium containing kanamycin and rifampicin, and incubated overnight at 28°C and 200 rpm until OD500 was reached. 600 1.2; After collecting the bacterial culture, centrifuge at 4000 rpm for 10 min, discard the supernatant, add an equal volume of resuspension to the centrifuge tube, mix well, and then adjust the OD with the resuspension. 600 1.2. After standing in the dark at room temperature for 2 hours, inject the cotyledons of flattened sea island cotton. Before injection, mix TRV1 with equal volumes of TRV2-GhCLA1, empty TRV2 vector, and TRV2-GbGA2ox2f Agrobacterium. During injection, use the syringe needle to scratch the lower epidermis of the cotyledons, but do not puncture the cotyledons. Draw the mixed resuspension into the cotyledons until the total cotyledon area is more than 90%. After injection, incubate overnight in the dark at 25°C, and then culture normally at 25°C.

[0091] 5.2 Detection of VIGS expression levels in cotton

[0092] The steps for extracting total RNA from cotton, reverse transcription to synthesize cDNA, and real-time quantitative PCR were the same as in Example 4.4, except that the internal reference gene was GbQ7, and the qRT-PCR primers are shown in Table 1. The expression level of VIGS-treated plants was detected, with the wild type as the control, according to a 2... -△△CT The expression levels of TRV::00(TRV1+TRV2), TRV::CLA1(TRV1+TRV2-GhCLA1), and TRV::GbGA2ox2f(TRV1+TRV2-GbGA2ox2f) were calculated respectively.

[0093] 5.3 VIGS Cotton Plant Height Measurement

[0094] The height from the cotyledon to the terminal bud was measured using a ruler, with a total of 15 biological replicates.

[0095] 5.4 Determination of Gibberellin Content in VIGS Cotton

[0096] The content of active gibberellins was determined using stem tissue samples taken 2 weeks after VIGS injection. After sampling, the samples were flash-frozen in liquid nitrogen and then transported to Nanjing Ruiyuan Biotechnology Co., Ltd. using dry ice. The company then performed gibberellin content determination using the GA1 (Gibberellin 1) ELISA kit (MM-1189O1), the GA4 (Gibberellin 4) ELISA kit (MM-1532O1), and the BCA protein quantification kit (MM-9227A).

[0097] The results are as follows Figure 5 As shown, after significantly downregulating the expression level of GbGA2ox2f through virus-mediated gene silencing (VIGS), the cotton plant height increased significantly, and the content of endogenous gibberellins GA1 and GA4 was significantly increased compared with the control.

[0098] Example 6: Screening of regulatory proteins of the GbGA2ox2f gene

[0099] 6.1 Yeast one-hybrid screening for regulatory proteins of the GbGA2ox2f gene

[0100] Yeast one-hybrid screening was used to screen upstream regulatory proteins of the GbGA2ox2f gene in sea-island cotton. Using sea-island cotton DNA as a template, the GbGA2ox2f gene promoter sequence was constructed into the pHIS2 vector. Primer sequences are shown in Table 1 (SEQ ID NO.19, SEQ ID NO.20). The vector construction steps were the same as in Example 3. A sea-island cotton cDNA library was screened using pHIS2-PRO-GA2ox2f as bait.

[0101] 6.1.1 Background detection of bait plasmids

[0102] The recombinant plasmids were transformed into Y187 competent cells (Coolaber, Beijing, CC306), following the instructions for use. Specifically, combination 1 involved transforming pHIS2-PRO-GA2ox2f into SD-T plates for screening; combination 2 involved transforming pHIS2-PRO-GA2ox2f+pGADT7 into SD-TL double-deficient plates for background screening; and combination 3 involved transforming pHIS2-p53+pGAD53m (positive control) into SD-TL double-deficient plates. The positive plasmid was purchased from Ruiyuan Bio's yeast nucleus system one-hybrid kit (Nanjing, RY8009). Three single colonies were randomly picked from each transformation plate, diluted, and plated onto SD-TLH-deficient plates containing different concentrations (0, 30, 50, 75, 100 mM) of 3AT, and incubated at 30°C for 3 days. Results... Figure 6 As shown in section A, the transformant pHIS2-PRO-GA2ox2f+pGADT7 did not grow on the plate with 100mM 3AT added, so 100mM 3AT was selected for subsequent library screening concentration.

[0103] 6.1.2 Document Screening and Back-to-Back Validation

[0104] Y187 yeast transformants containing the correct pHIS2-PRO-GA2ox2f bait plasmid were used as recipient cells to prepare competent cells (Gietz, R., Schiestl, R. Frozen competent yeast cells that can be transformed with high efficiency using the LiAc / SS carrier DNA / PEG method. Nat. Protoc. 2007, 2, 1-4.). The *Cotton Island* cDNA library plasmid was then transformed into these cells using the same method as in 6.1.1, and plated on SD-TLH + 100mM 3AT plates. Single clones were picked from the plates and identified by PCR, sequencing, and BLAST alignment using the Yeast Colony Rapid Detection Kit (Yeast Colony Rapid Detection Kit, catalog number: RY8001) from Nanjing Ruiyuan Biotechnology Co., Ltd. A total of 83 different gene sequences were obtained. Based on literature review, the transcription factor KNOX (Gbar_D05G001230) was selected for subsequent yeast one-hybrid verification. The results are as follows. Figure 6As shown in Figure B, pHIS2-PRO-GA2ox2f+pGADT7 could not grow on SD-TLH+100mM 3AT-deficient medium, while the positive control pHIS2-P53+pGAD53m and the experimental group pHIS2-PRO-GA2ox2f+pGADT7-KNOX could grow normally on SD-TL, SD-TLH, and SD-TLH+100mM 3AT-deficient plates. These results indicate that GbKNOX in Sea Island cotton can bind to the GbGA2ox2f promoter.

[0105] 6.2 Gel migration assay (EMSA) to verify the interaction

[0106] To further clarify the binding sites between the GbKNOX and GbGA2ox2f promoters, verification was performed using EMSA.

[0107] 6.2.1 Expression and purification of GbKNOX protein

[0108] The recombinant plasmid pET28-GbKNOX was constructed in the same manner as in Example 3. The primer sequences are shown in Table 1 (SEQ ID NO.24, SEQ ID NO.25). The plasmid was transformed into the expression strain Rosetta, and colony PCR was performed. Colonies with the correct detection band size were expanded and cultured until OD2800. 600 At a concentration of around 0.6, 1 mL of bacterial culture was collected for later use (marked as before induction). IPTG (0.5 mM) was added to the remaining bacterial culture to induce expression. The target protein His-KNOX was expressed in the supernatant induced at 16℃.

[0109] The activated bacterial culture was further inoculated into 400 mL of LB medium and cultured until OD500 reached. 600 At approximately 0.6, add 0.5 mM IPTG and induce expression at 16℃ for 16 h. Collect bacterial cells by centrifugation. Resuspend the cells in Lysis buffer (1 g of bacterial cells in 10 mL of Lysis buffer), then sonicate to disrupt the cells. Collect the cell lysate and filter. Incubate the filtered cell lysate with the corresponding beans at 4℃ for 3 h. Collect the beans (the supernatant can be saved at this stage). Add wash buffer to the beans to wash away impurities until the Bradford assay shows no color change. Finally, elute with Elution buffer (imidazole), collect the eluent, and add 30 μL to 10 μL of SDS Sample Buffer (4×). Mix well, incubate at 100℃ for 10 min, centrifuge, load, and analyze by SDS-PAGE. Figure 7 As shown in Figure A, Western blotting results indicate that a large amount of His-KNOX protein was obtained after purification, and its size was as expected.

[0110] 6.2.2 Gel migration experiment

[0111] The kit required for the EMSA experiment is the Light Shift Chemiluminescent EMSA Kit (Cat20148: Pierce, Rockford, United States). The probes used in the process are listed in Table 1 (SEQ ID No. 21, SEQ ID No. 22, SEQ ID No. 23). For detailed steps, please refer to the instruction manual.

[0112] The results are as follows Figure 7 As shown in lane B, the biotin-labeled probe (lane 1) and His-KNOX can bind to each other to form a clear blocking band (lane 2). Furthermore, with the addition of a competing cold probe, the binding of His-KNOX to the biotin-labeled probe is significantly inhibited (lanes 3, 4, 5), while the added mutant probe cannot form a blocking band with His-KNOX (lane 6). These results indicate that GbKNOX can specifically bind to the site shown in SEQ ID No. 26 (TATTTTTAAAAA) on the GbGA2ox2f promoter.

[0113] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A gene GbGA2ox2f that regulates cotton plant height, characterized in that, The gene GbGA2ox2f includes the nucleotide sequence shown in SEQ ID No. 1, or a nucleotide sequence having more than 85% homology with the sequence shown in SEQ ID No.

1.

2. Amplify the primer pair for the gene GbGA2ox2f described in claim 1.

3. The primer pair according to claim 2, characterized in that, The nucleotide sequence includes the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No.

3.

4. A recombinant vector comprising the gene GbGA2ox2f as described in claim 1.

5. The recombinant vector according to claim 4, characterized in that, The recombinant vectors include recombinant vectors that reduce plant height and recombinant vectors that increase plant height; The recombinant vector that reduces plant height includes a recombinant vector that overexpresses the gene GbGA2ox2f; The recombinant vector that increases plant height includes a recombinant vector that inhibits the expression of the gene GbGA2ox2f.

6. The use of the gene GbGA2ox2f as described in claim 1 or the recombinant vector as described in claim 4 or 5 in regulating plant height and / or the content of active gibberellin.

7. The application according to claim 6, characterized in that, The active gibberellin includes GA1 and / or GA4.

8. A method for regulating plant height and active gibberellin content, characterized in that, This includes transforming target plants using the recombinant vector described in claim 4 or 5.

9. A method for increasing cotton plant height and improving the content of active gibberellin, characterized in that, This includes silencing the expression of the gene GbGA2ox2f as described in claim 1 in the cotton genome.

10. A method for reducing plant height, characterized in that, This includes overexpressing the gene GbGA2ox2f of claim 1 in the genome of the target plant.

Images