Arthrobacter carbodii gene knockout vector and method

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to an arthrobacter carbodii gene knockout vector and method. The vector comprises a target gene upstream and downstream homologous arm amplification sequence and a target gene double PAM integration fragment; wherein the target gene is a gene segment to be knocked out; the lengths of upstream and downstream arms of the target gene are respectively 1000bp, and the lengths of amplified homologous arm genes are respectively 2000bp; a basic group at the tail of the sequence of the double PAM integrated fragment is adenine or guanine, and the GC content is 40-60%. According to the knockout vector and the corresponding knockout method, the stable knockout of the gene in the Arthrobacter carbodii can be realized, the knockout efficiency is high, and the knockout vector and the corresponding knockout method have important significance for researching the gene function of the Arthrobacter carbodii and also have a certain reference value for other strains of the Arthrobacter.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of genetic engineering, and in particular relates to a gene knockout vector and method of Arthrobacter kaistensis. BACKGROUND

[0002] Up to now, various gene manipulation methods have been researched and developed, such as zinc finger technology (ZFN) and transcription activator-like effector nuclease technology (TALEN) and the current gene editing technology (CRISPR-Cas), because the CRISPR-Cas gene manipulation system is simple in design, can quickly realize gene manipulation, low in cost and strong in scalability, researchers believe that this method is of important revolutionary significance and can be used for targeting almost all types of cell genomes. CRISPR (Clustered Regularly Interspace Repeats), also known as clustered regularly interspaced short palindromic repeats, CRISPR-associated proteins have high-efficiency genome manipulation functions (Cas proteins), and the key to the application of this gene editing system is that it can perform gene knockout, knock-in and modification on different types of cell genomes.

[0003] According to the effector module of the prokaryotic system, it can be divided into class I and class II CRISPR-Cas systems. The class I CRISPR-Cas system needs to use an effector complex composed of multiple effector proteins to function, while the class II CRISPR-Cas system can only use a single effector protein to complete the nucleic acid cutting function, which is also the main basis for distinguishing different types of systems. The II-alpha type homolog of class II Streptococcus pyogenes (SpCas9) has become the most widely used CRISPR / Cas9 system due to its simple structure and high efficiency, and Cas9 is the only endonuclease that can target and cut under the guidance of gRNA to cause double-strand breaks of the target gene. This method selects a class II gene editing system, and Cas9 is a codon-optimized protein-Streptococcus pyogenes (SpCas9). CRISPR-Cas9 is a kind of adaptive immune defense system formed by bacteria and archaea in the long-term evolution process, which can be used to resist foreign viruses and DNA, etc. This method is a technology for specific DNA modification of targeted genes, and is also a widely used cutting-edge method for gene editing. The CRISPR-Cas9-based gene editing technology has been applied in various gene therapy fields, such as tumors, blood diseases, and various genetic diseases, and this technology has been applied to the precise modification or deletion of the genomes of human cells, zebrafish, mice and bacteria.

[0004] The existing method can only achieve the silencing of the genes of A. agilis and A. bussei, but no method for knocking out target genes of bacteria in the Arthrobacter genus has been developed. The existing method is complicated and requires multiple rounds of PCR amplification, enzyme digestion, and ligation to assemble the plasmid, which requires higher costs, manpower, and time. After the plasmid construction is completed, it is transferred into the target strain by electroporation method, and the actual operation process requires more stringent requirements for voltage and transformation time. Higher voltage and longer electric shock time are more likely to cause the death of the target strains A. agilis and A. bussei. The detection of gene silencing efficiency requires multiple experimental steps such as expansion culture, induction of protein expression, and centrifugation after obtaining the strain. The protein in the collected cells is lysed and extracted, and then the concentration is detected or evaluated by SDS-PAGE electrophoresis experiment, which still requires higher costs and manpower. SUMMARY

[0005] The purpose of the present application is to provide a Arthrobacter gene knockout vector and method, which can achieve efficient and stable knockout of genes in the genome of Arthrobacter A. cumminsii.

[0006] To this end, the present application provides the following technical solutions.

[0007] The first aspect of the present application provides an Arthrobacter gene knockout vector, which comprises a target gene upstream and downstream homologous arm amplification sequence and a target gene double PAM integration fragment; wherein,

[0008] The target gene is a gene fragment to be knocked out;

[0009] The length of each of the target gene upstream and downstream arms is 1000 bp, and the length of each of the amplified homologous arm genes is 2000 bp;

[0010] The sequence of the double PAM integration fragment ends with one base of adenine or guanine, and the GC content is 40%-60%.

[0011] The second aspect of the present application provides the use of the Arthrobacter gene knockout vector as described above in the implementation of scarless knockout of target genes of Arthrobacter.

[0012] The third aspect of the present application provides an Arthrobacter gene knockout method, which comprises the following steps:

[0013] S1: transforming the gene knockout vector as described above into E. coli to obtain E. coli carrying the gene knockout vector;

[0014] S2: inoculate the obtained E. coli carrying the gene knockout vector, E. coli HB101 PRK-2013 and the Arthrobacter protidans strain into LB agar medium added with corresponding antibiotics for culture, and then transfer to resistant LB liquid medium for culture to the exponential growth phase, centrifugal collection, to obtain E. coli carrying the gene knockout vector, E. coli HB101 PRK-2013 and the Arthrobacter protidans strain, respectively;

[0015] S3: mix the obtained E. coli carrying the gene knockout vector, E. coli HB101 PRK-2013 and the Arthrobacter protidans strain and perform plasmid transformation, and then obtain the Arthrobacter protidans strain with the knockout plasmid by screening.

[0016] S4: perform plasmid removal treatment on the obtained Arthrobacter protidans strain with the knockout plasmid to obtain the gene-deficient strain with the knockout target gene.

[0017] As preferred, step S1 further comprises:

[0018] S11: amplify the upstream and downstream homologous arms of the target gene to be knocked out to obtain the upstream and downstream homologous arm amplification sequences of the target gene; the nucleotide sequence of the amplification primer is shown in SEQ ID NO: 3-10;

[0019] S12: design a double-PAM integration fragment of the target gene to be knocked out, and connect the obtained double-PAM integration fragment to plasmid P0 to construct the knockout plasmid P1.

[0020] S13: connect the upstream and downstream homologous arm amplification sequences of the target gene to the knockout plasmid P1 to obtain the gene knockout vector.

[0021] As preferred, in step S2, the LB agar medium culture condition is 37°C overnight culture; and the resistant LB liquid medium culture condition is 37°C culture for 3-4 hours.

[0022] As preferred, in step S3, the E. coli carrying the gene knockout vector, E. coli HB101 PRK-2013 and the Arthrobacter protidans strain are mixed in a ratio of 2:2:1.

[0023] As preferred, in step S3, the plasmid transformation condition is: the transformation medium is a non-resistant LB agar plate, the temperature is 37°C, and the time is 16 hours.

[0024] As preferred, in step S3, the screening condition is: the screening medium is an ampicillin and apramycin double-resistant LB agar plate added with isopropyl-β-D-thiogalactopyranoside, the temperature is 28°C, and the time is 48h.

[0025] As preferred, in step S4, the plasmid removal condition is that the plasmid removal medium is LB agar medium without antibiotics, the temperature is 39 DEG C, and the time is 2-3 days.

[0026] As preferred, in step S4, a step of detecting the gene-deficient strain is further included, and the detection is a double-primer PCR amplification method, and the nucleotide sequences of the primers are shown in SEQ ID NO: 15-20.

[0027] By means of the above technical solution, the present application has at least the following advantages:

[0028] The present application first establishes a gene knockout vector and method which can be used for Arthrobacter cumminsii, and optimizes the existing gene knockout tool, targets the same gene by using double PAM to target the target gene, and integrates Cas9 protein to cut the double-stranded DNA of the target gene to cause double-stranded breakage, and couples the principle of homologous recombination repair to precisely repair the target gene, so that a gene knockout vector is constructed, and the gene stability knockout can be successfully performed in Arthrobacter cumminsii, the knockout efficiency is high, the gene function of Arthrobacter cumminsii is of great significance for research, and the method also has certain reference value for other Arthrobacter strains.

[0029] The above description is only a summary of the technical solutions of the present application, in order to more clearly understand the technical means of the present application, and the contents of the specification can be implemented, the following preferred embodiments of the present application are described in detail. BRIEF DESCRIPTION OF DRAWINGS

[0030] Figure 1 It is a gene knockout process schematic diagram of the Arthrobacter cumminsii of the present application;

[0031] Figure 2 It is a plasmid pCRISPomyces-2 map of the present application;

[0032] Figure 3 It is a plasmid P1 map of the present application;

[0033] Figure 4 It is a plasmid P2 map of the present application;

[0034] Figure 5 It is a schematic diagram of double-primer design for PCR detection of gene-deficient strain Arthrobacter cumminsii;

[0035] Figure 6 It is a plasmid removal detection result diagram of the target strain;

[0036] Figure 7Figure 1 is a diagram of PCR detection results of positive mutant strains of Arthrobacter cumminsii, wherein a is the first round of mutation detection results after completion of conjugation transfer; and b is the second round of gene mutation detection after completion of plasmid removal. DETAILED DESCRIPTION

[0037] In order to make the technical means, creative features, purposes and effects of the present application easy to understand, the technical solutions in the embodiments of the present application will be described clearly and completely below in combination with the embodiments of the present application. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.

[0038] There is no method available for gene knockout of Arthrobacter cumminsii in the prior art. Similar research only uses a CRISPR-dCas system to silence genes of Arthrobacter spp. A method is established based on a pCasiART plasmid, and the operability of the method is verified by selecting A. agilis and A. bussei. The detailed steps include: 1. dCas9 nucleic acid sequence is amplified by designing primers with pCasiSA as a template, and agarose gel electrophoresis is used for detection. The band with the target fragment is cut, recovered, and the DNA fragment is purified. Then, the fragment is sequenced and verified by enzyme digestion and ligation to the SalI / AvrII site of pART2; 2. The hdnO promoter and sgRNA fusion fragment are synthesized, and the double enzyme digestion method is used to connect them to the plasmid Bsu36I / AvrII site constructed in step 1; 3. The LacZα, Lac operator and promoter three-gene fusion fragment is amplified by designing primers with pUC19 as a template, and agarose gel electrophoresis is used for detection. The band with the target fragment is cut, recovered, and the DNA fragment is purified. Then, the fragment is connected to the plasmid constructed in step 2 by enzyme digestion and ligation; 4. The usability of the method is verified by taking the target gene crtB as an example. PAM (Protospacer Adjacent Motif) is selected and designed according to the gene sequence, and it is connected to the plasmid constructed in step 3 by Golden Gate assembly. The plasmid after 4 rounds of assembly can be used for gene silencing of the target strain (pCasiART-spacer); 5. The knockout plasmid constructed in step 4 is introduced into strains A. agilis and A. bussei by electroporation method, and the silencing efficiency is evaluated by detecting the concentration of the corresponding protein expressed by the bacteria.

[0039] To this end, the present application is directed to the gene knockout of Arthrobacter cumminsii from cervical tissue of cervical cancer patients, and the method is established for the convenience of further study on the gene function of the strain. In the present application, the integrated pCRISPomyces-2 plasmid targeting the target gene is used for gene knockout by using single-gene double-target site homologous recombination repair. The plasmid can be assembled by multiple fragments using conventional molecular biology methods such as enzyme digestion, ligation and transformation, and the single-stranded DNA mutation efficiency can reach 90%-97%. The gene-deficient strain can be obtained by using PCR to detect 50-100 conjugants.

[0040] In one specific embodiment of the present application, a gene knockout vector of Arthrobacter is provided, which comprises an amplified sequence of the upstream and downstream homologous arms of the target gene and a double PAM integration fragment of the target gene; wherein the target gene is a gene fragment to be knocked out; the length of each of the upstream and downstream arms of the target gene is 1000 bp, and the length of each of the amplified homologous arm genes is 2000 bp; the last base of the sequence of the double PAM integration fragment is adenine or guanine, and the GC content is 40%-60%, for example.

[0041] The Arthrobacter gene knockout vector obtained according to the present application can be used for efficient and stable knockout of Arthrobacter genes.

[0042] In one specific embodiment of the present application, a gene knockout method of Arthrobacter cumminsii is provided, which comprises the following steps:

[0043] The first step is the amplification of the homologous arm gene, which specifically comprises: performing conventional PCR amplification on the upstream and downstream arms of the target gene to be knocked out, and then using fusion PCR to amplify the homologous arms to obtain the amplified homologous arm genes; optionally, the length of each of the upstream and downstream arms is 1000 bp, the primer sequence for amplifying the upstream and downstream homologous arms is shown in SEQ ID NO: 3-10, and the length of each of the homologous arm genes after amplification is 2000 bp.

[0044] The second step is the construction of the knockout plasmid, which specifically comprises: designing a double PAM integration fragment of the target gene to be knocked out, connecting the obtained double PAM integration fragment (Spacer) to the plasmid vector pCRISPomyces-2 to obtain the knockout plasmid P1.

[0045] As used herein, PAM (Protospacer Adjacent Motif): refers to several nucleotide sequences adjacent to the target sequence, i.e. the first 20 nt of NGG in the target gene, which are the key sequences for sgRNA to recognize and bind to the target. Mechanism of PAM sequence: CRISPR-Cas9 system guides Cas9 protein to specific DNA sequence for cleavage by guide RNA. This cleavage process depends on the presence of PAM sequence, because sgRNA recognizes the PAM sequence of the target gene, and then Cas9 protein starts to play the activity of cleaving nucleotide chain. Streptococcus pyogenes Cas9 usually requires two G nucleotides (NGG) as part of its PAM sequence. In this embodiment, the PAM sequence is selected to have a terminal base of adenine (A) or guanine (G), and the GC content is 40%-60% (for example, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%). To avoid off-target effects, each PAM should correspond to a specific gene in the strain genome (blast alignment analysis), and must specifically target the target gene.

[0046] The third step is to construct E. coli DH5a carrying the complete gene knockout vector P2, which specifically includes: connecting the homologous arm gene obtained in the first step to plasmid P1 to construct the complete gene knockout vector P2. Transform the obtained complete gene knockout vector P2 into E. coli DH5a to obtain the E. coli DH5a strain carrying the complete gene knockout vector P2.

[0047] The fourth step is to transform the knockout plasmid into the target strain A. cumminsii, specifically including: inoculating the obtained E. coli DH5a carrying the complete gene knockout vector P2, E. coli HB101 PRK-2013 and the target strain A. cumminsii into LB agar medium added with corresponding antibiotics for culture, and then transferring into resistant LB liquid medium for culture to the exponential growth phase, centrifuging to collect, and obtaining E. coli DH5a bacterial body carrying the complete gene knockout vector P2, E. coli HB101 PRK-2013 bacterial body and the target strain A. cumminsii bacterial body, respectively; mixing the obtained E. coli DH5a bacterial body carrying the complete gene knockout vector P2, E. coli HB101 PRK-2013 bacterial body and the target strain A. cumminsii bacterial body and performing plasmid transformation, and then obtaining the A. cumminsii into which the knockout plasmid is transformed through screening. Alternatively, the LB agar medium culture condition is: 37°C overnight culture; the resistant LB liquid medium culture condition is: 37°C culture for 3-4 hours; and the E. coli DH5a bacterial body carrying the complete gene knockout vector P2, E. coli HB101 PRK-2013 bacterial body and the target strain A. cumminsii bacterial body are mixed in a ratio of 2:2:1. The plasmid transformation condition is: the transformation culture medium is a non-resistant LB agar plate, the temperature is 37°C, and the time is 16 hours. The culture medium used for screening is an ampicillin and apramycin double-resistant LB agar plate added with isopropyl-β-D-thiogalactopyranoside, the temperature is 28°C, and the time is 48h.

[0048] The last step is the step of detecting the A. cumminsii deplasmid and gene-deficient strain, specifically including: performing deplasmidization treatment on the obtained A. cumminsii into which the knockout plasmid is transformed to obtain a gene-deficient strain in which the target gene is knocked out. The deplasmidization culture medium is non-resistant LB agar medium, the temperature is 39°C, and the time is 2-3 days. The primers used for detecting the gene-deficient strain are shown in SEQ ID NO: 15-20.

[0049] The method of the application can realize the stable knockout of the gene in the genome of Arthrobacter cumminsii, and the steps are simple. Wherein only one round of PCR amplification of 1000bp gene fragments upstream and downstream of the target gene and one round of overlap extension PCR can obtain the homologous arm of the target gene; the gene synthesis containing two PAM and the fusion sgRNA, T7term and other elements are connected to pCRISPomyces-2; the plasmid transformation adopts the three-parent conjugation transfer method, only the experimental strain, the auxiliary strain and the plasmid maintenance strain are incubated in a 37℃ constant temperature incubator overnight, and the high efficiency plasmid transformation can be completed, the survival rate of the experimental strain is higher, and more strains can be used for subsequent PCR detection; the gene knockout efficiency is higher, the single-stranded DNA deletion efficiency of the target gene can reach 90%-95%, the double-stranded DNA deletion efficiency is different according to the size of the target gene fragment, and under normal circumstances, positive mutants can appear in 50 bacterial clones; the process of deplasmidization is simple and easy to operate, only the target strain A. cumminsii carrying the knockout plasmid after transformation is cultured at 39℃ for 48 hours, and the plasmid can be completely degraded and inactivated, which can better save manpower, time and reagent costs compared with the existing methods.

[0050] The key steps in the method of the application include: amplifying 1000bp fragments upstream and downstream of the target gene by conventional PCR, then amplifying the homologous arm of the target gene by overlap extension PCR, and purifying, enzyme cutting, connecting to pMD-18T plasmid and sequencing verification. According to the target gene fragment, double PAM sequences are designed, sgRNA and T7term elements are fused and connected to pCRISPomyces-2, and then the complete knockout plasmid is assembled by enzyme cutting, dephosphorylation and connection etc. by conventional molecular biology methods. The screening of mutant strains is completed by using three-parent conjugation transfer, conjugant A. cumminsii deplasmidization and gene defect strain PCR detection methods, wherein the key steps affecting the method are whether the deplasmidization is complete and the knockout efficiency, and the corresponding results are as follows:

[0051] After three parentage transfer and double antibiotic screening, a large number of successfully transformed knockout plasmid strains A. cumminsii can be obtained, since the plasmid belongs to temperature control type, 96 single clones are randomly selected and streaked to an antibiotic-free LB agar plate and cultured at 39℃ for 2 days to remove plasmid. Then 18 strains after plasmid removal are randomly selected and streaked to an antibiotic-free and apramycin-resistant LB agar plate and cultured in a 37℃ constant temperature incubator for 16 hours. The strains that can grow normally on the antibiotic-free LB agar plate and cannot grow on the LB agar plate added with apramycin meet the two determination conditions at the same time, which proves that the plasmid removal is completed. The plasmid removal method is simple and efficient, and no foreign plasmid is left in the strain. Only A. cumminsii carrying the plasmid is cultured at 39℃ for 48 hours to complete the degradation of the whole plasmid. Compared with other methods, the method is more cost-effective in terms of reagent cost, manpower and time, etc.

[0052] Example 1

[0053] As shown in Figure 1 The present application provides a kind of efficient stability gene knockout method (CRISPR-Cas9 integration homologous recombination repair) applicable to A. cumminsii of Kedarnath Arthrobotrys as shown in the drawing, wherein pCRISPomyces-2 is used as basic gene knockout vector, after double PAM sequence is targeted to target gene, the purpose gene double-stranded DNA cutting is realized by inducing Cas9 protein expression to produce fracture, and homologous recombination is repaired. Using this method, the stability of the gene in the genome can be realized, and other sequences will not be introduced into the genome, and the plasmid will not be left in the strain cell, and the gene function of A. cumminsii is further studied, which has high application value.

[0054] Specifically, the method comprises the following steps:

[0055] 1. Amplification of A. cumminsii target gene homologous arm

[0056] The genes A and B annotated as toxin protein coding genes in the bacteria are selected to verify the method of the present application, wherein the nucleotide sequence (1380bp) of gene A is shown as SEQ ID NO:1, and the nucleotide sequence (633bp) of gene B is shown as SEQ ID NO:2.

[0057] SEQ ID NO:1

[0058]

[0059] SEQ ID NO: 2

[0060] ATGAAAAAGGAAAGTAAGATATATATTTATAATGATATATATAAAGTGAATG

[0061] GATGCAGAGAAAATAGTCAGGCTGACTACTGCTTTCCACTGTCGAAATGTATAAA

[0062] ACTGCTGGCATTTATAGATTGTCATTATCATTTATCACAAAAATATAATAATGATG

[0063] TGACAGATAATAAAATCTGTTCTGATTATGAAATTACTTTTCCGGTTCAGGGGGA

[0064] TGCAGAAAACCCGGAATATCGTATTGTCTGTGAAATGCTGAATGAAAATAGTGTA

[0065] ATAAAAACATTTTTTAATACACTGCGTCACTCTGAGCATTACTGGCTGGTGAAAC

[0066] ACCTGATCAGCGCAGCGGATTGCAAAAACAATAACATCCGGGATATCAGCCAGC

[0067] GTTACGGGTTATCCGGCACTCACTTCAGACGCTTGTGTCAGCGTTATATCGGCAAT

[0068] CAGAGTAAATACCAGTTGCGGCACTGGCGCGGCGTGGCATCAGTGCTGGATATCC

[0069] TGGTAAAAGAGCATTCACTGACCCGTATCGCGGCAGATAACGGCTACTGCTCTGC

[0070] ATCGCATTTCTCAAATGAAATCAAAATATTATTTGGTATGTCTCCCCGGAAAATA

[0071] AGGAATTTAAATCATGCGGTTAAAAAATAG

[0072] Firstly, the primers were designed for the 1000 bp upstream and downstream of the two genes A and B by using software Primer 5.0, and the nucleic acid DNA sequences were amplified by using 2x Phata Flash high-fidelity enzyme. The obtained amplification products were directly diluted 50 times without purification and other treatments, and the two DNA products after dilution were mixed according to 1:1 as the subsequent overlap extension PCR template. The homologous arm of the two target genes was amplified by setting gradient PCR amplification program, and the homologous arm amplification products were detected by agarose gel electrophoresis experiment. The 2000 bp target band was cut and purified, and A was added at the end of the fragment. The fragment was connected to pMD-18T vector by using T4 ligase, and the conditions were 16℃ metal bath connection for 18 hours to obtain the connection product. 10 μL of the above connection product was transformed into E. coli DH5α, which was cultured at 37℃ for 16 hours to obtain the transformed E. coli DH5α. The transformed E. coli DH5α was detected by PCR using M13 universal primer, and the strain successfully connected with 2000 bp was extracted by plasmid extraction kit, and the plasmid DNA was sent to Shanghai Shengong Biological Co., Ltd. for sequencing verification, and the sequence correct one was used as the homologous recombination repair template.

[0073] In the above process, the primer sequences used for amplifying the homologous arm and the 1000 bp products of the upstream and downstream of the target gene are shown in Table 1, and the primers for overlap extension PCR amplification are A-F1 and A-R2 and B-F1 and B-R2.

[0074] Table 1 Primer sequences used for amplifying the homologous arm of the target gene

[0075]

[0076] The amplified homologous arm gene sequence is shown as SEQ ID NO: 11-12

[0077] The homologous arm sequence of Gene A (2000 bp) is:

[0078] SEQ ID NO: 11

[0079]

[0080] Homology arm sequence of Gene B (2000 bp):

[0081] SEQ ID NO: 12

[0082]

[0083] 2. Synthesis of dual-target sequence and construction of knockout plasmid

[0084] First, the target gene is subjected to bioinformatics analysis and the signal peptide region is predicted, and then the region is cut to obtain the complete gene coding region (http: / / www.cbs.dtu.dk / services / SignalP). Within about 100 bp sequences at the beginning and end of the coding region of the target gene, the first 20 nucleotide sequences of NGG in the sequence are selected as PAM sequences. The last base of the sequence is adenine (A) or guanine (G), and the GC content is 40%-60%. Then, the BbsI enzyme cutting site and the protection base, sgRNA sequence box, T7 term and other elements are integrated for gene synthesis, and are connected to the plasmid pCRISPomyces-2 (http: / / www.addgene.org / protocols / crispr / crispr-plasmid-construction / ) by enzyme digestion, ligation and other methods. After the integration of the fragment, the plasmid P1 map obtained is shown in Figure 2 Figure 3 .

[0085] The sequence of the dual-PAM integration fragment of gene A and gene B is shown in SEQ ID NO: 13-14:

[0086] The sequence of the knockout plasmid P1 integration fragment of gene A is:

[0087] SEQ ID NO: 13

[0088] ​ACGCAGATTTAGTTCTCTGTATTAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGGCTGCTCCTTCGGTCGGACGTGCGTCTACGGGCACCTTACCGCAGCCGTCGGCTGTGCGACACGGACGGATCGGGCGAACTGGCCGATGCTGGGAGAAGCGCGCTGCTGTACGGCGCGCACCGGGTGCGGAGCCCCTCGGCGAGCGGTGTGAAACTTCTGTGAATGGCCTGTTCGGTTGCTTTTTTTATACGGCTGCCAGATAAGGCTTGCAGCATCTGGGCGGCTACCGCTATGATCGGGGCGTTCCTGCAATTCTTAGTGCGAGTATCTGAAAGGGGATACGCGTCCACTCAGGCAGTCGCAGGTTT

[0089] Knockout plasmid P1 integration fragment sequence of gene B:

[0090] SEQ ID NO: 14

[0091] ACGCAATGATATATATAAAGTGAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGGCTGCTCCTTCGGTCGGACGTGCGTCTACGGGCACCTTACCGCAGCCGTCGGCTGTGCGACACGGACGGATCGGGCGAACTGGCCGATGCTGGGAGAAGCGCGCTGCTGTACGGCGCGCACCGGGTGCGGAGCCCCTCGGCGAGCGGTGTGAAACTTCTGTGAATGGCCTGTTCGGTTGCTTTTTTTATACGGCTGCCAGATAAGGCTTGCAGCATCTGGGCGGCTACCGCTATGATCGGGGCGTTCCTGCAATTCTTAGTGCGAGTATCTGAAAGGGGATACGCACCCGTATCGCGGCAGATAAGTTT

[0092] 3. The homologous arm is ligated to plasmid P1 to construct the complete gene knockout vector P2

[0093] The plasmid sequence is analyzed, and the 2000 bp homologous arm of the target gene amplified in step 1 and the knockout plasmid P1 obtained in step 2 are simultaneously single-cut with XbaI fast-cut enzyme (37°C, 30 min) to obtain the corresponding enzyme digestion products. Then the two enzyme digestion products are purified and recovered for later use. After the plasmid P1 is purified by enzyme digestion, the heat-sensitive calf intestinal alkaline phosphatase (Quick Cip) is used for dephosphorylation (37°C, 20 min) and further purification and recovery. Finally, the T4 ligase is used to ligate the homologous arm after enzyme digestion and purification to the dephosphorylated plasmid P1, and the homologous arm is connected to the position 9035-9040 (marked in orange highlight) of the plasmid, and placed in a 16°C metal bath for 18 hours to obtain the ligation product--the complete gene knockout vector P2. Figure 4 Figure 4 ​). Take 10 μL of the ligated product and transform into E. coli DH5α, and incubate at 37 °C for 16 hours to obtain the transformed E. coli DH5α. Perform PCR detection on the transformed E. coli DH5α using primers designed at 100 bp upstream and downstream of the Xba I enzyme cutting site, and extract plasmid DNA from the strain successfully ligated with 2000 bp using a plasmid extraction kit, and send to Shanghai Biosci & Biotech Co., Ltd. for sequencing verification. The plasmid map of the correct sequence is shown in Figure 4 . Obtain the E. coli DH5α carrying the complete integrated fragment gene knockout vector P2 as the gene knockout strain for subsequent experiments.

[0094] 4. Transformation of the knockout plasmid into the target strain A. cumminsii

[0095] The E. coli DH5α carrying the complete integrated fragment gene knockout vector P2 (Apramycin resistance), E. coli HB101 PRK-2013 (Kanamycin resistance), and the target strain A. cumminsii (Ampicillin resistance) are streaked onto LB agar medium (Luria-Bertani) with the corresponding antibiotics (the final concentration of ampicillin and apramycin is 100 μg / ml, and the final concentration of kanamycin is 50 μg / ml) and incubated at 37 °C overnight. The next day, three single colonies of each bacterium are picked and cultured in the resistant LB liquid medium at 37 °C for 3-4 hours to the exponential growth phase (180 rpm), and then centrifuged at 8000 rpm for 2 min to recover the bacterial cells. The bacterial cells are washed 2-3 times with LB liquid medium without antibiotics, and then resuspended in 1 mL of LB liquid medium without antibiotics. The E. coli DH5α cells carrying the complete integrated fragment gene knockout vector P2, the E. coli HB101 PRK-2013 cells, and the target strain A. cumminsii cells are mixed at a ratio of 2:2:1, and 100 μL of the mixture is dropped onto an LB agar plate without antibiotics and incubated at 37 °C for 16 hours for plasmid transformation (triple parent conjugation). The overnight cultured bacteria are washed with antibiotic-free LB liquid medium and gradient diluted, and the bacterial solution is spread on an ampicillin and apramycin double-resistant LB agar plate, and 0.2 mM of isopropyl-β-D-thiogalactoside (IPTG) is added to the agar plate, which is incubated at 28 °C for 48 hours for screening of the successfully transformed conjugants. The purpose of IPTG is to induce the expression of Cas9 protein in the target strain A. cumminsii, and finally the A. cumminsii strain into which the knockout plasmid is transformed is obtained.

[0096] 5. Detection of A. cumminsii deplasmid and gene-deficient strain

[0097] Randomly select 96 A. cumminsii monoclonal strains successfully transformed with the knockout plasmid in step 4 and streak them on antibiotic-free LB agar medium, and incubate them at 39°C for 2-3 days for plasmid removal. Randomly select 18 monoclonal strains and streak them on two types of LB agar plates without antibiotic addition and apramycin resistance for plasmid removal detection. The strains that do not grow on the resistant plates and grow on the antibiotic-free plates are determined to be completely degraded. Meanwhile, the double primer method is used for PCR amplification to detect the target gene-deficient strains, and the primer design principle is shown in Table 1: two pairs of inner and outer primers are designed, the outer primers are designed at the upstream and downstream of the target gene, and the inner primers are designed at the upstream 250 bp and the 5' end 250 bp of the target gene. Figure 5

[0098] Table 2 PCR detection of double primer sequences of A. cumminsii gene-deficient strains

[0099]

[0100] The detection results are shown in Table 3. Figure 6 As shown in Table 3, 18 strains grow normally on the antibiotic-free LB agar plates, but do not grow on the LB agar plates with apramycin addition, indicating that the conjugants are completely plasmid-free. Figure 6

[0101] The positive gene-deficient strain is determined by amplifying a 500 bp nucleic acid DNA fragment with the outer primer and no fragment amplification with the inner primer, which is preliminarily determined as a mutant strain. The positive gene-deficient strain obtained by the initial screening is further purified by four-zone streak culture for 2-3 times, and 24 clones are randomly selected for detection by the double primer method after each purification culture until all the detection clones are positive.

[0102] The gene knockout efficiency is a key link in the whole method and is also a standard for judging the practicability of the method. The present application detects the gene-deficient strains by designing two pairs of primers. The agarose gel electrophoresis detection results after two rounds of PCR detection of the positive gene-deficient strains are shown in Table 4. Figure 7 After agarose gel electrophoresis, the inner primer cannot amplify the band, and the outer primer can amplify a band of about 500 bp. Randomly select 48 A. cumminsii strains after conjugation and transfer them using the outer primer (F1 and R2) for one round of PCR detection, and a 500 bp band can be detected by agarose gel electrophoresis, indicating that the method can achieve a DNA strand deletion efficiency close to 100%.​​Figure 7 -a); 96 transformed A. cumminsii were selected for plasmid removal, and 48 strains were randomly selected again for double primer detection after 48 hours of culture at 39°C. Two positive mutant strains were detected for gene A (positive rate of about 4%), and 7 mutant strains were detected for gene B (positive rate of about 15%), and the detection results are shown in Table b. The above results show that the method of the present application can be used to stably knock out genes in the genome of A. cumminsii. The method only needs to detect 48 strains to obtain the corresponding gene-deficient strains, and the knockout plasmid carries a strain DNA repair template, which can achieve precise gene knockout in A. cumminsii without introducing exogenous plasmids or genes. Figure 7 -a); 96 transformed A. cumminsii were selected for plasmid removal, and 48 strains were randomly selected again for double primer detection after 48 hours of culture at 39°C. Two positive mutant strains were detected for gene A (positive rate of about 4%), and 7 mutant strains were detected for gene B (positive rate of about 15%), and the detection results are shown in Table b. The above results show that the method of the present application can be used to stably knock out genes in the genome of A. cumminsii. The method only needs to detect 48 strains to obtain the corresponding gene-deficient strains, and the knockout plasmid carries a strain DNA repair template, which can achieve precise gene knockout in A. cumminsii without introducing exogenous plasmids or genes.

[0103] The above is only a preferred embodiment of the present application, and does not limit the present application in any form. Although the present application has been disclosed as above with a preferred embodiment, it is not intended to limit the present application. Any person skilled in the art can make some changes or modifications to the above disclosed methods and technical contents to obtain equivalent embodiments with equivalent changes, without departing from the technical solution of the present application. Any simple modification, equivalent change and modification of the above embodiments based on the technical essence of the present application are still within the scope of the technical solution of the present application.

Claims

1. A gene knockout vector for Arthroblastus karyotes, characterized in that, The vector comprises amplified sequences of upstream and downstream homologous arms of the target gene and a double PAM integration fragment of the target gene; wherein... The target gene is the gene fragment to be knocked out; The upstream and downstream arms of the target gene are each 1000bp in length, and the length of the amplified homologous arm genes is 2000bp in length. The last base of the sequence of the dual PAM integrated fragment is adenine or guanine, and the GC content is 40%-60%.

2. The application of the Arthroblastus karyotes gene knockout vector according to claim 1 in achieving scarless knockout of the target gene in Arthroblastus karyotes.

3. A method for gene knockout of Arthroblastus karyotes, characterized in that, The method includes the following steps: S1: Transform Escherichia coli with the gene knockout vector described in claim 1 to obtain Escherichia coli carrying the gene knockout vector; S2: The obtained Escherichia coli carrying the gene knockout vector, Escherichia coli HB101 PRK-2013 and the target strain Arthroblastus karyotes were inoculated into LB agar medium supplemented with the corresponding antibiotics and cultured. Then they were transferred to resistant LB liquid medium and cultured until the exponential growth phase. They were centrifuged and collected to obtain Escherichia coli cells carrying the gene knockout vector, Escherichia coli HB101 PRK-2013 cells and the target strain Arthroblastus karyotes cells, respectively. S3: The obtained E. coli cells carrying the gene knockout vector, E. coli HB101 PRK-2013 cells, and target strain Arthroblastus cells were mixed and transformed with plasmids. After screening, Arthroblastus cells with knockout plasmids were obtained. S4: The resulting Germella catarrhalis transformed with the knockout plasmid is deplatinated to obtain a gene-deficient strain with the target gene knocked out.

4. The gene knockout method for Arthroblastus carinii according to claim 3, characterized in that, Step S1 also includes: S11: Amplify the upstream and downstream homologous arms of the target gene to be knocked out to obtain the amplified sequences of the upstream and downstream homologous arms of the target gene; the nucleotide sequences of the amplification primers are shown in SEQ ID NO:3-10; S12: Design a double PAM integration fragment of the target gene to be knocked out, and link the obtained double PAM integration fragment to plasmid P0 to construct the knockout plasmid P1. S13: The amplified sequences of the upstream and downstream homologous arms of the target gene are ligated to the knockout plasmid P1 to obtain the gene knockout vector.

5. The gene knockout method for Arthroblastus carinii according to claim 3, characterized in that, In step S2, the LB agar medium culture conditions are: overnight culture at 37°C; the resistant LB liquid medium culture conditions are: 37°C culture for 3-4 hours.

6. The gene knockout method for Arthroblastus carinii according to claim 3, characterized in that, In step S3, the Escherichia coli cells carrying the gene knockout vector, Escherichia coli HB101 PRK-2013 cells, and the target strain Arthroblastus cells are mixed in a ratio of 2:2:

1.

7. The gene knockout method for Arthroblastus carinii according to claim 3, characterized in that, In step S3, the plasmid transformation conditions are as follows: the transformation medium is non-resistant LB agar plate, the temperature is 37°C, and the time is 16 hours.

8. The gene knockout method for Arthroblastus carinii according to claim 3, characterized in that, In step S3, the screening conditions are as follows: the screening medium is LB agar plates containing ampicillin and apramycin with isopropyl-β-D-thiogalactopyranoside added, the temperature is 28°C, and the time is 48h.

9. The gene knockout method for Arthroblastus carinii according to claim 3, characterized in that, In step S4, the deplasmidization conditions are as follows: the deplasmidization medium is antibiotic-free LB agar medium, the temperature is 39°C, and the time is 2 to 3 days.

10. The gene knockout method for Arthroblastus carinii according to claim 3, characterized in that, Step S4 also includes a step of detecting gene-deficient strains, wherein the detection is performed by double-primer PCR amplification, and the nucleotide sequences of the primers are shown in SEQ ID NO:15-20.

Images