Molecular marker for interaction resistance of panonychus citri to insecticide as well as application and detection method of molecular marker

Abstract

The invention discloses a molecular marker for interaction resistance of panonychus citri to insecticides as well as application and a detection method of the molecular marker. According to the molecular marker for the cross resistance of the panonychus citri to the multiple medicaments, the molecular marker is carboxylesterase genes PcCCE11 and / or PcCCE7, the nucleotide sequence of the PcCCE11 gene is as shown in SEQ ID NO.1, and the nucleotide sequence of the PcCCE7 gene is as shown in SEQ ID NO.2. The invention further discloses a preparation method of the molecular marker for the cross resistance of the panonychus citri to the multiple medicaments.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular biology, and relates to a molecular marker for insect resistance to pesticides, in particular to a molecular marker for cross-resistance of Panonychus citri to insecticides and an application and detection method thereof. BACKGROUND

[0002] Panonychus citri McGregor is a phytophagous mite, which can harm more than 112 species of plants such as citrus, apple, cherry, pear and zanthoxylum, and mainly feeds on Rutaceae citrus fruit trees. Due to its biological characteristics and improper use of chemical pesticides, the resistance of Panonychus citri is extremely serious, which further causes its frequent outbreak in various citrus production areas and makes the prevention and control more and more difficult.

[0003] At present, although various types of acaricides are sprayed in citrus production areas, mainly including chloride channel allosteric modulators (emamectin benzoate and abamectin), acetyl coenzyme A carboxylase inhibitors (spirotetramat and spirodiclofen), mitochondrial complex electron transport inhibitors (flumorfine and bifenthrin), growth inhibitors (hexythiazox and etoxmizole) (Adesanya et al., 2021; Chen Huiping et al., 2021), but the long-term unreasonable use inevitably causes the prominent problem of mite resistance in the field (Pan Deng et al., 2024). It is reported that Panonychus citri has developed different levels of resistance to various acaricides used in production, such as spirotetramat, spirodiclofen, fenpropathrin, etoxmizole, pyridaben, flumorfine, fentrazamide, hexythiazox, bifenthrin and abamectin (Hue et al., 2010; Van Leeuwen et al., 2010; Ouyang et al., 2011; Wang et al., 2020; et al., 2021). More seriously, Panonychus citri also simultaneously develops cross-resistance to various acaricides (Yu et al., 2011; Wang et al., 2020; et al., 2021; Liu et al., 2023).

[0004] The target of abamectin is GABA and GluCl, but most of the researches on target resistance are focused on GluCl, for example, A309G, G315E and V263I mutations of Plutella xylostella and G323D and G326E mutations of Tetranychus urticae, which mediate the formation of abamectin resistance (Riga et al., 2017; Sun et al., 2023). In addition, the increased activity of detoxification enzymes enhances the detoxification metabolism of abamectin.

[0005] Spirodiclofen is a highly effective and specific acaricide for the control of Tetranychus spp., Brevipalpus spp., Panonychus spp. and Phyllocoptruta spp. and other mites. It has contact and stomach toxicities to the mites and can be used to control a variety of ornamental plants and economic crops such as roses, citrus, apples and strawberries (Zhang et al., 2008; Della Vechia and de Andrade, 2022). Lipids are the most basic energy source for the growth and development of mites, and acetyl-CoA carboxylase (ACCase) involved in the synthesis of lipids plays a key role. ACCase is also the target of Spirodiclofen, and the inhibition of ACCase activity by Spirodiclofen affects the process of lipid synthesis and ultimately the energy metabolism of mites (Marcic et al., 2009; Seyed-Talebiet al., 2014). As a spirocyclic tetronic acid acaricide, Spirodiclofen is low in toxicity and residual and has a long persistence period. It has good acaricidal effect on eggs, larvae and nymphs of mites, but cannot kill adult mites. However, it has a good sterilizing effect on female adult mites, reduces their reproductive capacity, and 90% of the eggs laid by female adult mites after contact with the drug cannot hatch and die in the late embryonic stage (Ouyang et al., 2011). Due to the above advantages, Spirodiclofen is favored in the field of mite control. However, with the continuous use of Spirodiclofen and unscientific use of the drug, the problem of Spirodiclofen resistance in mites is becoming increasingly serious, and Spirodiclofen resistance has been widely reported in Panonychus ulmi, Brevipalpus yothersi, Amphitetranychus viennensis, two-spotted spider mite and citrus red mite (Hue et al., 2010; Kramer and Nauen, 2011; Ferreira et al., 2015; Feng et al., 2018).

[0006] Cross-resistance refers to the phenomenon where a certain strain of a pest (mite) develops resistance to a pesticide or a class of pesticides other than the target pesticide (Liue et al., 2023). Yu et al. (2011) found cross-resistance to spirodiclofen in toxicity tests of citrus psyllid strains resistant to spirodiclofen screened indoors. In addition, Wang et al. (2020) found that field populations from Guilin and Nanning, Guangxi, China, also showed extremely high levels of resistance to abamectin, cypermethrin, and fenflurfen. Doker et al. (2021) found that populations from Kukurova, Turkey, showed varying degrees of resistance to etoxazole, spirodiclofen, and spirotetramat. Liu et al. (2023) found cross-resistance to emamectin benzoate, pyridaben, cypermethrin, and fenflurfen in highly resistant citrus psyllid strains to abamectin. In a broader sense, cross-resistance, in a narrower sense, refers to resistance to two or more acaricides mediated by the same gene or mutation in a mite (Liue et al., 2023). Some reports indicate that target mutations are involved in the cross-resistance of mites to acaricides with the same mechanism of action. However, the vast majority of cross-resistance to acaricides with different mechanisms of action and modes of contact arises through metabolic resistance. Therefore, enhanced activity of detoxification metabolic enzymes in mites is an important mechanism for their reduced sensitivity to multiple acaricides (Van Leeuwen et al., 2010; Badieini et al., 2020).

[0007] Carboxyl esterases (CCEs) are important detoxification and metabolic enzymes, forming a large, multifunctional family of enzymes widely distributed in most organisms. In insects, they are primarily found in the head, midgut, and Malpighian tubules (Cuie et al., 2011; Ren et al., 2014). As one of the most important detoxification and metabolic enzymes in insects, carboxyl esterases have highly complex and diverse functions, mainly involved in insect resistance to pesticides or hormone metabolism, and also in insect reproductive processes (Ransone et al., 2002; Yu et al., 2009). Currently, the carboxyl esterase family is divided into eight subfamilies, but most catalytic functions are performed by three enzymes: α-esterases, β-esterases, and juvenile hormone esterases (Ransone et al., 2002). The conserved structures of the CCEs family mainly include catalytic triplets, oxygen ion holes, and α / β hydrolase folding domains. Their characteristic structure is Gly-x-Ser-x-Gly, where the Ser residue is a crucial nucleophilic residue enabling the catalytic triplet to function. The catalytic triplet Ser-Glu / Cys-His (SE / DH) is present in most carboxylesterases, thus giving CCEs the ability to hydrolyze ester bonds (Yuetal., 2009). However, CCEs-mediated acaricide resistance, especially cross-resistance, has not been reported.

[0008] Currently, *Pseudomonas citrus* has developed resistance or cross-resistance to most registered acaricides, but the mechanisms of resistance, especially cross-resistance, are poorly reported. Abamectin, spirodiclofen, and etoxazole are three widely used acaricides in citrus production in my country, and many production areas have reported that *Pseudomonas citrus* in the same orchard has developed significant resistance to all three acaricides simultaneously. These three acaricides have different mechanisms of action, making target mutations unlikely to mediate cross-resistance. Therefore, enhanced activity of detoxification metabolic enzymes and their upregulation are likely important reasons for cross-resistance. Although there are reports of enhanced CCE enzyme activity associated with resistance to abamectin, spirodiclofen, and etoxazole, research on the involvement of the CCE gene in cross-resistance to these three acaricides has not yet been reported. Summary of the Invention

[0009] The purpose of this invention is to address the above-mentioned problems by providing a molecular marker for cross-resistance of citrus psyllids to insecticides, its application, and a detection method thereon.

[0010] To achieve its objective, the present invention employs the following technical solution:

[0011] The first aspect of the present invention provides a molecular marker for the cross-resistance of multiple agents to the citrus paronychia, said molecular marker being a carboxylesterase gene PcCCE11 and / or PcCCE7, the nucleotide sequence of the PcCCE11 gene being shown in SEQ ID NO.1, and the nucleotide sequence of the PcCCE7 gene being shown in SEQ ID NO.2.

[0012] The various agents include abamectin, spirodiclofen, and preferably etoxazole.

[0013] The molecular marker is the carboxylesterase gene PcCCE11, and the various agents are avermectin and spirodiclofen.

[0014] A second aspect of the invention provides the application of the molecular markers described in any of the preceding claims in the classification of susceptible and resistant populations of *Psoceras citrinum* to various pesticides, said various pesticides including abamectin, spirodiclofen, and preferably etoxazole.

[0015] The expression level of the carboxylesterase gene in the tested citrus psyllid was detected. If the expression level of the carboxylesterase gene in the tested citrus psyllid was significantly higher than that in the susceptible population, it could be determined that the tested citrus psyllid exhibited cross-resistance to multiple agents. If there was no significant difference in the expression level of the carboxylesterase gene between the tested citrus psyllid and the susceptible population, it could not be determined that the tested citrus psyllid exhibited cross-resistance. The carboxylesterase gene was PcCCE11 and / or PcCCE7.

[0016] A third aspect of the present invention provides a method for detecting the above-mentioned molecular markers, using a drug-sensitive population of *P. citrus* as a control, detecting the expression level of the carboxylesterase gene in the *P. citrus* mite to be tested. If the expression level of the carboxylesterase gene in the *P. citrus* mite to be tested is significantly higher than that in the sensitive population, it can be determined that the *P. citrus* mite to be tested exhibits cross-resistance to multiple drugs; if there is no significant difference in the expression level of the carboxylesterase gene between the *P. citrus* mite to be tested and the sensitive population, it cannot be determined that the *P. citrus* mite to be tested exhibits cross-resistance; the carboxylesterase gene is PcCCE11 and / or PcCCE7.

[0017] The various agents include abamectin, spirodiclofen, and preferably etoxazole.

[0018] The method includes the following steps: extracting total RNA from the citrus parvovirus mite to be tested, reversing it into cDNA, performing qPCR amplification using the cDNA as a template, using a sensitive population as a control, measuring the expression level of the carboxylesterase gene in the test subject, and determining that the test subject has cross-resistance to multiple agents when the expression level of the carboxylesterase gene in the test subject is significantly higher than that in the sensitive population.

[0019] Preferably, the primer sequences for the qPCR amplification are:

[0020] The primer sequences for amplifying the PcCCE11 gene are as follows:

[0021] EVM0001466-F: 5'-CGGAACATTGTGCTTCATTC-3';

[0022] EVM0001466-R: 5'-CGAGTTTTCGGCTTCAAGTATC-3';

[0023] The primer sequences for amplifying the PcCCE7 gene are as follows:

[0024] EVM0005255-F: 5'-GAGTCCTTGTTGCCCGTTTA-3';

[0025] EVM0005255-R: 5'-GCCACATTACCTGGAATACCCT-3'.

[0026] Preferably, the reaction program for the qPCR amplification is as follows: 95℃ pre-denaturation for 30s; 95℃ for 10s, 60℃ for 30s, 40 cycles; melting curve: 95℃ for 15s, 60℃ for 60s, 95℃ for 15s.

[0027] The beneficial effects of this invention are:

[0028] This invention investigated the following: 1. It clarified that overexpression of PcCCE11 and PcCCE7 is involved in the formation of cross-resistance between *Pterygodium citrinum* and abamectin, spirodiclofen, and etoxazole: By measuring the CCEs activity of multi-resistant strains of *Pterygodium citrinum* resistant to abamectin, spirodiclofen, and etoxazole, it was found that the CCEs activity of multi-resistant strains of *Pterygodium citrinum* resistant to abamectin, spirodiclofen, and etoxazole was significantly higher than that of sensitive strains. Further analysis of transcriptome and RT-qPCR revealed two candidate CCE genes (PcCCE11 and PcCCE7) that were significantly overexpressed at all developmental stages. After reducing the expression of PcCCE11 and PcCCE7, the CCEs activity of *Pterygodium citrinum* decreased and its sensitivity to abamectin and spirodiclofen increased. 2. The specific detoxification and metabolic mechanisms of PcCCE11 and PcCCE7 proteins in the cross-resistance of *Pteris vittata* to avermectin, spirodiclofen, and etoxazole were clarified: In vitro functional analysis of candidate genes PcCCE11 and PcCCE7 using prokaryotic expression showed that recombinant proteins PcCCE11 and PcCCE7 can directly metabolize avermectin and spirodiclofen, but not etoxazole. PcCCE11 protein prevents avermectin from reaching its target by isolating or chelating it, and directly hydrolyzes the chemical ester bonds of spirodiclofen, metabolizing it into secondary metabolites; PcCCE7 protein can directly hydrolyze the chemical ester bonds of avermectin and spirodiclofen, metabolizing them into secondary metabolites.

[0029] This invention identifies molecular markers for cross-resistance of *P. citrus* to spirodiclofen, abamectin, and etoxazole. These markers exhibit high specificity and stability. By analyzing these molecular markers in a tested *P. citrus* population, the presence of cross-resistance to multiple pesticides can be confirmed. This invention provides a rapid method for detecting these molecular markers. The expression level of the carboxylesterase gene in the tested *P. citrus* mite is measured. If the expression level of this gene is significantly higher than that in susceptible *P. citrus* populations, it can be determined that the tested *P. citrus* mite exhibits cross-resistance to multiple pesticides. The detection method of this invention is simple and rapid to operate, with high specificity and sensitivity. It is beneficial for early monitoring of pesticide resistance in the field of *P. citrus*, enabling continuous and effective control of pesticide resistance, and is of great significance for the sustainable development of the citrus industry. Attached Figure Description

[0030] Figure 1 The specific viability of CCEs for the citrus parsnipus SS and CoR-NN strains is as follows: SS, a laboratory-sensitive strain; CoR-NN, a field-collected multi-resistant strain; error bars represent the standard deviation of the mean of three independent replicates, and significance was determined using the Student's test (***p<0.001).

[0031] Figure 2This study analyzes the expression patterns of six CCE genes in CoR-NN at different developmental stages: expression of CCE genes (EVM0001466, EVM0002296, EVM0002806, EVM0005255, EVM0003530, EVM0009195) at different developmental stages in CoR-NN; error bars represent the standard deviation of the mean of three independent replicates; significance was determined using Student's-test (*p<0.1, **p<0.01, ***p<0.001, and ****p<0.0001), and relative expression levels between 10 and 100-fold were not labeled (between **p<0.01 and ***p<0.001).

[0032] Figure 3 This study analyzed the expression patterns of the two CCE genes in CoR-NN at different developmental stages: the relative expression levels of EVM0001466 and EVM0005255 in different developmental stages of CoR-NN (compared to SS); error bars represent the standard deviation of the mean of three independent replicates; significance was determined using Student's t-test (*p<0.1, **p<0.01 and ***p<0.001).

[0033] Figure 4 Expression pattern analysis of CoR-NNEVM0001466 and EVM0005255 at different treatment times: (A and B) using LC 50 CoR-NN was treated with avermectin at a concentration of 350 mg / L for 24 h, and the expression levels of EVM0001466 and EVM0005255 were detected; (C and D) by LC 10 CoR-NN was treated with spirodiclofen at a concentration of 5000 mg / L for 24 h, and the expression levels of EVM0001466 and EVM0005255 were detected; (E and F) were analyzed by LC-12. 10 CoR-NN was treated with etoxazole at a concentration of 5000 mg / L for 24 h, and the expression levels of EVM0001466 and EVM0005255 were detected. Error bars represent the standard deviation of the mean of three independent replicates. Statistical significance was determined using the Student's st-test (*p<0.05; **p<0.01; ***p<0.001).

[0034] Figure 5 This is a phylogenetic analysis of the Citrus citrus cephalomites (CCEs) and other arachnid species.

[0035] Figure 6The following are the SDS-PAGE and Western blotting results of recombinant PcCCE11 and PcCCE7 proteins: (A) SDS-PAGE image of PcCCE11 protein. M: protein marker; lane1: empty vector; lane2: precipitate; lane3: supernatant; lane4-9: elution buffers of 20mM, 40mM, 60mM, 80mM, 100mM, and 150mM imidazole; (B) SDS-PAGE image of PcCCE7 protein. M: Protein Marker; lane1: Empty vector; lane2: Precipitate; lane3: Supernatant; lane4-9: 40mM, 60mM, 80mM, 100mM, 150mM, 20mM imidazole; (C) Western blotting diagram of PcCCE11 and PcCCE7 proteins; M: Protein Marker; lane1: Recombinant protein PcCCE7; lane1 represents recombinant protein PcCCE11.

[0036] Figure 7 This is a metabolic chromatogram of recombinant proteins PcCCE11 and PcCCE7 against acaricides.

[0037] Figure 8 RNAi analysis of the CoR-NN strain of *Paecilomyces citrus*: (A and B) qPCR analysis of the expression levels of PcCCE11 and PcCCE7 in CoR-NN relative to the control after RNAi; (C and D) LC50 of avermectin in CoR-NN after RNAi. 50 Values; mortality rates of spirodiclofen after CoR-NNRNAi (E and F); mortality rates of etoxazole after CoR-NNRNAi (G and H); error bars represent the standard deviation of the mean of three independent replicates; significance was determined using Student's t-test (*p<0.05; **p<0.01; ***p<0.001; ****p<0.0001).

[0038] Figure 9 The results show the crude enzyme activity of CCEs after RNAi treatment of the Citrus paris versicolor CoR-NN strain: (A and B) represent the activity of CCEs relative to the control after RNA interference with PcCCE11 and PcCCE7, respectively; error bars represent the standard deviation of the mean of three independent replicates; significance was determined using Student's t-test (***p<0.001; ****p<0.0001). Detailed Implementation

[0039] The present invention will be further described below with reference to embodiments, but these embodiments are not intended to limit the scope of the invention.

[0040] Unless otherwise specified, the experimental methods described in the following examples are conventional methods.

[0041] Example 1

[0042] 1. Experimental Materials

[0043] 1.1 Test mite sources

[0044] Laboratory-susceptible strain of *Pseudorasbora citrinum* (SS): Collected in 2005 from *Citrus trifoliata* in an abandoned citrus orchard near the Citrus Research Institute of Southwest University. It has not been exposed to acaricides for many years and has been raised under conditions free from any acaricides to date. Multi-resistant strain of *Pseudorasbora citrinum* resistant to abamectin, spirodiclofen, and etoxazole (CoR-NN): Isolated from a field population in Nanning, Guangxi in April 2020. Since then, it has maintained resistance monthly under selected concentrations of 100 mg / L abamectin, 500 mg / L spirodiclofen, and 500 mg / L etoxazole.

[0045] All mites were cultured indoors on potted citrus plants or in a climate-controlled incubator with a temperature of 25±1℃, a relative humidity of 60% to 70%, and a photoperiod of 14L:10D.

[0046] 1.2 Test acaricides

[0047] 5% abamectin (CAS No.: 71751-41-2) EC (Hebei Xingbai Agricultural Technology Co., Ltd.), 240g / L (100mg / L) spirodiclofen (CAS No.: 148477-71-8) SC (Hangzhou Bayer Crop Science Co., Ltd.), 110g / L (100mg / L) etoxazole (CAS No.: 153233-91-1) SC (Shanghai Sumitomo Chemical Co., Ltd.).

[0048] 2 Experimental Methods

[0049] 2.1 Toxicity determination

[0050] The toxicity of abamectin, spirodiclofen, and etoxazole to female citrus psyllids was determined using a leaf-disc spray method, referencing and slightly modifying the method of Knight et al. (Knight et al., 1990). First, a leaf-disc apparatus was constructed. Absorbent sponges were cut into circular shapes slightly smaller than a 9cm diameter petri dish. After the sponges were fully soaked, they were placed in the petri dish. Then, circular filter paper, also slightly smaller than the petri dish, was soaked in water and placed on top of the sponges. Next, collected citrus leaves (untouched by any pesticides) were washed, dried, and trimmed to form a regular 2cm² shape. The leaves were placed face down on the filter paper, and the leaves were gently pressed to ensure they adhered tightly. To prevent escape of the citrus psyllids, absorbent cotton was torn into thin strips, moistened with water, and wrapped around the edges of the leaves. Then, healthy, vigorous adult females and nymphs (more than 30 individuals) of similar size were gently picked up with a soft brush and transferred to the leaf-disc apparatus. Finally, the leaf disc devices were placed in a Potter spray tower, and 1 mL of solutions of different concentrations of abamectin, spirodiclofen, and etoxazole were sprayed at a pressure of 1 bar. After spraying, the leaf discs were transferred to an incubator for rearing. After 24 hours, the mortality rate of adult female mites and nymphs on each leaf disc was counted under a stereomicroscope. A nymph was considered dead if its limbs were gently touched with a brush and it could not move. Five concentration gradients were set up, with at least three replicates for each concentration. A water treatment was used as a blank control (mortality rate <10% was effective). The virulence regression equation, LC50 value, 95% confidence limit, and correlation coefficient were calculated using PoloPlus and SPSS Statistics 26 data processing software.

[0051] 2.2 Assay of Carboxylesterase (CCE) Activity

[0052] 2.2.1 Extraction of crude enzyme solution

[0053] Two hundred healthy female adult citrus paronychia mites of the multi-resistant strain were selected and placed in pre-chilled 1.5 mL enzyme-free centrifuge tubes. 300 μL of pre-chilled 0.04 mol / L PBS (pH 7.4) buffer was added, and the mixture was homogenized on ice using an electric grinder. Then, 700 μL of pre-chilled 0.04 mol / L PBS (pH 7.4) buffer was added. The mixture was centrifuged at 4°C and 10000×g for 15 min. The supernatant was transferred to a new 1.5 mL enzyme-free centrifuge tube for detecting crude carboxylesterase activity. This solution can be stored at 4°C for later use. Crude enzyme solution from sensitive female adult mites and 0.04 mol / L PBS (pH 7.4) buffer were used as controls. Three replicates were set up for each group.

[0054] 2.2.2 Construction of Bovine Serum Protein Standard Curve

[0055] Bovine serum albumin (BSA) standard solution (1000 μg / mL) was diluted with 0.04 mol / L PBS (pH 7.4) buffer to create seven concentration gradients (5 μg / mL, 10 μg / mL, 20 μg / mL, 40 μg / mL, 60 μg / mL, 80 μg / mL, and 100 μg / mL). 50 μL of each gradient solution was added to an ELISA plate according to Table 1. 0.04 mol / L PBS (pH 7.4) buffer served as a blank control. Each group was tested in triplicate. After thorough mixing, the mixture was incubated at 37°C for 10 min. The OD values ​​at 595 nm for each concentration were then measured using an ELISA reader. A standard curve for BSA was plotted with the difference between the OD values ​​of the treated and control groups (ΔOD = OD treated well – OD control well) as the Y-axis and the concentration of BSA as the X-axis (μg / mL).

[0056] Table 1. Reaction system for bovine serum albumin standard curve

[0057]

[0058] 2.2.3 Determination of enzyme content

[0059] The zymogenin content in the crude enzyme solution was determined according to the Coomassie Brilliant Blue method (Bradford, 1976). The reaction system is shown in Table 2 below. 200 μL of Coomassie Brilliant Blue G-250 solution was added to each well. 50 μL of PBS solution was added to the control group, and 50 μL of crude enzyme solution was added to the treatment group. After mixing thoroughly, the mixture was reacted at 37℃ for 10 min. The OD values ​​at 595 nm for each concentration were then measured using a microplate reader. Each group was repeated in triplicate. The calculated ΔOD (ΔOD = OD treatment wells – OD control wells) was substituted into the standard curve obtained in 3.2.2.2 to calculate the zymogenin content in the crude enzyme solution.

[0060] Table 2. Crude enzyme solution protein concentration detection system

[0061] Reagent Control group (μL) Treatment group (μL) Crude enzyme solution 0 50 0.04 mol / L PBS 50 0 Coomassie brilliant blue G-250 200 200

[0062] 2.2.4 Plotting the α-naphthol standard curve

[0063] Using a serial dilution method, 1 mM α-naphthol was diluted to five concentration gradients with 0.04 mol / L PBS (pH 7.4) buffer. Samples were added to microplates according to Table 3, with 0.04 mol / L PBS (pH 7.4) buffer serving as a control. Each group was configured with three replicates. After thorough mixing, the mixture was incubated at 37°C for 10 min, and the OD values ​​at 600 nm for each concentration were measured using a microplate reader. An α-naphthol standard curve was plotted with the difference between the OD values ​​of the treatment group and the control group (ΔOD = OD treatment well – OD control well) as the Y-axis and the α-naphthol concentration as the X-axis.

[0064] Table 3. Reaction system for α-naphthol standard curve

[0065]

[0066] 2.2.5 CCEs Activity Assay

[0067] The method for CCEs activity assay was based on Van Asperen's method with modifications (Van Asperen, 1962). Following the assay system shown in Table 4, 150 μL of 0.3 mM mixed substrate and 50 μL of crude enzyme solution were added to the microplate, mixed thoroughly, and reacted at 37°C for 10 min. Then, 25 μL of chromogenic reagent was added, and the reaction was carried out at 30°C for 10 min. The OD value at 600 nm was then measured using a microplate reader. 0.04 mol / L PBS (pH 7.4) buffer was used as a control, and each group was repeated in triplicate. The measured ΔOD value (ΔOD = OD treated well – OD control well) was substituted into the standard curve obtained in 3.2.2.4 to calculate the content of the reaction product. The specific activity of the esterase CCEs was then calculated using the following formula:

[0068] CCE enzyme activity (nmol / mg Pro / min) = ΔOD / (T×Pro×V)

[0069] Where ΔOD is the content of α-naphthol generated in the reaction (nmol), T is the reaction time (min), Pro is the protein concentration (mg / L), and V is the volume of crude enzyme solution added to the system (L).

[0070] Table 4. Sampling system for CCEs activity detection

[0071]

[0072] 2.3 Real-time quantitative PCR

[0073] 1. Total RNA Extraction: Female adult mites of the SS strain and CoR-NN strain were selected on leaf discs. Under a stereomicroscope, vigorous females of suitable size were chosen. 24 hours after the selected females laid eggs, they were removed from the leaf discs. Total RNA was extracted from the samples required for the experiment, with three biological replicates (more than 100 individuals per replicate) for each sample. The ReliaPrep™ RNATissue Miniprep System (Promega) kit was used to extract total RNA from samples of *Pseudomonas citrus* at different developmental stages and under different treatments.

[0074] 2. Utilize The 1st Strand cDNA Synthesis Kit (Vazyme) was used to remove genomic DNA from the RNA sample. First-strand cDNA was synthesized according to the kit instructions.

[0075] 3. Real-time quantitative PCR

[0076] Based on transcriptome data from the SS and CoR-NN strains of the citrus parsnipae mite, six differentially expressed candidate CCE genes were screened (upregulated: EVM0001466, EVM0002296, EVM0002806, EVM0005255; downregulated: EVM0003530, EVM0009195). RT-qPCR primers for these genes were designed using Primer Premier 5.0 software; primer information is shown in Table 5. A 100-fold dilution of 1 μg of first-strand cDNA synthesized from total RNA was used as a template to dilute the primers, obtaining primer mixtures. ELF1A (HM582444) and GADPH (HM582445) were used as internal control genes. RT-qPCR reactions were detected using the ChamQ™ Universal SYBR@qPCRMaster Mix (Vazyme) kit, and the relative expression levels of the target genes were calculated using the 2-ΔΔCt method. The RT-qPCR reaction program was as follows: 95℃ pre-denaturation for 30s; 95℃ for 10s, 60℃ for 30s, 40 cycles; melting curve: 95℃ for 15s, 60℃ for 60s, 95℃ for 15s.

[0077] Table 5 Primer information for the CCE gene of *Pseudomonas citrus*

[0078] Primer name Primer sequence (5'-3') SEQ ID NO EVM0001466-F CGGAACATTGTGCTTTCATTC SEQ ID NO.3 EVM0001466-R CGAGTTTTCGGCTTCAAGTATC SEQ ID NO.4 EVM0002296-F AGCGGCACTTATTTGGGTTAG SEQ ID NO.5 EVM0002296-R CAGTTGCTTGATTGGGTTGAGA SEQ ID NO.6 EVM0002806-F AGCGGCACTTATTTGGGTTAG SEQ ID NO.7 EVM0002806-R CAGTTGCTTGATTGGGTTGAGA SEQ ID NO.8 EVM0005255-F GAGTCCTTTGTTGCCCGTTTA SEQ ID NO.9 EVM0005255-R GCCACATTACCTGGAATACCCT SEQ ID NO.10 EVM0003530-F AAGAGGCTTTAGTCCAGTTTATCG SEQ ID NO.11 EVM0003530-R CCAGTTCGTGTTCCGTAGGTT SEQ ID NO.12 EVM0009195-F TATTCGTTACCCGCTCACCC SEQ ID NO.13 EVM0009195-R TCCATGTCTTCAATCTTAGTCGC SEQ ID NO.14

[0079] 2.4 Biological Analysis of Candidate Genes

[0080] Bioinformatics analysis of candidate genes was performed based on their sequence information using the online tool TMHMM-2.0.

[0081] Signal peptides and transmembrane domains were comprehensively predicted and analyzed using tools such as (https: / / services.healthtech.dtu.dk / services / TMHMM-2.0 / ) and Novoproonline Tools (https: / / novopro.cn / tools / ). Furthermore, amino acid sequences of CCE genes from other species were downloaded from online databases such as Uniprot (https: / / www.uniprot.org / ) and NCBI (https: / / www.ncbi.nlm.nih.gov / ). A phylogenetic tree was then constructed using the Neighbour Joining (NJ) method with MEGA 6.0 software (Tamura et al., 2013). The phylogenetic tree was then refined using the online enhancement tool Itol (https: / / itol.embl.de / ). Further analysis of conserved domains in the CCE amino acid sequences was performed using the online tool ESPript 3.0.

[0082] (https: / / espript.ibcp.fr / ESPript / cgi-bin / ESPript.cgi) Beautification.

[0083] 2.5 Target gene cloning

[0084] Primers specific to the target gene were designed using Primer Premier 5.0 software; primer information is shown in Table 6. Using the cDNA synthesized by PCR in section 3.2.4 as a template, the target gene was cloned using the 2×Phanta@Max Matser Mix (Vazyme) kit. After the PCR amplification reaction, the quality was assessed using 1% agarose gel electrophoresis. The GelDNAExtraction Mini Kit (Vazyme) is used to excise and recover the obtained cloned products.

[0085] Table 6 Primer information for the CCE gene of *Pseudomonas citrus*

[0086] Primer name Primer sequence (5'-3') SEQ ID NO Pst I-PcCCE11-F ttcaagcttgtcgacctgcagATGAATGACAATCCAATAGTGAATACG SEQ ID NO.15 Xba I-PcCCE11-R agcagagattacctatctagaTTAATTGATTGATTTAAGGTCTATGGTTAC SEQ ID NO.16 Pst I-PcCCE7-F ttcaagcttgtcgacctgcagATGTCTATTCGTCCGTTAGTAACTACTCG SEQ ID NO.17 Xba I-PcCCE7-R agcagagattacctatctagaTTAGTTTTCGAGTGGAAATTGATAATC SEQ ID NO.18

[0087] 2.6 Double digestion of prokaryotic expression vector

[0088] Bioxm 2.7.1 software was used to analyze the restriction enzyme sites of candidate genes, and different restriction enzyme sites were selected based on the restriction enzyme sites on the pCold-SUMO vector. A double-enzyme digestion system was selected, and samples were loaded on ice. The rapid digestion reaction mixture consisted of 4 μg pCold-SUMO vector, 2.5 μL rapid digestion enzyme 1, 2.5 μL rapid digestion enzyme 2, 5 μL 10× buffer, and RNase-free H2O to a final volume of 50 μL. The mixture was vortexed and centrifuged at 37°C for 3 h in a metal bath. After digestion, the reaction products were subjected to agarose gel electrophoresis and gel recovery. The recovered products were stored at -40°C.

[0089] 2.7 Homologous recombination and transformation

[0090] The candidate target gene and linearized vector were added to the ClonExpress Ultra One Step Cloning Kit V2 (Vazyme) for homologous recombination ligation. The homologous recombination reaction mixture consisted of 1 μL of the insert fragment, 1 μL of the linearized vector, 5 μL of 5×CE Mix, and ddH2O to a final volume of 10 μL. The mixture was vortexed and incubated in a 50°C metal bath for 5 min.

[0091] The transformation of the recombinant product was performed according to the kit instructions. After transformation, centrifuge at 2,500×g for 3 min, discard 900 μL of supernatant, resuspend the remaining bacterial culture, and spread it evenly on LB solid medium (containing antibiotics) plates with a sterile spreader. After absorption for 5 min, incubate upside down in a 37℃ incubator for 12–14 h.

[0092] 2.8 Identification by bacterial culture PCR and sequencing

[0093] Using a 10 μL pipette or sterile toothpick, pick single colonies from the above-mentioned plate and transfer them to a sterile PCR tube containing 10 μL of ddH2O. Mix thoroughly by pipetting and regurgitation. Use 2 μL as template for PCR amplification and detection, following the same amplification method. Transfer the remaining 8 μL to a 1.5 mL sterile centrifuge tube containing 1 mL of LB medium (containing antibiotics) and incubate at 37°C and 220 rpm for 3–6 hours. Detection requires gel electrophoresis. If the target band is present, send the sample to BGI Genomics or KIST Biotechnology for sequencing identification.

[0094] 2.9 Extraction of Recombinant Plasmids

[0095] Plasmids were extracted using the EndoFree Mini Plasmid Kit II (Tiangen) according to the instructions.

[0096] 2.10 Prokaryotic expression and SDS-PAGE detection

[0097] The recombinant plasmid containing the target gene fragment was transformed into Rosetta(DE3) chemocompetent cells, and subsequent procedures were as described in 3.2.10. 500 μL of bacterial culture, successfully identified and sequenced by bacterial culture PCR, was transferred to 100 mL of LB medium containing ampicillin and chloramphenicol. The bacterial culture was cultured at 37°C and 220 rpm until the OD600 reached 0.6–0.8. Then, IPTG was added to the bacterial culture to a final concentration of 0.1 mM to induce protein expression. The culture was then incubated overnight at 15°C and 180 rpm for 8–12 h.

[0098] The overnight induced bacterial culture was lysed to collect the target protein. To determine whether the target protein was expressed in the supernatant as a soluble protein, SDS-PAGE electrophoresis was performed to confirm the target band.

[0099] 2.11 Western Blotting

[0100] To further confirm whether the target band size corresponds to the expressed target protein, the sample needs to be used for Western blotting.

[0101] 2.12 Recombinant protein purification and buffer replacement

[0102] After confirming that the target protein was successfully expressed in the supernatant by SDS-PAGE gel electrophoresis and Western blotting, the obtained supernatant was purified by Ni-NTA6FF pre-packed gravity column to remove impurities and obtain recombinant protein containing the His tag.

[0103] 2.13 CCEs Recombinant Protein Activity Assay

[0104] 2.13.1 Plotting Standard Curves for Bovine Serum Protein and α-Naphthol

[0105] 2.13.2 Determination of recombinant protein content and CCEs activity

[0106] 2.14 Recombinant protease kinetic analysis

[0107] Different concentrations of α-naphthyl acetate (0.01 mol / L, 0.05 mol / L, 0.1 mol / L, 0.5 mol / L, 1 mol / L, 1.5 mol / L, and 2 mol / L) were diluted with 0.04 mol / L PBS (pH 7.4) as substrates. The enzyme kinetic parameters (Km) and maximum reaction rate (Vmax) of the purified recombinant protein were determined. Three biological replicates were set up, and Km and Vmax were calculated using GraphPad Prism 10.2 software.

[0108] 2.15 In vitro metabolic assay of recombinant protein against acaricides

[0109] The direct metabolic capacity and mechanism of action of recombinant protein on acaricides were determined by in vitro metabolic experiments. The metabolic efficiency was calculated by detecting the acaricide residue in the reaction system using liquid chromatography-mass spectrometry (LC-MS).

[0110] 2.15.1 Plotting the Standard Curve for Acaricides

[0111] Acaricide standards were dissolved in acetonitrile to prepare a stock solution, which was then diluted with acetonitrile to prepare six concentrations. ≥500 μL of each diluted solution was filtered through a 0.22 μm organic filter membrane and transferred to brown test vials. High-performance liquid chromatography (HLPC) was used to detect different concentrations of acaricides, with three replicates for each concentration. A standard curve for the acaricide standards was plotted with the peak area as the Y-axis and the acaricide concentration (mg / L) as the X-axis.

[0112] 2.15.2 Determination of recombinant protein metabolism to acaricides

[0113] The ability of purified recombinant protein to metabolize acaricides in vitro was determined by HPLC. A total of 600 μL of acaricide (final concentration of 50 mg / L), recombinant protein (10 μg, 20 μg and 40 μg), and 0.04 mol / L PBS (pH 7.4) buffer were added to enzyme-free centrifuge tubes and the reaction was carried out according to the system in Table 7.

[0114] Table 7 Reaction system of recombinant protein metabolic acaricide

[0115]

[0116]

[0117] After the reaction was completed, 600 μL of acetonitrile was added to the above reaction solution to terminate the metabolic reaction. The mixture was vortexed for 5 min and centrifuged at 4℃ and 14,000×g for 10 min. Then, ≥500 μL of the supernatant (filtered through a 0.22 μm organic filter membrane) was transferred to a brown detection bottle. The acaricides were separated using a Sun Fire C18 (3.5 μm, 4.6 mm × 150 mm) reversed-phase analytical column with an injection volume of 10 μL, a flow rate of 1 mL / min, and a column temperature of 30℃. Spirodiclofen and etoxazole were separated by an elution gradient of 80% A: 20% B (A is acetonitrile, B is ultrapure water), and abamectin was separated by an elution gradient of 85% A: 15% B (A is methanol, B is ultrapure water). The elution of the acaricides was detected by absorbance at 245 nm. To further clarify the in vitro metabolic capacity of the recombinant protein, in addition to the control group containing inactivated protein, an extra control group (using the same reaction system but without the addition of recombinant protein) was set up to eliminate the influence of acaricide autodegradation. Each treatment was performed in triplicate. The peak areas measured in the experiment were substituted into the acaricide standard curve, and the metabolic rate was calculated.

[0118] 2.16 Identification of acaricide metabolites

[0119] To better identify the metabolites, the recombinant protein concentration was increased to 40 μg for mass spectrometry detection. The reaction method was the same as described in 3.2.20.2, and an Agilent 1290 Infinity LC / 6530Q-TOF MS system was used for metabolite analysis. An Eclipse Plus C18RRHD (1.8 μm, 2.1 mm × 50 mm) reversed-phase analytical column was used to separate the acaricide. The column temperature was 40 °C, the injection volume was 5 μL, the mobile phase A was methanol, and B was 0.1% formic acid in water. The gradient elution program was 0–15 min, 20% B, the flow rate was 0.3 mL / min, the nebulizer pressure was 30 psig, the capillary voltage was 3500 V, the dry gas temperature was 350 °C, the drying gas flow rate was 10 L / min, and the collision energy was set to 30 eV. Metabolite nomenclature was based on the InDrawforWeb website (https: / / indrawforweb.integle.com / ).

[0120] 2.17 3D Modeling and Molecular Docking

[0121] Molecular docking was used to assist in the analysis of the binding mechanisms of the protein with the acaricides avermectin and spirodiclofen. Based on the amino acid sequences of the target genes, homology modeling was performed using SWISS-MODEL (https: / / swissmodel.expasy.org / ) and AlphaFold (https: / / alphafold.com / ). Three-dimensional models of avermectin and spirodiclofen were downloaded from Chemical Book (https: / / www.chemicalbook.com / ProductIndex.aspx) and PubChem (https: / / pubchem.ncbi.nlm.nih.gov / ). The target gene protein structure was molecularly docked with the three acaricides using AutoDock (vina) software, and the optimal docking result was selected based on the free energy of the alignment and the mode of action. Visualized images of the structures were generated using LigPlot+ v.2.2.9 and PyMOL 2.2.0 (Janson et al., 2017).

[0122] 2.18 Determination of IC50 of Recombinant Protein Inhibitory Concentration

[0123] Using α-naphthyl acetate at a Km concentration as a substrate, the acaricide standard was diluted with 0.04 mol / L PBS (pH 7.4) buffer to obtain different concentrations (0–5 mM). The median inhibitory concentration (IC50) of the purified recombinant protein was determined. Three replicates were set up, and IC50 data were analyzed using GraphPad Prism 10.2 software.

[0124] 2.19dsRNA Synthesis and Purification

[0125] RNAi primers containing the T7 RNA polymerase promoter (prefixed with "taatacgactcactataggg") were designed using Primer Premier 5.0 software. Specific primer information is shown in Table 8. eGFP (NCBI: JQ064510) was used as an experimental control; the amplification method and system for the target fragment PCR were the same as before.

[0126] Table 8. Primer information for dsRNA target fragment amplification

[0127]

[0128] After amplification, the interference target fragment was extracted and recovered using the FastPure Gel DNA Extraction Mini Kit. The concentration and quality of the product were monitored using a NanoDrop 2000. Once the product met the quality standards, dsRNA synthesis was performed. The target fragment recovered in the previous step was synthesized into dsRNA using the TranscriptAid T7 High Yield Transcription Kit. Using the gel-recovered product from the previous step as a template, the following reagents were added stepwise to an enzyme-free PCR tube to prepare the synthesis system: 1 μg target fragment, 2 μL each of ATP / GTP / CTP / UTP, 2 μL TranscriptAid Enzyme Mix, 4 μL 5×TranscriptAid Reaction Buffer, and DEPC to a final volume of 20 μL. After mixing, the mixture was briefly centrifuged and incubated at 37°C for 6 h in a PCR instrument with the cap temperature set to 60°C. The synthesized dsRNA was then purified.

[0129] 2.20dsRNA feeding

[0130] Following the method of Feng Kaiyang et al., dsRNA was delivered using a leaf dish dsRNA feeding method (Feng Kaiyang, 2017; Feng Kaiyang, 2020). The procedure was as follows: Citrus paris mites were collected and placed in disposable culture dishes. The lids were inverted to prevent escape, and the dishes were then placed in an incubator for 12 hours to starve the mites. Freshly collected citrus leaves were cleaned, cut into squares approximately 2 cm², and dehydrated at 50°C for 5 minutes until the leaves turned slightly yellow. Simultaneously, dsRNA was thawed beforehand. Then, 60 μL of dsRNA solution was evenly dropped onto the underside of the citrus leaves, and the leaves were weighed down with heavy weights for approximately 12 hours to ensure complete absorption of the dsRNA by the leaves.

[0131] Citrus leaves soaked in dsRNA were used to make leaf discs. Citrus paronychia mites that had been starved for 12 hours were then transferred onto the leaf discs, and finally the leaf discs were placed in an incubator and cultured for 24 hours.

[0132] 2.21 RNAi silencing efficiency detection

[0133] Citrus psyllids treated with dsRNA were collected, and RNA was extracted and reverse transcribed into first-strand cDNA. Citrus psyllids fed with dseGFP were used as a control. Three replicates were set up, and the silencing efficiency of RNAi was evaluated by detecting changes in the mRNA of the target gene using RT-qPCR.

[0134] 2.22 CCEs activity assay after RNAi

[0135] We collected *Pterocarya cirrhosa* after dsRNA treatment, measured the CCEs activity of *Pterocarya cirrhosa* after RNAi, and used *Pterocarya cirrhosa* fed with dseGFP as a control, setting up 3 biological replicates.

[0136] 2.23 RNAi-induced acaricide susceptibility assay

[0137] We collected *Pterocarya citrinum* mites treated with dsRNA and determined the changes in their sensitivity to acaricides after RNAi. *Pterocarya citrinum* mites fed with dseGFP were used as a control, and three biological replicates were set up.

[0138] 3 Results

[0139] 3.1 Toxicity determination of three acaricides for Citrus citrus parvovirus

[0140] The LC50 values ​​of abamectin against the susceptible strain (SS) and the multi-resistant strain (CoR-NN) of *Paecilomyces citrus* were 0.78 mg / L and 355.14 mg / L, respectively, with a resistance ratio (RR) of 455.31. The LC50 values ​​of spirodiclofen and etoxazole against SS were 41.33 mg / L and 20.29 mg / L, respectively. The LC50 values ​​of spirodiclofen and etoxazole against CoR-NN were both greater than 20,000 mg / L, with resistance ratios (RR) greater than 483.91 and 985.70, respectively. Specific results are shown in Table 9. *Paecilomyces citrus* CoR-NN exhibited extremely high resistance levels to abamectin, spirodiclofen, and etoxazole.

[0141] Table 9. Toxicity determination of acaricides against Citrus psyllid SS and CoR-NN.

[0142]

[0143] 3.2 Determination of crude enzyme activity of CCEs in Citrus psyllids

[0144] The regression equation for the bovine serum albumin standard curve is Y = 0.005x + 0.0017, R² = 0.9959. The regression equation for the α-naphthol standard curve is Y = 53.738x + 0.1621, R² = 0.9916. Based on the standard curves and the measured OD values, the content of proenzyme protein and the specific activity of CCEs in citrus psyllids can be calculated.

[0145] Crude enzyme solutions of adult female citrus parsnipae SS and CoR-NN mites were extracted separately. The results of CCEs enzyme activity assay are as follows: Figure 1As shown, the specific activities of crude CCEs in SS and CoR-NN were 3.99±0.11 μmol / mg / min and 12.39±0.29 μmol / mg / min, respectively, and the specific activity of crude CCEs in CoR-NN was 3.11 times that in SS. These results indicate that the increased CCE activity may be related to the resistance of the citrus psyllid to abamectin.

[0146] 3.3 Analysis of CCE gene expression pattern in Citrus psyllids

[0147] 3.3.1 Analysis of CCE gene expression patterns at different developmental stages

[0148] Six differentially expressed CCE genes (EVM0001466, EVM0002296, EVM0002806, and EVM0005255 upregulated, and EVM0003530 and EVM0009195 downregulated) were screened based on transcriptome data. Specific annotation information is shown in Table 10. The relative expression levels of the six CCE genes at different developmental stages in SS and CoR-NN were detected by RT-PCR, with the expression levels of the six CCE genes in the control SS set to 1 for relative expression calculation. In CoR-NN, EVM0001466 and EVM0005255 were significantly upregulated in all four developmental stages (egg, larva, nymph, and adult). Figure 2 Furthermore, compared to the SS strain, the relative expression levels of EVM0001466 in CoR-NN across the four developmental stages—egg, larva, nymph, and adult—were 5.33 times (egg), 22.23 times (larva), 2.86 times (nymph), and 3.64 times (adult) of SS, respectively. Figure 3 The relative expression levels of EVM0005255 at the four developmental stages—egg, larva, nymph, and adult—were 4.93 times (egg), 134.60 times (larva), 7.65 times (nymph), and 12.89 times (adult) of SS, respectively. Figure 3 EVM0002296 and EVM0002806 were significantly upregulated in the egg, larva, and nymph developmental stages, but EVM0003530 and EVM0009195 were not significantly downregulated in the egg and nymph developmental stages. Figure 2 The results above suggest that EVM0001466 and EVM0005255 may be associated with cross-resistance to abamectin, spirodiclofen, and etoxazole in *Pteris vittata*. Therefore, EVM0001466 and EVM0005255 were selected for further functional analysis.

[0149] Table 106 Annotation Information for Differentially Expressed Carboxylesterase Genes

[0150]

[0151] 3.3.2 Expression pattern analysis of candidate CCE genes under different induction time treatments

[0152] The mRNA expression levels of EVM0001466 and EVM0005255 were detected at different time points (6h, 12h, 24h, 48h, and 72h) after treatment with near LC50 concentration (350 mg / L) of abamectin and nymphal treatment with near LC10 concentration (5000 mg / L) of spirodiclofen and etoxazole. Figure 4 After 6 hours of treatment with avermectin, the expression level of EVM0001466 was lower than that of CK, and its expression level was significantly upregulated from 12 to 72 hours, with the highest fold increase of 17.49 at 24 hours; the expression level of EVM0005255 gradually increased from 6 to 24 hours, with the highest fold increase of 12.87 at 24 hours. Figure 4 A, B). Within 6–12 hours of spirodiclofen treatment, the expression level of EVM0001466 showed no significant change compared to CK, but was significantly upregulated within 24–72 hours, with the highest fold increase (6.93-fold) at 48 hours; the upregulation level of EVM0005255 at 24 hours was 8.29-fold higher than that of CK. Figure 4 C, D). After 6 h of etoxazole treatment, the expression level of EVM0001466 was lower than that of CK. Both EVM0001466 and EVM0005255 showed the highest upregulation at 24 h, at 3.52-fold and 6.37-fold respectively. Figure 4 E,F).

[0153] 3.4 Bioinformatics Analysis of CCE Genes in Citrus Paronychia

[0154] 3.4.1 Sequence and physicochemical property analysis of PcCCE11 and PcCCE7

[0155] Based on transcriptomic data and published genome databases, EVM0001466 and EVM0005255 were named PcCCE11 and PcCCE7, respectively. Gene sequence analysis revealed that the sequence lengths of PcCCE11 (SEQ ID NO. 1) and PcCCE7 (SEQ ID NO. 2) were 1680 bp and 1620 bp, respectively, encoding 559 and 539 amino acids. Their theoretical isoelectric points were 5.96 and 6.06, and their protein molecular weights were 63.31 kDa and 60.33 kDa, respectively. Analysis of the protein signal peptide and transmembrane domains showed that both PcCCE11 and PcCCE7 possess signal peptides. The signal peptide sequence was found in amino acids 1-24 of PcCCE11 and amino acids 1-17 of PcCCE7. No transmembrane domains were found.

[0156] 3.4.2 Sequence alignment and phylogenetic analysis of PcCCE11 and PcCCE7

[0157] A simple sequence alignment and phylogenetic analysis were performed on the amino acid sequences of PcCCE11 and PcCCE7 with 48 CCE genes from other arachnid species. Partial sequence alignment results showed that all these genes possess the highly conserved α / β hydrolases typical of carboxylesterases, namely GG, Gly-x-Ser-x-Gly, and a conserved catalytic triplet SEH active site composed of serine (Ser, S), glutamate (Glu, E), and histidine (His, H). Only in the two-spotted spider mite XP_015793567.1 was the catalytic triplet SEH replaced by SDH, with glutamate replaced by aspartic acid (Asp, D). Phylogenetic tree analysis showed that ( Figure 5 The citrus pseudomorph PcCCE11 is most closely related to the two-spotted spider mite XP_015791166.1 and XP_015791040.1, and clusters in the same Class 2 group and Clade E branch; the citrus pseudomorph PcCCE7 is most closely related to the two-spotted spider mite XP_015793534.1 and XP_015792994.1, and clusters in the same Class 3 group and Clade J branch (Tschesche et al., 2021).

[0158] Based on the phylogenetic tree results, the amino acid sequences of XP_015791166.1, XP_015791040.1, XP_015793534.1, and XP_015792994.1 were further analyzed using multidimensional sequence alignment. Partial sequence alignment results showed that the SEH active sites of the conserved catalytic triplet PcCCE11 are Ser-207, Glu-344, and His-452, while the SEH active sites of the conserved catalytic triplet PcCCE7 are Ser-219, Glu-363, and His-469. Analysis of the secondary and tertiary structures of PcCCE11 and PcCCE7 revealed that both possess the typical structural characteristics of a carboxylesterase family, consisting of multiple parallel β-sheets and α-helices. Both have a total of 17 α-helices and 20 β-sheets in their tertiary structures.

[0159] 3.5 Prokaryotic expression proteins of PcCCE11 and PcCCE7 in the citrus parrot mite

[0160] 3.5.1 Expression of PcCCE11 and PcCCE7 proteins

[0161] PcCCE11 and PcCCE7 proteins were expressed using an E. coli prokaryotic expression system. The results showed that the predicted molecular weights of PcCCE11 and PcCCE7 proteins were 74.5 kDa and 71.5 kDa, respectively, while the SDS-PAGE results... Figure 6 A distinct band was observed near 70 kDa in both the precipitate and supernatant in samples A and B. Purified SDS-PAGE results showed a single target band of the correct size. Further analysis using Western blotting... Figure 6 C) It was found that the target bands of PcCCE11 and PcCCE7 proteins were still clear and distinct, and the molecular weight was correct, indicating that soluble recombinant PcCCE11 and PcCCE7 proteins could be successfully obtained by prokaryotic expression.

[0162] 3.5.2 Determination of activity and kinetic parameters of recombinant proteins PcCCE11 and PcCCE7

[0163] The specific activities of the purified recombinant proteins PcCCE11 and PcCCE7 are shown in Table 11. The specific activities of PcCCE11 and PcCCE7 were 164.04±40.68 nmol / mg / min and 512.14±60.73 nmol / mg / min, respectively. The enzyme kinetic parameters Km values ​​were 0.52±0.02 mM and 0.46±0.08 mM, respectively, and Vmax values ​​were 582.80±29.19 nmol / mg / min and 588.00±32.07 nmol / mg / min, respectively. These results indicate that the recombinant proteins PcCCE11 and PcCCE7 possess carboxylesterase activity.

[0164] Table 11 Specific activity and enzyme kinetic parameters of recombinant proteins PcCCE11 and PcCCE7

[0165]

[0166] 3.6 Analysis of the metabolic capacity of recombinant PcCCE11 and PcCCE7 proteins to three acaricides

[0167] The regression equations for abamectin, spirodiclofen, and etoxazole were y = 0.1565x + 0.528 (R² = 0.9963), y = 0.1193x - 0.039 (R² = 0.9997), and y = 0.0593x - 0.0128 (R² = 0.9997), respectively. All three standards showed good linear relationships between their concentrations and peak areas. Therefore, the actual content of the acaricide in the samples was calculated using the standard curves of abamectin, spirodiclofen, and etoxazole.

[0168] The results of HPLC determination of the metabolism of three acaricides by recombinant PcCCE11 and PcCCE7 proteins are shown in Table 12. The elution times for the three acaricides were 10.1 min, 6.1 min, and 6.5 min, respectively. Figure 7 In the control group (CK), avermectin showed a slight autodegradation rate (5.90%), but its metabolic rate increased after the addition of 10 or 20 μg of PcCCE11 and PcCCE7 proteins. After adding 10 μg of PcCCE11 and PcCCE7 proteins, the metabolic rates of avermectin were 7.71% and 11.57%, respectively; after adding 20 μg of PcCCE11 and PcCCE7 proteins, the metabolic rates were 20.12% and 18.57%, respectively. Spirodiclofen also showed a slight autodegradation rate (7.02%) in the CK, but its metabolic rate significantly increased after the addition of 10 or 20 μg of PcCCE11 and PcCCE7 proteins. After adding 10 μg of PcCCE11 and PcCCE7 proteins, the metabolic rates of spirodiclofen were 17.87% and 15.28%, respectively; after adding 20 μg of PcCCE11 and PcCCE7 proteins, the metabolic rates of spirodiclofen were 33.55% and 39.94%, respectively. Etoxazole showed no self-degradation rate in the control group (CK), and the metabolic rate of etoxazole did not change significantly after adding 10 or 20 μg of PcCCE11 and PcCCE7 proteins. Chromatographic results of avermectin, spirodiclofen, and PcCCE11 and PcCCE7 proteins were compared between the CK and treatment groups. Figure 7 The peak areas of avermectin metabolites (elution time 5-7 min) and spirodiclofen metabolites (elution time 3-4 min) were found to be higher in the treatment group than in the control group.

[0169] Table 12 Metabolism of acaricides by different concentrations of recombinant PcCCE11 and PcCCE7 proteins

[0170]

[0171] Note: CK: 1200 μL acetonitrile + 10 mg / L acaricide; PBS: 1200 μL 0.04 M PBS + 10 mg / L acaricide; CK1: 10 μg inactivated recombinant protein; CK2: 20 μg inactivated recombinant protein. The autodegradation rate of the acaricide was calculated using the formula (CK concentration - PBS concentration) / CK concentration. Metabolometry was calculated as: (treatment concentration - CK1 or CK2 concentration) / CK1 or CK2 concentration. Different letters indicate statistically significant differences (p < 0.05).

[0172] 3.7 Identification of metabolites of avermectin and spirodiclofen

[0173] To confirm that recombinant proteins PcCCE11 and PcCCE7 can interact with avermectin and spirodiclofen, the metabolites of avermectin and spirodiclofen were subsequently identified using an HPLC-MS / MS system.

[0174] 3.7.1 Identification of avermectin metabolites

[0175] The relative molecular weight of avermectin is 873 g / mol. Positive ion mode mass spectrometry of its metabolites showed that the ion peak of the avermectin parent compound was detected at m / z 895.4873 [M+Na]+ in both the PcCCE11 and PcCCE7 recombinant protein CK groups. However, only the PcCCE11 recombinant protein treatment group showed a metabolite ion peak at m / z 911.4692 [M1+Na]+. The chemical structure of this peak is formed by the ester bond cleavage of avermectin through hydrolysis; therefore, the ion peak is about 16 m / z higher than the corresponding peak of the parent compound. The response values ​​of the parent compound and metabolite ion peaks in the PcCCE7 recombinant protein treatment group were extremely low.

[0176] According to the positive ion mode secondary mass spectrometry of avermectin metabolites, two ion peaks were observed: m / z 767.0936 [M3+Na]+ and 624.6593 [M5+Na]+. Based on the reported degradation pathway of avermectin, the possible molecular structures of metabolites M3 and M5 were inferred. M3 and M5 are likely product ion peaks formed by the loss of one (144 Da) or two (2 × 144 Da) pyranose rings from the original macrocyclic structure of avermectin, respectively. The ion peak with the loss of one pyranose ring is the predominant form, while the ion peak with the loss of two pyranose rings is the predominant fragmentation form. M2 and M3, M4 and M5 are all derived from M1, while M6 and M7 are derived from the molecular structure of M5. The high response values ​​of m / z 289.977 [M4+H]+, 281.8881 [M6+H]+, and 323.2393 [M7+H]+ in the secondary mass spectrometry further confirm that the loss of two pyranose rings is the main degradation pathway of avermectin metabolites (Gianelli et al., 2000; Cheng and Liu, 2014; Riga et al., 2014).

[0177] The above results indicate that the recombinant protein PcCCE11 can hydrolyze the ester bond of avermectin to generate hydrolysate (M1): 1,18-hydrolyzed avermectin-3-[(1E,2E,6E)-8-[2-(but-2-yl)-10-hydroxy-3-methyl-1,7-dioxaspiro[5.5]undec-4-en-8-yl]-5-({5-[(5-hydroxy-4-methoxy-6-methyl-3,4,5,6-tetrahydro-2H-pyran-2-yl)-3-[(5-hydroxy-4-methoxy-6-methyl-3,4,5,6-tetrahydro-2H-pyran-2 ... [-yl)oxy]-4-methoxy-6-methyl-3,4,5,6-tetrahydro-2H-pyran-2-yl]oxy]-4,6-dimethyloctyl-2,6-dieneylidene]-3a,7-dihydroxy-6-methyl-2,3,3a,4,7,7a-hexahydrocyclohexano[1,2-b]furan-4-carboxylic acid directly participates in the metabolism of avermectin, while the recombinant protein PcCCE7 may participate in the metabolism of the acaricide avermectin through isolation or chelation. 3.7.2 Identification of Spirodiclofen Metabolites

[0178] The relative molecular weight of spirodiclofen is 411 g / mol. Positive ion mode mass spectrometry of its metabolites showed that the ion peak of the parent compound of avermectin was detected in both the PcCCE11 and PcCCE7 recombinant protein CK groups at m / z 433.2665 ([M+Na]+). Furthermore, the metabolite ion peaks of m / z 335.2108 ([M1+Na]+) and m / z 138.0898 ([M2+Na]+) were detected in both treatment groups. These two ion peaks represent the ester bond cleavage of the parent compound spirodiclofen after hydrolysis, generating the main products spirodiclofen enol (M1) and 2,2-dimethylbutyric acid (M2). Positive ion mode mass spectrometry of spirodiclofen enol (M1), the main metabolite of spirodiclofen, revealed three high-response ion peaks: m / z 322.0956 [M4+H]+, m / z 84.9638 [M6+H]+, and m / z 186.9098 [M8+H]+. Based on the reported degradation pathway of spirodiclofen enol, the possible molecular structures of metabolites M4, M5, M6, M7, and M8 were deduced. M5 originated from the M2 molecular structure, while M4, M6, M7, and M8 originated from the M1 molecular structure (Tian et al., 2021; Dos Anjos et al., 2024; Yang et al., 2024). These results indicate that recombinant proteins PcCCE11 and PcCCE7 can hydrolyze the ester bonds of spirodiclofen to generate spirodiclofen enol (M1) and 2,2-dimethylbutyric acid (M2). Recombinant proteins PcCCE11 and PcCCE7 participate in the metabolism of the acaricide spirodiclofen through hydrolysis. 3.8 Inhibitory effect of the acaricide on recombinant proteins PcCCE11 and PcCCE7.

[0179] Using α-naphthyl acetate at a Michaelis constant (Km) concentration as a substrate, the median concentration (IC50) of avermectin and spirodiclofen against PcCCE11 and PcCCE7 was determined. The results, shown in Table 13, indicate that the median IC50s for avermectin and spirodiclofen against recombinant PcCCE11 protein were 3.74 ± 0.39 mM and 1.07 ± 0.09 mM, respectively. The IC50 for spirodiclofen against recombinant PcCCE7 protein was 0.89 ± 0.04 mM. However, avermectin at concentrations between 0.25 and 2.5 mM showed inhibition rates of 70%–80% against the recombinant PcCCE7 protease activity, making the IC50 for avermectin against PcCCE7 protein impossible to calculate. These results indicate that the acaricides avermectin and spirodiclofen have a certain inhibitory effect on the ability of recombinant proteins PcCCE11 and PcCCE7 to bind to the catalytic substrate α-naphthyl acetate and generate α-naphthol.

[0180] Table 13 IC50 of avermectin and spirodiclofen against PcCCE11 and PcCCE7

[0181]

[0182] 3.9 RNAi study of the CCE gene in the citrus paris mite

[0183] 3.9.1 Silencing Efficiency Detection of PcCCE11 and PcCCE7

[0184] The results of RT-qPCR detection of changes in mRNA transcription levels after RNAi are as follows: Figure 8 As shown in AB, compared with the water treatment control, the expression levels of PcCCE11 and PcCCE7 in CoR-NN were significantly reduced by 53.90% (P<0.01) and 58.52% (P<0.001), respectively, indicating that the expression levels of PcCCE11 and PcCCE7 in CoR-NN could be successfully interfered by the leaf dish feeding method.

[0185] 3.9.2 Determination of susceptibility to acaricides after interference with PcCCE11 and PcCCE7

[0186] The results of CoR-NN sensitivity to avermectin, spirodiclofen, and etoxazole after RNAi are as follows: Figure 8As shown in CH, after feeding dsPcCCE11, the LC50 of abamectin against adult female CoR-NN mites decreased from 354.64 mg / L to 287.18 mg / L (P<0.05), the mortality rate of CoR-NN nymphs under spirodiclofen treatment increased from 11.66% to 24.94% (P<0.01), and the mortality rate of CoR-NN nymphs under etoxazole treatment increased from 10.32% to 15.63% (P<0.01); after feeding dsPcCCE7, the LC50 of abamectin against adult female CoR-NN mites decreased from 354.64 mg / L to 287.18 mg / L (P<0.05), the mortality rate of CoR-NN nymphs under etoxazole treatment increased from 10.32% to 15.63% (P<0.01); The LC50 of adult mites decreased from 354.64 mg / L to 235.36 mg / L (P<0.001). The mortality rate of CoR-NN nymphs under spirodiclofen treatment increased from 11.66% to 39.34% (P<0.0001), and the mortality rate of CoR-NN nymphs under etoxazole treatment increased from 10.32% to 19.60% (P<0.001). This indicates that the reduction in the expression levels of PcCCE11 and PcCCE7 can significantly enhance the sensitivity of *Pteris multifiliis* to abamectin, spirodiclofen, and etoxazole. 3.9.3 Detection of CCEs enzyme activity after interfering with PcCCE11 and PcCCE7

[0187] After interfering with PcCCE11 expression, the specific activity of crude CCEs in CoR-NN decreased from 13.05±0.31 μmol / mg / min to 6.52±0.23 μmol / mg / min, and the total CCEs enzyme activity decreased significantly by approximately 0.50-fold (P<0.0001); after interfering with PcCCE7 expression, the specific activity of crude CCEs in CoR-NN decreased from 10.61±0.53 μmol / mg / min to 5.26±0.11 μmol / mg / min, and the total CCEs enzyme activity decreased significantly by 0.48-fold (P<0.001). Figure 9 The results indicate that changes in the expression levels of PcCCE11 and PcCCE7 affect the total crude enzyme activity of carboxylesterase in citrus psyllids.

[0188] 4 Analysis

[0189] The citrus psyllid is difficult to control due to its high susceptibility to acaricide resistance. Populations of the citrus psyllid from multiple citrus-producing regions around the world have developed resistance to abamectin, spirodiclofen, and etoxazole (Lin et al., 2009; Dou et al., 2017; Wei et al., 2019; Cheng et al., 2022). (et al., 2023). In this study, the field population of *Paecilomyces citrus* (CoR-NN) in Nanning, Guangxi, developed high levels of resistance to all three acaricides. This study found that the CCE genes PcCCE11 and PcCCE7 are overexpressed in *Paecilomyces citrus* CoR-NN, and their expression may be regulated. Functional analysis confirmed that their overexpression participates in the formation of cross-resistance in *Paecilomyces citrus*. In vitro metabolic data showed that the carboxylesterase PcCCE11 can directly metabolize avermectin by hydrolyzing ester bonds, and PcCCE11 and PcCCE7 can directly metabolize spirodiclofen by hydrolyzing ester bonds, indicating that PcCCE11 and PcCCE7 play important roles in the formation of cross-resistance in *Paecilomyces citrus*.

[0190] 4.1 CCEs activity of Citrus psyllids

[0191] The carboxylesterase (CCE) activity of the CoR-NN polyresistant strain in this study was significantly increased compared with the SS-sensitive strain, suggesting that the increased CCE activity of *Pteris vittata* may be involved in the formation of its cross-resistance to abamectin, spirodiclofen, and etoxazole.

[0192] 4.2 Expression pattern of CCE gene after citrus pardophylloxera acaricide stress

[0193] Identifying candidate genes is fundamental to studying the molecular mechanisms of acaricide resistance. Exposure to acaricides in mites typically leads to upregulation of detoxification genes (including CCEs), enhancing acaricide metabolism (Lee et al., 2006; Wang et al., 2018). In this study, PcCCE11 and PcCCE7 were highly expressed in eggs, larvae, nymphs, and adults. This is similar to the cross-resistance characteristics observed during developmental stages after the combined use of three acaricides: avermectin, spirodiclofen, and etoxazole. This indicates that PcCCE11 and PcCCE7 play a greater role in the cross-resistance of avermectin, spirodiclofen, and etoxazole in *Pteris vittata*. Therefore, further functional analysis of PcCCE11 and PcCCE7 is necessary. Following treatment with avermectin, spirodiclofen, and etoxazole, both PcCCE11 and PcCCE7 showed significantly high expression levels at 24 or 48 hours, suggesting this may be a crucial period for the formation of acaricide resistance mediated by these two genes. Furthermore, after 6 hours of treatment with etoxazole and avermectin on CoR-NN, PcCCE11 showed varying degrees of downregulation followed by upregulation. The different expression changes of the carboxylesterase genes PcCCE11 and PcCCE7 under different acaricide stresses indicate the presence of certain transcription factors or other regulatory mechanisms involved in their regulation. Therefore, the transcriptional regulatory mechanisms of PcCCE11 and PcCCE7 require further elucidation.

[0194] 4.3 In vitro metabolite acaricides containing PcCCE11 and PcCCE7 proteins of the citrus paronychia mite

[0195] Prokaryotic expression of recombinant proteins and in vitro drug metabolism can serve as an important research tool for analyzing the interaction between detoxification metabolic enzyme genes and acaricides (Wang Mengyao, 2018). Carboxylesterases mainly achieve detoxification by directly binding to exogenous substances and hydrolyzing acaricides with special groups (such as carboxyl ester bonds, phosphate ester bonds, and amide ester bonds) (Gong et al., 2017; Lu et al., 2022).

[0196] This invention, based on the successful acquisition of recombinant proteins PcCCE11 and PcCCE7 with carboxylesterase activity, also demonstrated through HPLC and HPLC-MS detection that the recombinant proteins PcCCE11 and PcCCE7 can effectively metabolize avermectin and spirodiclofen. Based on the reported degradation pathway of avermectin, the possible molecular structures of the metabolites were inferred. The ion peaks of the original macrocyclic structure of avermectin with the loss of one pyranose ring were the main form, while the ion peaks of the loss of two pyranose rings were the main fragmentation forms. The high response values ​​of m / z 289.977, m / z 281.8881, and 399 m / z 323.2393 in the secondary mass spectrometry further confirmed that the loss of two pyranose rings is the main degradation pathway of avermectin metabolites (Gianelli et al., 2000; Cheng and Liu, 2014). This study also found that recombinant protein PcCCE11 can hydrolyze the ester bond of avermectin to generate the hydrolysate 1,18-hydrolyzed avermectin, which directly participates in the metabolism of avermectin. Recombinant protein PcCCE7 may participate in the metabolism of avermectin by binding to avermectin through isolation or chelation.

[0197] This study is the first to discover products of the interaction between CCEs and avermectin in *Pseudomonas citrus*, but the safety of these metabolites requires further evaluation. Interestingly, avermectin contains one carboxyl ester bond, while spirodiclofen contains two. This study did not detect any intermediate products of catalytic hydrolysis at the five-membered inner ring carboxyl ester bond site of spirodiclofen, nor did it detect any intermediate products of hydrolysis of the inner ring carboxyl ester bond of avermectin by the PcCCE7 recombinant protein. It is speculated that the functional group in which carboxylesterases exert their hydrolytic action may be selective, possibly related to their folding conformation. Furthermore, the metabolic effects of carboxylesterases on avermectin and spirodiclofen differ significantly, possibly due to the different conformations of the intermediate complexes formed after the two acaricides bind to the carboxylesterase. Etoxazole lacks the functional group to be acted upon; therefore, the inability of carboxylesterases to directly metabolize etoxazole is consistent with the carboxylesterase hydrolysis mechanism. Currently, no direct evidence has been found for etoxazole metabolic resistance. It is speculated that this may be due to the synergistic effect of increased detoxification metabolic enzyme activity in mites before the I1017F SNP frequency reaches 100%. Once the I1017F SNPs are fixed, homozygous I1017F alleles are sufficient to promote high resistance to etoxazole. After the selective pressure of etoxazole disappears, it will affect the fitness-cost strategy adjustment of resistant mites. The activity of detoxification metabolic enzymes and gene expression are expected to decrease over time, even tending towards that of susceptible strains. Furthermore, etoxazole resistance in mites exhibits instability (Yorulmaz Salman and...). (2014; Yorulmaz Salman et al., 2015; Tadatsu et al., 2022) speculated that there may be some regulatory mechanism in this process affecting the formation of cross-resistance to citrus psyllids.

[0198] 4.4 3D Modeling and Molecular Docking of PcCCE11 and PcCCE7 Proteins of the Citrus Pestomyces

[0199] 3D modeling and molecular docking are important tools for analyzing the interaction between the structure of detoxification metabolic enzymes and their substrates. The active sites of the SEH conserved catalytic triplet of PcCCE11 protein are Ser-207, Glu-344, and His-452, while those of the SEH conserved catalytic triplet of PcCCE7 protein are Ser-219, Glu-363, and His-469. Both PcCCE11 and PcCCE7 also possess the typical structural features of the carboxylesterase family, consisting of multiple parallel β-sheets and α-helices, as well as oxyanion hole features. These structures are crucial for carboxylesterases to hydrolyze acaricide substrates, thus suggesting that they may have the ability to hydrolyze insecticides.

[0200] The molecular docking results of this invention show that avermectin and spirodiclofen can stably bind to the active pockets of PcCCE11 and PcCCE7 via hydrogen bonds. Furthermore, some amino acid residues of PcCCE11 and PcCCE7 can form stable hydrogen bonds with the non-cyclic carboxyl ester bond sites of spirodiclofen, but they cannot bind to the carboxyl ester bond sites of avermectin. They can also affect the activity of PcCCE11 and PcCCE7 proteins through some hydrophobic residues, which suggests that their hydrolytic activity against spirodiclofen may be higher, consistent with the higher metabolic rate of spirodiclofen shown in the metabolic results.

[0201] 4.5 In vivo functional analysis of PcCCE11 and PcCCE7 of the citrus parsnipus mite

[0202] RNAi is one of the most widely used methods for verifying gene function in insects and mites. Studies have confirmed that reducing the expression level of CCE genes in pests / mites via RNAi can decrease CCE activity and increase susceptibility to insecticides / miticides. In this study, RNAi interference with PcCCE11 and PcCCE7 significantly reduced their expression levels by 53.90% and 58.52%, respectively, demonstrating that feeding methods can effectively reduce the transcriptional levels of PcCCE11 and PcCCE7. The total enzyme activity of CCEs in the CoR-NN strain also decreased accordingly, and the susceptibility to abamectin and spirodiclofen was significantly enhanced, indicating that changes in the expression levels of PcCCE11 and PcCCE7 affect the formation of cross-resistance in the CoR-NN strain. Of course, other carboxylesterase genes (such as other CCE genes not yet studied in this transcriptome) may also play a role in the cross-resistance of *Pterygodium japonicum* to abamectin, spirodiclofen, and etoxazole.

Claims

1. A molecular marker for cross-resistance to multiple pesticides in *Pseudorasbora citrinum*, characterized in that: The molecular markers are carboxylesterase genes PcCCE11 and / or PcCCE7, with the nucleotide sequence of PcCCE11 as shown in SEQ ID NO.1 and the nucleotide sequence of PcCCE7 as shown in SEQ ID NO.

2.

2. The molecular marker according to claim 1, characterized in that: The various agents include abamectin, spirodiclofen, and preferably etoxazole.

3. The molecular marker according to claim 2, characterized in that: The molecular marker is the carboxylesterase gene PcCCE11, and the various agents are avermectin and spirodiclofen.

4. The application of the molecular marker according to any one of claims 1 to 3 in the classification of citrus psyllid populations susceptible to and resistant to multiple pesticides, wherein the multiple pesticides include abamectin, spirodiclofen, and preferably etoxazole.

5. The application according to claim 4, characterized in that: The expression level of the carboxylesterase gene in the tested citrus psyllid was detected. If the expression level of the carboxylesterase gene in the tested citrus psyllid was significantly higher than that in the susceptible population, it could be determined that the tested citrus psyllid exhibited cross-resistance to multiple agents. If there was no significant difference in the expression level of the carboxylesterase gene between the tested citrus psyllid and the susceptible population, it could not be determined that the tested citrus psyllid exhibited cross-resistance. The carboxylesterase gene was PcCCE11 and / or PcCCE7.

6. A method for detecting molecular markers as described in claim 1, characterized in that: Using a pesticide-sensitive population of *P. citrus* as a control, the expression level of the carboxylesterase gene in the tested *P. citrus* species was detected. If the expression level of the carboxylesterase gene in the tested *P. citrus* species was significantly higher than that in the sensitive population, it could be determined that the tested *P. citrus* species exhibited cross-resistance to multiple pesticides; if there was no significant difference in the expression level of the carboxylesterase gene between the tested *P. citrus* species and the sensitive population, it could not be determined that the tested *P. citrus* species exhibited cross-resistance; the carboxylesterase gene was PcCCE11 and / or PcCCE7.

7. The method according to claim 6, characterized in that: The various agents include abamectin, spirodiclofen, and preferably etoxazole.

8. The method according to claim 6 or 7, characterized in that: The procedure includes the following steps: extracting total RNA from the citrus parvovirus mite to be tested, reversing it into cDNA, performing qPCR amplification using the cDNA as a template, using a sensitive population as a control, and measuring the expression level of the carboxylesterase gene in the test subject. When the expression level of the carboxylesterase gene in the test subject is significantly higher than that in the sensitive population, it can be determined that the test subject has cross-resistance to multiple agents.

9. The method according to claim 8, characterized in that: The primer sequences for the qPCR amplification are as follows: The primer sequences for amplifying the PcCCE11 gene are as follows: EVM0001466-F: 5'-CGGAACATTGTGCTTCATTC-3'; EVM0001466-R: 5'-CGAGTTTTCGGCTTCAAGTATC-3'; The primer sequences for amplifying the PcCCE7 gene are as follows: EVM0005255-F: 5'-GAGTCCTTGTTGCCCGTTTA-3'; EVM0005255-R: 5'-GCCACATTACCTGGAATACCCT-3'.

10. The method according to claim 8, characterized in that: The reaction program for qPCR amplification is as follows: 95℃ pre-denaturation for 30s; 95℃ for 10s, 60℃ for 30s, 40 cycles; melting curve: 95℃ for 15s, 60℃ for 60s, 95℃ for 15s.

Images