Molecular identification method for swim bladder of Nibea dispinosa and processed product of swim bladder

By combining PCR technology and characteristic primers, the problem of distinguishing genuine from counterfeit swim bladders and processed products of the yellow croaker has been solved, realizing a rapid and accurate molecular identification method to ensure the authenticity of red-mouth glue.

CN121023041APending Publication Date: 2025-11-28JINAN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511439193.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-10
Publication Date
2025-11-28

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively distinguish the swim bladder of the yellow croaker and its processed products from counterfeit products, especially after processing when the appearance changes and it becomes difficult to tell the difference between genuine and counterfeit products.

Method used

Molecular identification was performed using PCR technology combined with characteristic primers 5′CGCCACCATAACAAATGAAC3′ and 5′TGCGGAACCCTATCCAGAG3′. Specific primers were designed to distinguish the swim bladder of *Prorocentrum diochotomum* and its processed products from common adulterants.

Benefits of technology

It enables rapid and accurate identification of the swim bladder of the yellow croaker and its processed products. The distinguishing characteristic bands are obvious at 500-700bp, while counterfeit products have no bands, thus solving the problem of distinguishing between genuine and counterfeit products.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121023041A_ABST
    Figure CN121023041A_ABST
Patent Text Reader

Abstract

The invention relates to a molecular identification method, in particular to a molecular identification method of a swimming bladder of Nibea dispinosa and a processed product thereof, and provides a novel molecular identification method based on a characteristic primer, namely identification is carried out by designing a specific primer through a PCR (Polymerase Chain Reaction) technology. The result shows that the swim bladder of the Nibea dispinosa and the swim bladder of the processed product fried Nibea dispinosa have a single obvious strip at 500-700bp, and the counterfeit product (the swim bladder of the large yellow croaker, the swim bladder of the small yellow croaker and the swim bladder of the bighead carp) has no strip. And rapid identification of authenticity of the maibea dispinosa swim bladder and the processed product thereof can be realized.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to a molecular identification method, in particular to a molecular identification method of Nibea diacanthus and its processed products BACKGROUND

[0002] Nibea diacanthus, also known as Nibea diacanthus, Protonibea diacanthus (Lacepède, 1802), is a fish of the family Sciaenidae and the genus Nibea. Fish glue made from Nibea diacanthus swim bladder, also known as red beak glue, is one of the world's five famous glues. It has a high protein content of 84.2% and only 0.2% fat, and is a pure natural high-grade tonic with comprehensive amino acids. It has the effects of tonifying kidney and essence, nourishing blood vessels, stopping bleeding and removing blood stasis. Because red beak glue is very valuable, there are often counterfeit products mixed in it, and because the appearance changes after processing, it is difficult to distinguish between true and false. Therefore, it is very important to establish a molecular identification method based on characteristic primers for identifying the authenticity of Nibea diacanthus swim bladder and its processed products. SUMMARY

[0003] OBJECTIVE The present application provides a novel molecular identification method based on characteristic primers, which can quickly identify the authenticity of Nibea diacanthus swim bladder and its processed products.

[0004] TECHNICAL SCHEME A molecular identification method for Nibea diacanthus swim bladder and its processed products, characterized by using PCR technology to identify the red beak glue and its common counterfeit product area, wherein the characteristic primers 5'CGCCACCATAACAAATGAAC3' and 5'TGCGGAACCCTATCCAGAG3' can distinguish the red beak glue (Nibea diacanthus swim bladder) from its common counterfeit product area.

[0005] The PCR reaction system is carried out in a 200 μl centrifuge tube, and the total reaction volume is 50 μl. The reaction system includes 2xPhanta Flash Master Mix 25 μl, 2 μl of each of the identification primers (10 μM), 1 μl of the template (about 200 ng), and 20 μl of sterile ultrapure water. The centrifuge tube is placed in a PCR instrument, and the PCR reaction parameters are: 98℃ pre-denaturation for 30 seconds, 35 cycles of 98℃ for 10 seconds, 62℃ for 5 seconds, and 72℃ for 5 seconds, and 72℃ extension for 1 minute.

[0006] The counterfeit product is the swim bladder of Pseudosciaena crocea, small yellow croaker or Aristichthys nobilis. ADVANTAGEOUS EFFECTS

[0007] This invention provides a novel molecular identification method based on characteristic primers. Specifically, by designing specific primers and performing PCR technology, the method reveals that the swim bladder of *Protoceratops dispinipes* and its processed form (stir-fried *Protoceratops dispinipes*) exhibit a single, distinct band at 500-700 bp, while counterfeit products (swim bladders of large yellow croaker, small yellow croaker, and bighead carp) show no band. This method enables rapid identification of the authenticity of *Protoceratops dispinipes* swim bladder and its processed products. Attached Figure Description

[0008] Figure 1 Electrophoresis results of this invention, lanes: 1. Swim bladder of *Protoscolephalum dispinipes*, 2. Fried swim bladder of *Protoscolephalum dispinipes*, 3. Swim bladder of *Large Yellow Croaker*, 4. Swim bladder of *Siniperca maculatus*, 5. Swim bladder of *Bighead Carp*, M1. 100-1500bp DNA marker, M2. 2000bp DNA marker. Figure 2 Images of the swim bladder of the yellow croaker (Procambarus spp.); Figure 3 Image of the swim bladder of stir-fried yellow croaker; Figure 4 Images of the swim bladder of large yellow croaker; Figure 5 Pictures of small yellow croaker Figure 6 Images of silver carp swim bladders Detailed Implementation

[0009] Example 1 Experimental methods 1. DNA template extraction Take the original yellow croaker with two spines Protonibea diacanthus (Lacepede) 25 mg each of fish swim bladder and stir-fried yellow croaker swim bladder were used to extract template DNA solution from the test samples using a high-efficiency animal genomic DNA extraction kit. Separately, large yellow croaker was used. Pseudosciaena crocea (Richardson), Yellow Croaker Pseudosciaena polyactis Bleeker, bighead carp Hypophthalmichthys nobilis 25 mg of the control herb was used to prepare a template DNA solution using the same method. Detailed operating steps are as follows: ① Material processing: Take about 25 mg of tissue from the swim bladder sample with sterilized scissors and put it into a 1.5 mL centrifuge tube. After sterilizing with 75% ethanol, cut the tissue into small pieces as much as possible, then add 200 μL of Buffer GA and vortex to mix. ② Add 20 μL Proteinase K, mix well, and incubate in a 56 ℃ water bath for 10~12h, inverting the sample 2~3 times during the process until the tissue is digested and there is no grainy texture. ③ Add 200 μL of Buffer GB to a centrifuge tube, vortex to mix, and incubate in a 56 ℃ water bath for 10 min; (4) Add 200 μL absolute ethanol into the centrifuge tube, vortex mix well; (5) Put the adsorption column into the collection tube, transfer the mixed solution from the previous step into the adsorption column, centrifuge at 12000 rpm for 1 min; (6) Discard the waste liquid after centrifugation, put the adsorption column back into the collection tube, add 500 μL Buffer WB1 into the adsorption column, centrifuge at 12000 rpm for 30 s; (7) Discard the waste liquid after centrifugation, put the adsorption column back into the collection tube, add 600 μL Buffer WB2 into the adsorption column, centrifuge at 12000 rpm for 30 s; (8) Repeat the previous step; (9) Discard the waste liquid after centrifugation, put the adsorption column back into the collection tube, centrifuge at 12000 rpm for 2 min; open the adsorption column, place it on the clean bench for about 15 min until the residual rinse solution on the adsorption membrane is completely dried; (10) Put the adsorption column into a new 1.5 mL centrifuge tube, add 75 μL TE Buffer preheated at 65 ℃ to the center of the adsorption membrane, place it at room temperature for 5 min, centrifuge at 12000 rpm for 2 min, collect the DNA solution and store it at -20 ℃ for subsequent PCR amplification.

[0010] 2 PCR reaction Discrimination primers: 5'CGCCACCATAACAAATGAAC 3'and 5'TGCGGAACCCTATCCAGAG 3 '. PCR reaction system: in a 200 μl centrifuge tube, the total reaction volume is 50 μl, the reaction system includes 2 × Phanta Flash MasterMix 25 μl, discrimination primers (10 μM) 2 μl each, template (about 200 ng) 1 μl, sterile ultrapure water 20 μl. Place the centrifuge tube in the PCR instrument, the PCR reaction parameters are: 98 ℃ pre-denaturation for 30 seconds, 35 cycles of reaction (98 ℃ for 10 seconds, 62 ℃ for 5 seconds, 72 ℃ for 5 seconds), 72 ℃ extension for 1 minute.

[0011] 3 Gel electrophoresis imaging Take 0.5 mL 50*TAE, 24.5 mL ultrapure water in a conical flask to get 1*TAE, weigh 0.25 g agarose and add it, microwave oven heating for 40 seconds to transparent state. After slight cooling, add 2.5 μL Ultra GelRed nucleic acid stain, mix well for subsequent plating. Place a clean electrophoresis gel bed in the gel making frame, insert the sample comb, slowly pour the agarose gel to prevent air bubbles, after it cools and solidifies into a gel, slowly pull out the sample comb vertically upwards to get a 1% agarose gel.

[0012] The agarose gel was placed in the electrophoresis tank, with the hole side close to the negative electrode, and the electrophoresis liquid was added to immerse the gel. 5 μL of the test sample, the control medicinal material, and the DNA molecular weight marker PCR reaction liquid were added to the gel plate hole slot respectively using a pipette The electrophoresis voltage was 120 V / cm, and the time was 30 min. The electrophoresis was stopped when the bromophenol blue spot was about 1 cm away from the gel front. The gel was taken out, observed by a gel imager, and the electrophoretogram was recorded.

[0013] Results 1. Electrophoresis results: It can be seen from the electrophoresis results that the double-spine original yellow croaker swim bladder and fried double-spine original yellow croaker swim bladder have a single obvious band at 500-700 bp, and there is no band in the large yellow croaker swim bladder, small yellow croaker and bighead carp swim bladder.

[0014] 2. Sequencing results The amplified sequence was sequenced (SEQ ID NO. 3) and the similarity with the sequence of double-spine original yellow croaker (NCBI accession number LC705437.1) reached 100% (using the blast tool of NCBI).

Claims

1. A molecular identification method for the swim bladder of *Protoceratops dispinipes* and its processed products, characterized in that, DNA was extracted from fish swim bladders, and PCR was used to identify red beak glue and its common counterfeits, with characteristic primers 5′CGCCACCATAACAAATGAAC3′ and 5′TGCGGAACCCTATCCAGAG3′.

2. The method according to claim 1, characterized in that, The PCR reaction system was carried out in 200 μl centrifuge tubes with a total reaction volume of 50 μl. The reaction system included 25 μl of 2×Phanta Flash Master Mix, 2 μl of each 10 μM identification primer, 1 μl of 200 ng template, and 20 μl of sterile ultrapure water. The PCR reaction parameters were: 98℃ pre-denaturation for 30 seconds, 35 cycles (98℃ for 10 seconds, 62℃ for 5 seconds, 72℃ for 5 seconds), and 72℃ extension for 1 minute.

3. The method according to claim 1, characterized in that, The counterfeit product is the swim bladder of large yellow croaker, small yellow croaker, or bighead carp.