Lactobacillus paracasei BHP06 with anti-allergic function

Abstract

The invention belongs to the technical field of food microorganisms, and particularly relates to a lactobacillus paracasei BHP06 with an anti-allergic function. The preservation number of the Lactobacillus paracasei BHP06 is GDMCC (China General Microbiological Culture Collection Center) No: 66270, and the preservation number of the Lactobacillus paracasei BHP06 is CGMCC No: 66270. The lactobacillus paracasei strain provided by the invention has good gastrointestinal tract reverse environment resistance and has good survival ability in simulated gastrointestinal fluid; good self-aggregation capability and hyaluronidase inhibition capability are realized. By establishing a degranulation model of RBL-2H3 cells, it is found that the strain can inhibit mast cell degranulation and relieve allergy; by establishing an RAW264.7 cell inflammation model, the strain disclosed by the invention is found to be capable of inhibiting allergic inflammatory reaction; by establishing an OVA (ovalbumin)-induced BALB / c mouse food allergy model, the strain disclosed by the invention is found to be capable of improving the anti-allergy ability of animals and exerting the activity of relieving food allergy.

Description

Technical Field

[0001] This invention belongs to the field of food microbiology technology, specifically relating to a strain of Lactobacillus paracasei BHP06 with anti-allergic function. Background Technology

[0002] Food allergy refers to an adverse immune response of the body to food allergens, which can cause a variety of clinical symptoms, including itching in the mouth or ears, rhinitis, asthma, vomiting, diarrhea, and difficulty breathing. In severe cases, it can even lead to shock and death. Food allergies can be classified into IgE-mediated, non-IgE-mediated, and mixed types, with IgE-mediated food allergies being more common in clinical practice. Avoiding allergens is currently the main means of preventing allergic diseases. However, food allergens are ubiquitous in people's diets and are difficult to avoid. Furthermore, long-term reduction in the intake of allergenic foods can easily lead to nutritional imbalances and even other adverse reactions in the body. Therefore, new treatment methods for food allergies are needed.

[0003] Currently, multiple studies have shown that probiotics play an important role in alleviating food allergy symptoms and have certain preventive and therapeutic effects on food allergies. Probiotics are live microorganisms that, when in sufficient doses, can regulate the host's immune system and benefit the host. Lactic acid bacteria, as one of the most common probiotics, are widely distributed in nature, such as in soil, water, plant surfaces, animal feces, fermented products, and the digestive tracts of humans and animals, and are a crucial component of the beneficial flora in the body. Lactic acid bacteria have various physiological functions, mainly manifested in lowering blood pressure, regulating blood sugar, lowering cholesterol, antagonizing pathogenic microorganisms, immune regulation, and anti-allergy effects. In individuals with food allergies, lactic acid bacteria can effectively alleviate food allergy reactions by reducing specific IgE levels, regulating Th1 / Th2 immune balance, inhibiting mast cell activation, suppressing allergy-induced inflammatory responses, strengthening the intestinal barrier, and regulating the diversity and composition of the intestinal flora.

[0004] Patent application CN 119331791 A discloses a strain of *Lactobacillus paracasei* LC97. This LC97 strain possesses broad-spectrum antibacterial properties, enhances immune function, and alleviates atopic dermatitis. It alleviates atopic dermatitis by relieving skin lesions, inhibiting inflammation, reducing ear swelling, and regulating cytokine levels. Furthermore, it enhances immunity by regulating cytokine levels by reducing serum total IgE and IL-4 levels and increasing IFN-γ and IL-10 levels. Summary of the Invention

[0005] The purpose of this invention is to provide a novel Lactobacillus paracasei BHP06 with anti-allergic function and its application in improving food allergies.

[0006] In a first aspect, the present invention provides a strain of Lactobacillus paracasei BHP06, with accession number GDMCC 66270.

[0007] This invention involves screening a strain of *Lactobacillus paracasei* BHP06 from fermented foods. The strain was identified through bacterial morphology, physiology, and growth characteristics, combined with 16S rDNA sequencing. The results show that the 16S rDNA sequence of *Lactobacillus paracasei* BHP06 is shown in SEQ ID NO:1.

[0008] Secondly, the present invention provides a microbial inoculant containing *Lactobacillus paracasei* BHP06. Further, the microbial inoculant contains fermentation broth or dried powder of *Lactobacillus paracasei* BHP06.

[0009] Furthermore, the fermentation broth is a fermentation culture medium, and the preparation method of the fermentation culture medium includes the following steps: inoculating Lactobacillus paracasei into MRS liquid culture medium and culturing at 37°C for 18 hours to obtain the fermentation culture medium.

[0010] Furthermore, the fermentation broth is a fermentation supernatant or a bacterial suspension. The fermentation supernatant is obtained by centrifuging the fermentation culture broth; the bacterial suspension is obtained by resuspending the precipitate after centrifuging the fermentation culture broth.

[0011] Furthermore, the dried bacterial powder is a freeze-dried powder.

[0012] Thirdly, the present invention provides the use of one or more of the following components in the preparation of products that enhance the anti-allergic ability of animals and / or improve food allergy symptoms and their complications:

[0013] (1) The Lactobacillus paracasei BHP06;

[0014] (2) The fermentation broth or dried powder of the Lactobacillus paracasei BHP06;

[0015] (3) The aforementioned microbial inoculant. The food allergy symptoms and complications include diarrhea and immune dysregulation. The immune dysregulation is manifested in the release of pro-inflammatory factors.

[0016] Fourthly, the present invention provides a product for improving an animal's anti-allergic ability and / or allergy symptoms and complications, said product containing one or more of the following active ingredients:

[0017] (1) The Lactobacillus paracasei BHP06;

[0018] (2) The fermentation broth or dried powder of the Lactobacillus paracasei BHP06;

[0019] (3) The microbial agent mentioned above.

[0020] The beneficial effects of this invention are as follows:

[0021] The *Lactobacillus paracasei* strain provided by this invention exhibits good resistance to adverse gastrointestinal environments and demonstrates good survival ability in simulated gastrointestinal fluids; it also possesses good self-aggregation ability and hyaluronidase inhibition ability.

[0022] This invention established a degranulation model of RBL-2H3 cells and found that the Lactobacillus paracasei strain of this invention can inhibit cell degranulation, improve cell morphology, alleviate calcium ion influx and reduce ROS levels, indicating that the strain can inhibit mast cell degranulation and alleviate allergies.

[0023] This invention established a RAW264.7 cell inflammation model and found that the *Lactobacillus paracasei* strain of this invention can reduce nitric oxide content, inhibit phagocytic activity, reduce ROS levels, and inhibit the expression of mRNAs of iNOS, IL-1β, IL-6, and TNF-α, indicating that the strain can inhibit allergic inflammatory responses.

[0024] This invention established an ovalbumin (OVA)-induced food allergy model in BALB / c mice. The results showed that the *Lactobacillus paracasei* strain of this invention significantly alleviated OVA-induced allergic reaction symptoms and diarrhea in mice, reduced the levels of OVA-specific immunoglobulin E (OVA-sIgE), immunoglobulin G1 (OVA-sIgG1), immunoglobulin G2a (OVA-sIgG2a), lipopolysaccharide, histamine, and mast cell protease in mouse serum, downregulated the indices of immune organs (spleen and thymus), enhanced the intestinal barrier, upregulated the expression of inflammation-related anti-inflammatory factors and downregulated related pro-inflammatory factors in the spleen, and inhibited the activation of the TLR4 / NF-κB signaling pathway, thus exerting an activity to alleviate food allergy. Attached Figure Description

[0025] Figure 1 Image A shows the colony morphology of Lactobacillus paracasei BHP06; Image B shows the microscopic examination results of Lactobacillus paracasei BHP06.

[0026] Figure 2 A is the growth curve of Lactobacillus paracasei BHP06; B is the acid production curve of Lactobacillus paracasei BHP06.

[0027] Figure 3Results of toluidine blue staining of RBL-2H3 cells by Lactobacillus paracasei BHP06;

[0028] Figure 4 Effects of Lactobacillus paracasei BHP06 on ROS levels in RBL-2H3 cells;

[0029] Figure 5 Lactobacillus paracasei BHP06 affects intracellular Ca in RBL-2H3 cells. 2+ The influence of level;

[0030] Figure 6 Effects of Lactobacillus paracasei BHP06 on NO levels in RAW264.7 cells;

[0031] Figure 7 Effects of Lactobacillus paracasei BHP06 on the phagocytic capacity of RAW264.7 cells;

[0032] Figure 8 Effects of Lactobacillus paracasei BHP06 on ROS levels in RAW264.7 cells;

[0033] Figure 9 Effects of Lactobacillus paracasei BHP06 on the relative gene expression levels in RAW264.7 cells;

[0034] Figure 10 Changes in total IgE in mice during the modeling period;

[0035] Figure 11 : Mouse allergy symptom score and diarrhea symptom score;

[0036] Figure 12 : Mouse serum specific antibody levels (A: OVAs IgE; B: OVAs IgG1; C: OVAs IgG2a);

[0037] Figure 13 : Mouse serum cytokine levels (A: IL-4; B: IL-10; C: IFN-γ; D: LPS);

[0038] Figure 14 : Serum allergy mediator levels in mouse tail veins (A: Histamine; B: mMCP-1);

[0039] Figure 15 : Morphology of the mouse cecum and fecal condition;

[0040] Figure 16 HE staining of mouse jejunum;

[0041] Figure 17 TB staining of mouse jejunum;

[0042] Figure 18 Results of mouse jejunal inflammation detection;

[0043] Figure 19 qPCR results of inflammatory factors in mouse spleen (A: IL-4; B: TNF-α; C: GATA-3; D: IL-10; E: T-bet; F: Foxp3; G: TNF-β; H: TLR4; I: Myd88; J: TRAF6; K: NF-κB; L: IκB).

[0044] Preservation Information

[0045] Preserved biological material: Lactobacillus paracasei BHP06

[0046] Accession number: GDMCC No: 66270;

[0047] Classification and naming: Lacticaseibacillus paracasei;

[0048] Preservation institution: Guangdong Provincial Center for Microbial Culture Collection;

[0049] Address of the repository: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou;

[0050] Deposit date: May 8, 2025. Detailed Implementation

[0051] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of the embodiments of this invention will be clearly described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0052] Example 1: Isolation and identification of Lactobacillus paracasei BHP06

[0053] 1. Screening of lactic acid bacteria

[0054] 1.1 Sample Source

[0055] The strains used in the embodiments of this invention were all isolated from fermented food samples.

[0056] 1.2 Isolation and purification of lactic acid bacteria strains

[0057] Add 1 g / 1 mL of sample to 100 mL of MRS liquid medium and incubate at 37 °C in a shaker for 24 h; then, in a clean bench, take 1 mL of the enrichment solution, dilute with PBS, and incubate at 10 °C.-3 10 -4 10 -5 At each gradient, 100 μL of the culture was spread, numbered, and recorded on MRS agar plates. The plates were then incubated upside down at 37°C for 24–48 h. After colony formation, morphology was observed, numbered, and recorded, including the top and side shapes, size, color, transparency, and surface roughness. A single characteristic colony was picked up with a sterile inoculating loop and placed into the corresponding MRS liquid medium, incubated at 37°C for 24 h. The colony was then streaked again with a sterile inoculating loop until all colonies on the same plate exhibited consistent color, size, and shape. The colonies were then transferred to MRS liquid medium and stored in sterilized glycerol tubes at -20°C.

[0058] A strain that meets the criteria of good growth and good genetic stability was selected and named BHP06.

[0059] 2. Identification of Lactobacillus paracasei BHP06

[0060] 2.1 Colony characteristics

[0061] After culturing strain BHP06 on MRS agar medium for 48 hours, the colonies were 0.3–0.8 mm in diameter, round, with a raised center, neat edges, smooth and moist, and milky white in color. Figure 1 As shown in Figure A.

[0062] 2.2 Microscopic morphology

[0063] BHP06 colony smear: Gram-positive, terminal straight bacilli, single, paired, or in short chains, non-flagellated, non-spore-forming. Figure 1 As shown in B.

[0064] 2.3 16S rDNA Identification

[0065] The selected strains were identified by 16S rDNA sequencing. Target genomic DNA was extracted using a DNA extraction kit (Tiangen Biotech Co., Ltd.). Amplification was performed using two universal primers, 27F and 1492R. The PCR products were sent to BGI Genomics Co., Ltd. for sequencing, and compared with the NCBI BLAST sequence database to identify the strain at the species level. The results showed that the sequence (as shown in SEQ ID NO:1) had over 99% homology with the 16S rDNA sequence of *Lactobacillus paracasei*.

[0066] The 16S rDNA sequence (5'–3') of the strain to be identified is as follows:

[0067]

[0068] Based on the sequence alignment and physiological and biochemical results of strain BHP06, the screened lactic acid bacteria BHP06 was identified as Lacticaseibacillus paracasei.

[0069] 3. Preparation of Lactobacillus paracasei BHP06 bacterial suspension and fermentation supernatant

[0070] The bacterial strain preserved in glycerol tubes was streaked onto MRS agar plates, and single colonies were picked and cultured in MRS liquid medium for 18 h. A 2% inoculum was transferred to MRS liquid medium and incubated at 37°C for 18 h. After 2–3 passages, the culture was centrifuged (4000 rpm, 4°C, 10 min). The supernatant was filtered through a 0.22 μm filter to remove impurities; the resulting supernatant was the fermentation supernatant of *Lactobacillus paracasei* BHP06. The precipitate was washed three times with 0.9% sterile physiological saline and resuspended, with the bacterial suspension concentration adjusted to 1 × 10⁻⁶. 8 The concentration of CFU / mL yields a bacterial suspension of Lactobacillus paracasei BHP06.

[0071] Example 2: Determination of the probiotic properties of Lactobacillus paracasei BHP06

[0072] 1. Determination of growth curve and acid production curve

[0073] Logarithmic growth phase Lactobacillus paracasei was inoculated into MRS liquid medium at a 2% inoculum and cultured at 37°C for 24 hours. The pH and OD were measured every 2 hours. 600 Value. It enters the logarithmic growth phase at 2 hours and reaches the stationary phase at 12 hours, such as... Figure 2 As shown in Figure A; the pH value of *Lactobacillus paracasei* BHP06 decreased rapidly within 8 hours, and remained essentially unchanged after 8 hours. Figure 2 As shown in B.

[0074] 2. Determination of tolerance to simulated gastrointestinal fluids

[0075] Simulated gastric fluid: Adjust the pH of 0.1 mol / L potassium phosphate buffer to 2.5, sterilize it, add pepsin (4 g / L) to dissolve it completely, and preheat it to 37°C before use.

[0076] Simulated intestinal fluid: After sterilizing 0.1 mol / L potassium phosphate buffer to pH 8.0, add trypsin (1 g / L) and porcine bile salts (1.5 g / L), mix and dissolve thoroughly to obtain simulated intestinal fluid. Preheat to 37°C before use.

[0077] After activating *Lactobacillus paracasei* BHP06 for 2-3 generations, 1 mL of bacterial suspension was inoculated into 9 mL of simulated gastric and intestinal fluids, respectively. After incubation at 37°C for 3 h and 4 h, respectively, the viable count was determined using the plate count method. The survival rate was calculated according to Formula I:

[0078] Survival rate = (Number of viable bacteria after treatment / Number of viable bacteria before treatment) × 100%, Equation I.

[0079] Table 1. Tolerance of Lactobacillus paracasei BHP06 to simulated gastric and intestinal fluids

[0080] strain Simulated gastric fluid survival rate (%) Simulated intestinal fluid survival rate (%) Lactobacillus paracasei BHP06 <![CDATA[88.49±8.57 A ]]> <![CDATA[72.84±2.98 b ]]> Lactobacillus rhamnosus ATCC 53103 <![CDATA[74.18±10.01 A ]]> <![CDATA[98.45±1.50 a ]]>

[0081] As shown in Table 1, *Lactobacillus paracasei* BHP06 exhibited good tolerance in both simulated gastric juice at pH 2.5 and simulated intestinal juice containing bile salts at pH 8.0, and its tolerance rate in simulated gastric juice was higher than that of the positive control *Lactobacillus rhamnosus* ATCC53103. Therefore, *Lactobacillus paracasei* BHP06 possesses good resistance to adverse gastrointestinal environments.

[0082] 3. Determination of self-aggregation ability

[0083] After activating *Lactobacillus paracasei* BHP06 for 2-3 generations, 1 mL of the solution was vortexed for 10 seconds and placed in a 37°C water bath for 5 hours. The supernatant was then collected, and the OD value was measured. 600nm (A t Value. Calculated according to Formula II:

[0084]

[0085] In the formula: A0 represents the OD at 0h. 600nm Absorbance, A t Indicates OD at 5h 600nm Absorbance value.

[0086] Table 2. Self-aggregation ability of Lactobacillus paracasei BHP06

[0087] strain Self-aggregation rate (%) Lactobacillus paracasei BHP06 <![CDATA[27.47±4.92 a ]]> Lactobacillus rhamnosus ATCC 53103 <![CDATA[14.32±1.30 b ]]>

[0088] As shown in Table 2, *Lactobacillus paracasei* BHP06 exhibited good self-aggregation ability, significantly higher than the positive control *Lactobacillus rhamnosus* ATCC 53103. Therefore, *Lactobacillus paracasei* BHP06 possesses good adhesiveness, ensuring high density of the strain in the intestine.

[0089] Example 3: Determination of the anti-allergic properties of Lactobacillus paracasei BHP06

[0090] 1. Determination of hyaluronidase inhibition rate

[0091] The Elson-Morgan modified method was used. 0.1 mL of 2.5 mmol / L CaCl2 and 0.5 mL of 250 U / mL hyaluronidase were added to a 7 mL test tube and incubated at 37°C for 20 min. Then, 0.5 mL of *Lactobacillus paracasei* BHP06 (or *Lactobacillus rhamnosus* ATCC 53103) fermentation supernatant was added and incubated at 37°C for 20 min. Next, 0.5 mL of 0.5 mg / mL sodium hyaluronate solution was added and incubated at 37°C for 30 min. After standing at room temperature for 10 min, 0.1 mL of 5 mol / L NaOH solution and 0.5 mL of acetylacetone solution were added, followed by a boiling water bath for 30 min, an ice bath for 10 min, and a return to room temperature for 10 min. Finally, 1 mL of Ehrlich's reagent was added and incubated at room temperature for 30 min. The absorbance of the supernatant at 530 nm was measured. The inhibition rate was calculated using Formula III.

[0092]

[0093] In the formula:

[0094] A—Absorbance value of the control group (sodium acetate-acetic acid buffer instead of fermentation supernatant);

[0095] B—Blank absorbance value of control group (sodium acetate-acetic acid buffer replacing enzyme solution and fermentation supernatant);

[0096] C—Absorbance value of the test group;

[0097] D—Blank absorbance of the experimental group (sodium acetate-acetic acid buffer solution replacing enzyme solution).

[0098] Table 3. Hyaluronidase inhibition rate of Lactobacillus paracasei BHP06

[0099] strain Inhibition rate (%) Lactobacillus paracasei BHP06 <![CDATA[85.30±0.13 a ]]> Lactobacillus rhamnosus ATCC 53103 <![CDATA[83.79±0.62 b ]]>

[0100] As shown in Table 3, *Lactobacillus paracasei* BHP06 exhibited good hyaluronidase inhibition ability, significantly higher than the positive control *Lactobacillus rhamnosus* ATCC 53103. The hyaluronidase inhibition test is an effective method for rapid in vitro screening of anti-allergy drugs; the higher the hyaluronidase inhibition rate, the stronger the anti-allergy activity.

[0101] 2. Determination of the inhibitory effect of β-aminohexosidase (β-HEX) release on RBL-2H3 cells.

[0102] 2.1 RBL-2H3 cell culture

[0103] RBL-2H3 cells (purchased from Shanghai Enzyme-Linked Biotechnology Co., Ltd.) were removed from liquid nitrogen and thawed in a 37°C water bath, avoiding shaking and light exposure. After thawing, the cells were quickly transferred to cell culture flasks, and MEM medium containing 15% fetal bovine serum was added. The cells were cultured in a 5% CO2 environment at 37°C, with the medium changed daily. When the confluence reached 80%–90%, the cells were passaged: washed with sterile PBS, digested with trypsin containing 0.25% Trypsin-EDTA, and neutralized with complete medium. The cells were then transferred to sterile centrifuge tubes, centrifuged at 1000 rpm for 5 min, the supernatant was discarded, and the cells were resuspended in fresh complete medium. The cell culture was then aliquoted into new flasks and cultured further.

[0104] 2.2 Construction of RBL-2H3 degranulation model and determination of β-HEX release inhibition rate

[0105] Construction of the RBL-2H3 degranulation model (sensitized cells): RBL-2H3 cells in the logarithmic growth phase were digested and a cell suspension was prepared using complete culture medium. 0.5 μg / mL Anti-DNP-IgE was added to the cell suspension, and the cell suspension was diluted at 100 μL / well (2 × 10⁻⁶ cells / well). 4 (The cells) are inoculated into 96-well plates and incubated in an incubator for 24 hours.

[0106] Sample processing: The samples were divided into experimental group (group A, with sample and Anti-DNP-IgE), model group (group B, with Anti-DNP-IgE but no sample), and blank group (group K, without Anti-DNP-IgE).

[0107] After 24 hours of culture, remove the culture medium from the cells, wash them twice, add 100 μL of Lactobacillus paracasei BHP06 (or Lactobacillus rhamnosus ATCC 53103) fermentation supernatant or bacterial suspension to group A, and add 100 μL of basal culture medium to groups B and K. Incubate for 1 hour. Remove the culture medium, wash twice, add 100 μL of basal culture medium containing 5 μg / mL DNP-HSA, and place in an incubator.

[0108] Method for determining β-HEX release inhibition rate: After culturing with DNP-HSA for 1 h in each group, the supernatant was collected, and 50 μL of supernatant and chromogenic solution were added sequentially to a 96-well plate. The plate was incubated at 37℃ for 1.5 h, and then 100 μL of stop solution was added. OD was then measured. 405nm Values. Calculate the β-HEX release efficiency and release inhibition rate in RBL-2H3 cells:

[0109]

[0110] Table 4. Inhibition rate of β-HEX release by Lactobacillus paracasei BHP06

[0111] strain Fermentation supernatant (%) Bacterial suspension (%) Lactobacillus paracasei BHP06 <![CDATA[38.41±3.78 A ]]> <![CDATA[59.86±8.18 a ]]> Lactobacillus rhamnosus ATCC 53103 <![CDATA[41.29±11.86 A ]]> <![CDATA[37.37±16.83 b ]]>

[0112] As shown in Table 4, the bacterial suspension of *Lactobacillus paracasei* BHP06 showed a significantly higher inhibition rate of β-HEX release than the positive control *Lactobacillus rhamnosus* ATCC 53103. The RBL-2H3 cell line has the advantages of a short culture period and unlimited passage, and it possesses a large number of FcεRI receptors on its cell surface. After antigen activation, it can degranulate and release inflammatory mediators in a short time, and the detection method is simple, thus it is often used to evaluate the anti-allergic activity of active substances. β-HEX is a compound pre-synthesized in mast cells and / or basophils and is not detected in body fluids under normal conditions. Only in an allergic state can the body promote the degranulation of mast cells or basophils, subsequently releasing β-HEX. An inhibition rate of β-HEX release greater than 30% can be considered to have certain anti-allergic activity potential.

[0113] 3. Toluidine blue staining of RBL-2H3 cells

[0114] Toluidine blue is a synthetic basic dye that binds to acidic substances and heterochromatic substances such as heparin and histamine in mast cells, thus producing different colors. After culturing with DNP-HSA for 0.5 h, the cells in each group were washed with phosphate-buffered saline (PBS) and then incubated with 250 μL of 4% paraformaldehyde for 30 min at room temperature. The cells were then stained with toluidine blue dye for 30 min. Images of the stained cells were then examined and captured using an inverted microscope.

[0115] like Figure 3 As shown, a clear, elongated structure and abundant intracytoplasmic granules were observed in normal RBL-2H3 cells. Conversely, after DNP-HSA challenge, the cells exhibited typical degranulation morphology, including irregular shapes and low intracytoplasmic granule content. This indicates that mast cells are undergoing degranulation. Pretreatment of IgE-sensitized RBL-2H3 cells with Lactobacillus paracasei BHP06 improved the elongated cell shape and increased intracytoplasmic granule content, suggesting that it can improve the cell degranulation state.

[0116] 4. Effects on reactive oxygen species (ROS) in RBL-2H3 cells

[0117] Sensitized cells (as in step 2.2) were grouped into (Group A, with sample and Anti-DNP-IgE), model group (Group B, with Anti-DNP-IgE but no sample), and blank group (Group K, without Anti-DNP-IgE).

[0118] After 24 hours of culture, the cells were removed from the culture medium, washed three times with benchtop buffer, and incubated with DCFH-DA probe in each well for 30 minutes. For group A, fermentation supernatant or bacterial suspension of Lactobacillus paracasei BHP06 (or Lactobacillus rhamnosus ATCC 53103) was added to each well. For groups B and K, 100 μL of basal culture medium was added, and the cells were incubated for 1 hour. After washing three times with benchtop buffer, DNP-HSA was added to stimulate the cells for 1 hour. The fluorescence value of the 96-well plate was measured at an excitation wavelength of 488 nm and an emission wavelength of 525 nm.

[0119] like Figure 4 As shown, compared with the normal group (i.e., the blank group), the fluorescence intensity of the model group was enhanced, and the fermentation supernatant or bacterial suspension of *Lactobacillus paracasei* BHP06 showed significantly higher inhibitory ability against ROS than the positive control *Lactobacillus rhamnosus* ATCC53103, which could significantly reduce the level of intracellular ROS. ROS represents oxidative stress and plays an important role in cellular physiological processes. The above indicates that *Lactobacillus paracasei* BHP06 can alleviate allergies by reducing the level of intracellular ROS.

[0120] 5. Ca in RBL-2H3 cells 2+ The influence of level

[0121] Sensitized cells (as in step 2.2) were divided into experimental group (group A, with sample and Anti-DNP-IgE), model group (group B, with Anti-DNP-IgE but no sample), and blank group (group K, without Anti-DNP-IgE).

[0122] Fluo-3AM binds to intracellular calcium ions, producing strong fluorescence. After 24 hours of culture, the cells were removed from the culture medium and washed three times with Benzoate buffer. For group A, each well was added with *Lactobacillus paracasei* BHP06 (or *Lactobacillus rhamnosus* ATCC53103) fermentation supernatant or bacterial suspension. Groups B and K were added with 100 μL of basal medium and incubated for 1 hour. Cells were washed three times with HBSS solution, and each group was incubated with Fluo-3AM working solution for 30 minutes. Cells were washed with HBSS solution to thoroughly remove residual working solution and ensure complete deesterification of the AM group. Incubation with HBSS solution continued for 30 minutes, followed by stimulation with DNP-HSA. Measurements were taken every 10 seconds for 300 seconds at an excitation wavelength of 488 nm and an emission wavelength of 525 nm in a 96-well plate.

[0123] like Figure 5 As shown, compared with the normal group (i.e., the blank group), the model group Ca 2+ The level was significantly enhanced after treatment with Lactobacillus paracasei BHP06, resulting in a significant increase in Ca levels. 2+ Decreased levels. Mast cell degranulation and signal transduction and intracellular calcium. 2+The increase in levels is related to this. This suggests that *Lactobacillus paracasei* BHP06 may be mediated by affecting intracellular calcium levels. 2+ It stabilizes mast cell morphology and thus inhibits mast cell degranulation.

[0124] 6. Determination of the inhibitory effect of RAW264.7 cells on nitric oxide (NO) release

[0125] 6.1 RAW264.7 Cell Culture

[0126] After resuscitating RAW264.7 cells, they were placed in DMEM medium containing 10% fetal bovine serum and cultured at 37°C and 5% CO2. When the cells reached 80%–90% confluence, they were washed 2–3 times with PBS, and 4 mL of fresh medium was added to the culture flask. The cells were gently pipetted off and transferred to a 15 mL centrifuge tube. The tube was centrifuged (1000 rpm for 5 min), and the supernatant was discarded. Then, complete medium was added and mixed thoroughly. 1 mL of the cell suspension was transferred to a T25 culture flask containing complete medium and mixed thoroughly. The cell density and morphology were observed under a microscope before the flask was placed in a CO2 incubator for further culture.

[0127] 6.2 RAW264.7 Inflammation Model

[0128] RAW 264.7 macrophages were induced at a rate of 2 × 10⁻⁶. 5 Cells / well were seeded in 24-well plates and incubated for 24 h. After adding the appropriate reagents to the control group (cells), model group (cells, 100 ng / mL lipopolysaccharide), and experimental group (cells, 100 ng / mL lipopolysaccharide, and sample), the cells were cultured for 12 h. The supernatant was collected and the NO content was determined using a kit. The sample was the fermentation supernatant or bacterial suspension of *Lactobacillus paracasei* BHP06 (or *Lactobacillus rhamnosus* ATCC 53103).

[0129] 100 μL of the collected supernatant was spread into each well of a 96-well plate, and 100 μL of a mixed solution of Griess reagent A and Griess reagent B (Griess reagent A:Griess reagent B = 1:1) was added. The plate was then placed on a shaker and shaken at low speed for 10 min. The absorbance of each well was measured at 540 nm using a multi-mode microplate reader. The NO release rate was calculated according to Equation V.

[0130]

[0131] like Figure 6As shown, the fermentation broth or bacterial suspension of *Lactobacillus paracasei* BHP06 exhibited significantly higher inhibitory activity against NO than the positive control *Lactobacillus rhamnosus* ATCC 53103, and could significantly reduce intracellular NO levels. NO, primarily produced by activated macrophages and lymphocytes, is a key inflammatory mediator that can exacerbate damage at inflammatory sites. The above indicates that *Lactobacillus paracasei* BHP06 has the ability to alleviate allergic inflammation.

[0132] 7. Determination of phagocytic capacity of RAW264.7 cells

[0133] After measuring the NO release rate, the cell culture medium in each well was removed, and the cells were washed with PBS. Then, 100 μL of 0.072% neutral red solution was added to each well, and the cells were incubated at 37°C for 30 min. The neutral red solution was then removed, and the cells were washed with PBS until no obvious purple-red color remained in the wells. Next, 100 μL of RIPA lysis buffer was added to each well, and the cells were incubated at 4°C for 12 h to allow for complete cell lysis. The OD of each group was then measured. 570 nm Value. Calculate the neutral red phagocytic index according to formula VI.

[0134] Neutral red phagocytic index = OD value of experimental group / OD value of blank group, Equation VI.

[0135] like Figure 7 As shown, the phagocytic index of the model group was significantly increased compared with the control group. The fermentation supernatant of *Lactobacillus paracasei* BHP06 significantly downregulated phagocytic capacity, with better results than the positive control *Lactobacillus rhamnosus* ATCC 53103. Phagocytosis is a key indicator for measuring macrophage activity.

[0136] 8. Determination of ROS levels in RAW264.7 cells

[0137] Adjust the RAW264.7 cell suspension to 5 × 10⁶ cells per milliliter. 5 Cells were added to 96-well plates and cultured for 24 hours. The supernatant was discarded, and the cells were divided into three groups: blank group (cells), model group (cells, 100 ng / mL lipopolysaccharide), and experimental group (cells, 100 ng / mL lipopolysaccharide, and sample). The appropriate reagents were added, and the cells were cultured for another 12 hours. The supernatant was discarded, and DCFH-DA was added and incubated for 30 minutes. Fluorescence values ​​were measured at an excitation wavelength of 488 nm and an emission wavelength of 525 nm. The sample was the fermentation supernatant or suspension of *Lactobacillus paracasei* BHP06 (or *Lactobacillus rhamnosus* ATCC 53103).

[0138] like Figure 8As shown, compared with the normal group (i.e., the blank group), the fluorescence intensity of the model group was enhanced, and the inhibitory ability of the bacterial suspension of *Lactobacillus paracasei* BHP06 on ROS was significantly higher than that of the positive control *Lactobacillus rhamnosus* ATCC 53103, which could significantly reduce the level of intracellular ROS. This indicates that *Lactobacillus paracasei* BHP06 can improve lipopolysaccharide-induced oxidative stress, reduce damage to cell structure, and decrease the body's inflammatory response.

[0139] 9. Detection of RAW264.7 cells by real-time quantitative PCR

[0140] 9.1 Extraction of total RNA

[0141] (1) Add 1 mL of Trizol to the cell sample (cells in the blank group, model group and experimental group after 12 h of continued culture in “8.RAW264.7 cell ROS level determination”), homogenize with QIAGEN Tissue Ruptor, and let stand at room temperature for 10 min to fully lyse.

[0142] (2) Add 200 μL of chloroform, shake to mix thoroughly, and centrifuge at 15000 r / min for 5 min.

[0143] (3) Take the supernatant into a 1.5 mL centrifuge tube, add 600 μL of chloroform, mix well, and centrifuge at 15000 r / min for 5 min.

[0144] (4) Take the supernatant into a 1.5 mL centrifuge tube, add 500 μL of isopropanol, mix thoroughly by inverting, and centrifuge at 15000 r / min for 10 min.

[0145] (5) Discard the supernatant, add 1 mL of 75% alcohol, and centrifuge at 5000g for 5 min.

[0146] (6) Discard the supernatant and let it air dry.

[0147] (7) Add 30 μL of RNA-free water to dissolve the RNA.

[0148] (8) Take 1 μL of total RNA to measure OD 260 Quantitative.

[0149] 9.2 mRNA reverse transcription

[0150] (1) Add the following reactants (volume 10.5 μL) to a 1.5 mL centrifuge tube in the following order: 6 μL DEPC water, 0.5 μL RNase inhibitor (50 U / μL), 2 μL random primer (50 pM / μL), and 2 μL RNA;

[0151] (2) Treat at 65℃ for 5 min; place at room temperature for 10 min; centrifuge at 5000g for 5 s;

[0152] (3) Add the following reactants to a 1.5 mL centrifuge tube in the following order (total volume after addition is 20 μL): RNase inhibitor (50 U / μL) 0.5 μL, 5×buffer (invitrogen) 4 μL, dNTP MIX (10 mM / each) 2 μL, DTT 2 μL, AMV (200 U / μL) 1 μL;

[0153] (4) React at 40℃ for 1 hour; treat at 90℃ for 5-10 minutes; ice bath for 5 minutes; centrifuge at 5000g for 5 seconds.

[0154] 9.3 Quantitative Real-Time PCR Amplification

[0155] (1) Sequence and primer design

[0156] Primers were designed based on the sequences of the target genes in the Gene Bank database. The primers were designed using PrimerExpress Software v2.0 from ABI and synthesized by BGI Genomics.

[0157] Table 5. Primer sequences

[0158] Primer name Sequence (5'-3') TNF-α-F CCAAATGGCCTCCCTCTCAT TNF-α-R GGTGGTTTGCTACGACGTGG IL-1β-F TCGTGCTGTCGGACCCATAT IL-1β-R GCCCAAGGCCACAGGTATTT IL-6-F CACAAGTCCGGAGAGGAGAC IL-6-R TCCACGATTTCCCAGAGAAC iNOS-F CGGAGTGACGGCAAACATGA iNOS-R GTGGCAGCATCCCCTCTGAT COX2-F TGGTGGAAAAACCTCGTCCA COX2-R AAAGGTGCTCGGCTTCCAGT GAPDH-F GGCAAATTCAACGGCACAGT GAPDH-R ACGACATACTCAGCACCGGC

[0159] (2) PCR reaction system (16 μL): Water, 6.6 μL, 2×PCR MIX (QIAGEN) 8 μL, Primer (up 50 pM / μL) 0.2 μL, Primer (down 50 pM / μL) 0.2 μL, cDNA 1 μL.

[0160] (3) PCR reaction conditions: ① 95℃ for 2 min, ② 94℃ for 10 s, ③ 59℃ for 10 s, 40 cycles, ④ 72℃ for 40 s.

[0161] (4) Experimental Results

[0162] The real-time quantitative PCR reaction system consisted of a 16 μL reaction volume. The reaction was performed in triplicate in 384-well plates using an ABI ViiA7 PCR instrument. Ct values ​​were acquired using a calibrated threshold setting. For real-time quantitative PCR, GAPDH was used as an internal reference gene for mRNA, and a blank control group was used as the control group. A 2-fold parallel operation was employed. -ΔΔCt The method is used for relative quantification.

[0163] like Figure 9As shown, compared with the normal group (i.e., the blank group), the model group had higher expression levels of TNF-α, IL-1β, IL-6, iNOS, and COX-2. *Lactobacillus paracasei* BHP06 significantly inhibited LPS-induced expression of IL-1β, IL-6, iNOS, and TNF-α mRNA in RAW 264.7 cells. Under LPS stimulation, macrophages express various cytokines in response to inflammation, leading to vascular permeability and the recruitment of inflammatory cells. TNF-α plays an important role in inducing inflammatory responses and the expression of pro-inflammatory cytokines; LPS stimulation upregulates TNF-α expression. IL-1β is a representative pro-inflammatory cytokine closely related to TNF-α. Generally, IL-1β is essential for cell growth or maintaining homeostasis at low concentrations, but excessive production during inflammatory responses, wounds, or immune stimulation can exacerbate human diseases. iNOS produces high levels of NO for extended periods, which is an important mechanism for the excessive production of inflammatory mediators by macrophages. The above results indicate that Lactobacillus paracasei BHP06 can reduce the expression of IL-1β, IL-6, iNOS and TNF-α mRNA, thereby reducing allergic inflammatory responses.

[0164] Example 4: Anti-allergy verification experiment of Lactobacillus paracasei BHP06

[0165] 1. Adaptive feeding and modeling

[0166] The mice used in the experiment were SPF-grade 4-week-old female BALB / c mice (purchased from Vital River Laboratory Animal Technology Co., Ltd.). They were acclimatized to the new environment for one week before the experiment. The housing conditions were 23℃±2℃ and 60%±20% relative humidity. The mice had their drinking water and food changed daily and had free access to food and water. They were kept under 12 hours of light and 12 hours of darkness daily.

[0167] Mice were randomly divided into groups of 8:

[0168] Control group (i.e., blank group): physiological saline;

[0169] Model group: physiological saline;

[0170] Lactobacillus rhamnosus ATCC 53103 treatment group (RLGG): 1×10 9 CFU / each;

[0171] Low-dose treatment group with Lactobacillus paracasei BHP06 (RL6): 1×10 8 CFU / each;

[0172] High-dose treatment group with Lactobacillus paracasei BHP06 (RH6): 1×10 9 CFU / each;

[0173] Lactobacillus rhamnosus ATCC 53103 prevention group (PLGG): 1×10 9 CFU / each;

[0174] Low-dose prevention group of Lactobacillus paracasei BHP06 (PL6): 1×10 8 CFU / each;

[0175] High-dose prevention group of Lactobacillus paracasei BHP06 (PH6): 1×10 9 CFU / each;

[0176] On days 0 and 14, the model and experimental groups were sensitized by intraperitoneal injection of 0.2 mL of sterile saline containing 50 μg OVA and 0.1 mL of alum adjuvant. Serum total IgE levels were measured on day 14. From days 28 to 41, allergy was challenged by gavage every two days with 0.2 mL of sterile saline containing 50 mg OVA. Mice were fasted for 1 hour before each allergy challenge, but allowed free access to water. A total of 5 challenges were performed. The control group received an equal volume of saline instead of the sensitization and challenge solutions. From day 0 to 40, the prevention group received 0.2 mL of probiotic solution daily by gavage, and the treatment group received the same amount daily from day 27 to 40. The control and model groups received an equal volume of sterile saline instead. After the fifth challenge, tail vein serum was collected within 30 minutes and stored at -80°C for later use. On day 41, ocular serum, spleen, and jejunum were collected and stored at -80°C for later use.

[0177] 2. Evaluation of allergy symptoms

[0178] Mice were observed for 1 hour after each allergy challenge to score allergy symptoms.

[0179] Table 6. Scoring Table for Food Allergy Symptoms in Mice

[0180] Rating levels symptom 0 Asymptomatic 1 Repeatedly scratching and rubbing around the mouth and nose 2 Disordered hair, spiky hair, puffiness around the eyes and mouth, increased breathing rate and decreased activity 3 Difficulty breathing, asthma, cyanosis around the mouth and tail 4 Tremors, seizures followed by no activity 5 Shock, death

[0181] 3. Diarrhea score

[0182] One hour after each stimulation, the diarrhea status of mice in each group was assessed.

[0183] Table 7. Scoring Table for Diarrhea Symptoms in Mice

[0184] Rating levels symptom 0 normal stool 1 Small amount of wet and unformed feces 2 Moderate perianal staining, with some wet and unformed stool. 3 Severe perianal staining, severely watery stool

[0185] 4. Organ Index

[0186] The organ index is the ratio of the weight of each organ to the relative weight of the individual. After euthanasia of mice, the spleen and thymus are removed, quickly washed with PBS to remove surface blood, blotted dry with filter paper, and weighed and recorded. The organ index is calculated according to formula VII.

[0187] Organ index = organ weight (mg) / relative individual weight (g), Equation VII.

[0188] 5. Measurement of specific antibody levels

[0189] The levels of OVA-specific IgE, IgG1, and IgG2a in the sample were calculated according to the ELISA kit instructions.

[0190] 6. Detection of cytokines and allergy mediators in mouse serum

[0191] The levels of cytokines in mouse serum were measured according to the instructions of the purchased IL-4, IFN-γ, IL-10, LPS, Histamine, and mMCP-1 ELISA kit, and the cytokine content in the sample was calculated.

[0192] 7. Pathological analysis of intestinal inflammation in mice

[0193] After euthanizing the mice, they were dissected in a clean bench, and the cecum and rectum were removed for photographs. The jejunum tissue was removed and stained with hematoxylin and eosin (HE staining) and toluidine blue staining (TB staining).

[0194] 8. Detection of intestinal inflammation in mice

[0195] Take 50 mg of jejunum and prepare the sample according to the kit instructions. Analyze the myeloperoxidase (MPO) activity and lipopolysaccharide (LPS) content in the jejunum.

[0196] 9. Quantitative real-time PCR detection of mouse spleen

[0197] 9.1 RNA extraction and cDNA reverse transcription

[0198] (1) Weigh 40mg of spleen tissue, add 1mL of Trizol and mix thoroughly. Grind the tissue in a tissue grinder for 5min, aspirate the supernatant and transfer it to an enzyme-free centrifuge tube, and let it stand on ice for 5min.

[0199] (2) Add 200 μL of chloroform, shake vigorously for 15 seconds, and let stand at 4°C for 5 minutes.

[0200] (3) Centrifuge at 12000×g at 4℃ for 15min.

[0201] (4) Carefully remove the upper aqueous phase, add an equal volume of isopropanol, invert and mix well, and let stand at 4°C for 10 min.

[0202] (5) Centrifuge at 12000×g at 4℃ for 10 min. A white precipitate is found at the bottom of the centrifuge tube.

[0203] (6) Carefully discard the supernatant, add 1 mL of 75% ethanol, wash by inverting the bowl several times, and let stand for 5 min.

[0204] (7) Centrifuge at 12000×g at 4℃ for 5min and discard the supernatant.

[0205] (8) Allow the RNA to dry thoroughly in a clean, room-temperature environment.

[0206] (9) Add 20 μL of DEPC water to fully dissolve the RNA.

[0207] (10) Removal of genomic DNA reaction.

[0208] (11) RNA reversal

[0209] Table 8. Genome-free system

[0210] reagents Dosage (μL) 4×g DNA wiper Mix 4 Total RNA 1 <![CDATA[RNase Free ddH2O]]> 16

[0211] Mix well and incubate at 42°C for 2 minutes.

[0212] Table 9. Reverse Transcription System

[0213] reagents Dosage (μL) Step (10) Reaction solution 16 5×HiScriptⅡqRT SuperMixⅡ 4.0

[0214] Mix the sample thoroughly, incubate at 50℃ for 15 min, 85℃ for 5 s, and then cool to 4℃. Obtain the cDNA template and store at -80℃. 9.2 qPCR detection of expression of mouse spleen-related inflammatory genes.

[0215] (1) The qPCR primers are shown in the table below. The primers were synthesized by Beijing Liuhe BGI Genomics Co., Ltd.

[0216] Table 10. qPCR primer sequences

[0217] Primer name Sequence (5'to3') IL-4-F GGTCTCAACCCCCAGCTAGT IL-4-R GCCGATGATCTCTCTCAAGTGAT TNF-α-F CCCTCACACTCAGATCATCTTCT TNF-α-R GCTACGACGTGGGCTACAG IL-10-F GCTCTTACTGACTGGCATGAG IL-10-R CGCAGCTCTAGGAGCATGTG TGF-β-F CTCCCGTGGCTTCTAGTGC TGF-β-R GCCTTAGTTTGGACAGGATCTG Foxp3-F CCCATCCCCAGGAGTCTTG FoxP3-R ACCATGACTAGGGGCACTGTA T-bet-F AGCAAGGACGGCGAATGTT T-bet-R GGGTGGACATATAAGCGGTTC Gata3-F CTCGGCCATTCGTACATGGAA Gata3-R GGATACCTCTGCACCGTAGC TLR4-F ATGGCATGGCTTACACCACC TLR4-R GAGGCCAATTTTGTCTCCACA Myd88-F TCATGTTCTCCATACCCTTGGT Myd88-R AAACTGCGAGTGGGGTCAG TRAF6-F AAAGCGAGAGATTCTTTCCCTG TRAF6-R ACTGGGGACAATTCACTAGAGC IκB-F TGGTGTGACTGTGGATCTCTGGAG IκB-R GGCTGGCTTCTCTGTGGTGATTC Ikbkg-F GGATATGAGGAAGCGGCATGTAGAG Ikbkg-R CCTGATACTGGCACTTCGGACAAC β-actin-F GGCTGTATTCCCCTCCATCG β-actin-R CCAGTTGGTAACAATGCCATGT

[0218] The primers were diluted with DEPC water to a final concentration of 10 μM and stored at -20 °C.

[0219] (2) qPCR reaction system

[0220] Table 11. qPCR reaction system

[0221] reagents Dosage (μL) TB Green Premix Ex TapⅡ 10 PCR Froward Primer 0.8 PCR Reverse Primer 0.8 ROX Reference Day (50×) 0.4 DNA template 1 Sterilized water 7 Total 20

[0222] (3) After the sample is thoroughly mixed, the relative expression of mRNA is immediately detected. Reaction conditions: 95℃ for 30s, cyclic reaction: 95℃ for 5s, 60℃ for 30s, 40 cycles. Melting curve: 95℃ for 15s, 60℃ for 1min, 95℃ for 15s. β-actin is an internal reference gene, and gene expression is measured using 2... -ΔΔCT Perform the calculation.

[0223] The experimental results are as follows:

[0224] like Figure 10 As shown, blood was collected weekly from the tail vein during the modeling period to detect the total IgE level in the serum. The IgE level reached its highest point after the modeling process, which is a marker of successful establishment of the food allergy model. Compared with the Model group, the total IgE content in the serum of mice treated with PL6 was significantly decreased, while the PLGG and PH6 treatment groups had no significant effect on the total IgE content. This indicates that low-dose *Lactobacillus paracasei* BHP06 can reduce the increase in total IgE caused by allergies and alleviate allergies.

[0225] from Figure 11 The results showed that the control group mice exhibited normal behavior, with low allergy scores and diarrhea rates. With increasing OVA gavage frequency, the allergy scores and diarrhea rates in the model group mice significantly increased (P<0.01). Compared to the model group mice, the allergy symptom scores in the RH6 and PH6 treatment groups were significantly reduced, and the diarrhea symptoms in the PL6 and PH6 treatment groups were significantly improved, indicating that the allergy symptoms in the mice were significantly alleviated.

[0226] Table 12. Organ Index of Mice

[0227] Group spleen thymus Control <![CDATA[4.73±0.76 c ]]> <![CDATA[1.96±0.13 ab ]]> Model <![CDATA[6.90±0.55 a ]]> <![CDATA[2.40±0.51 a ]]> RLGG <![CDATA[6.04±0.50 b ]]> <![CDATA[2.04±0.51 ab ]]> RL6 <![CDATA[5.92±0.86 b ]]> <![CDATA[1.96±0.54 ab ]]> RH6 <![CDATA[6.09±0.71 b ]]> <![CDATA[1.76±0.44 b ]]> PLGG <![CDATA[6.06±0.58 b ]]> <![CDATA[2.04±0.23 ab ]]> PL6 <![CDATA[6.09±0.51 b ]]> <![CDATA[1.84±0.43 b ]]> PH6 <![CDATA[6.13±0.32 b ]]> <![CDATA[1.88±0.19 b ]]>

[0228] As shown in Table 12, enlargement of the spleen and thymus, immune organs, was observed in the sensitized mice. Compared with the Control group, the organ indices in the Model group were elevated, and after bacterial intervention, the spleen and thymus indices decreased. The spleen is the largest lymphoid organ in animals and a major site for immune responses; the spleen index can reflect the body's immune status to a certain extent. This indicates that the bacterial strain can significantly improve abnormal organ indices and regulate the body's immune status.

[0229] like Figure 12 As shown, the effects of ELISA kits on the levels of OVA-specific antibodies IgE, IgG1, and IgG2a in mouse serum were investigated. The results showed that the control group mice had very low levels of specific antibodies in their serum, while the model group mice had significantly higher levels (P<0.01). Compared to the model group, the treatment groups showed decreased levels of specific antibodies in their serum, and the PH6 group showed significant effects against all three specific antibodies. These results indicate that high-dose prophylactic treatment with *Lactobacillus paracasei* BHP06 can significantly reduce the levels of OVA-specific antibodies in serum, but without a significant concentration-dependent effect.

[0230] like Figure 13As shown, the effects of lactic acid bacteria on serum IL-4, IFN-γ, IL-10, and LPS levels were detected according to the instructions of the purchased ELISA kit. Compared with the control group mice, the Model group mice showed significantly increased serum IL-4, IL-10, and LPS levels, and significantly decreased IFN-γ levels (P<0.01). The RH6 group significantly decreased IL-4 levels and increased IFN-γ levels, the PH6 group significantly decreased IL-10 levels, and the RL6 group showed the best effect in reducing LPS levels.

[0231] like Figure 14 As shown, compared with the control group, the serum levels of histamine and mMCP-1 in the model group mice were significantly increased. Compared with the model group, the serum levels of histamine in the RLGG group mice were significantly decreased, and the serum levels of mMCP-1 in the RH6, PL6, and PH6 groups mice were significantly decreased. When mast cells are activated, they release mediators such as histamine and mMCP-1, which can rapidly trigger allergic reactions, leading to damage to multiple systems in the body.

[0232] like Figure 15 As shown, the feces in the large intestine of mice in the Control group were intact and formed into lumps, while the cecum of mice in the Model group was swollen, and the feces in the large intestine were mostly in a liquid state with few formed feces. It can be observed that after intervention with Lactobacillus rhamnosus ATCC 53103 and Lactobacillus paracasei BHP06, the cecal swelling of mice was relieved, and the fecal morphology of the colon in the PL6 and PH6 groups was similar to that in the Control group, and their effects were better than those in the treatment group.

[0233] like Figure 16 As shown, the intestinal tissue of the Control group was intact, with normal intestinal villi arrangement, intact epithelial cells, and no damage to the intestinal barrier. In contrast, the Model group of mice showed inflammatory cell infiltration in the jejunum, as well as aggregation and infiltration of eosinophils stained red by HE staining. Furthermore, the intestinal barrier was severely damaged, with no obvious intestinal villi arrangement. The intestinal inflammatory response of mice in the RH6 and PH6 groups was improved, and intact intestinal villi arrangement and a tight epithelial cell barrier were observed.

[0234] like Figure 17 As shown, compared with the Control group, mast cell degranulation was observed in the jejunum and colon of the Model group. The Model group showed significant mast cell infiltration in the intestine, with blurred cell outlines and degranulation. However, after intervention with high-dose *Lactobacillus paracasei* BHP06 (RH6 and PH6 groups), the degree of degranulation was reduced, and the number of mast cells decreased. These results suggest that *Lactobacillus paracasei* BHP06 may alleviate allergic reactions by inhibiting mast cell activation.

[0235] like Figure 18As shown, compared with the Control group, allergic mice (Model group) had higher MPO activity (P<0.05) and higher LPS content. The PH6 group significantly reduced MPO activity and LPS content, alleviating intestinal inflammatory infiltration. MPO is a marker of neutrophil activation, and its level and activity represent the function and state of neutrophils.

[0236] like Figure 19 As shown in the AG, the gene expression levels of IL-4 and TNF-α increased in the Model group, reaching 2.728 and 2.808, respectively; compared with the Model group, the gene expression levels in the RH6 and PH6 groups decreased significantly. Regarding the gene expression of IL-10, FOXP3, and TGF-β, compared with the Control group, the gene expression levels in the Model group decreased to 0.355, 0.123, and 0.258, respectively; compared with the Model group, the gene expression levels in the RH6 and PH6 groups increased significantly. This indicates that *Lactobacillus paracasei* BHP06 can protect the spleen by downregulating the gene expression of pro-inflammatory factors IL-4 and TNF-α and upregulating the gene expression of anti-inflammatory factors IL-10, Foxp3, and TGF-β.

[0237] like Figure 19 As shown in Figure HL, compared with the control group mice, the relative expression levels of Myd88, TRAF6, and NF-κB genes in the spleen of the model group mice were significantly increased (P<0.05), indicating that food allergy activates the TLR4 / NF-κB signaling pathway. Both the prevention and treatment groups of *Lactobacillus paracasei* BHP06 significantly reduced the relative expression levels of TLR4, Myd88, TRAF6, and NF-κB genes, while increasing the relative expression level of IκB. *Lactobacillus paracasei* BHP06 intervention reduced Myd88 expression, inhibited the TLR4 / NF-κB pathway, reduced the release of eosinophil chemokines (such as CCL11), and alleviated inflammatory infiltration. In conclusion, *Lactobacillus paracasei* BHP06 may alleviate allergies by inhibiting the TLR4 / NF-κB signaling pathway and reducing the release of pro-inflammatory factors.

[0238] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A strain of Lactobacillus paracasei BHP06, characterized in that, The preservation number of the *Lactobacillus paracasei* is GDMCC No: 66270.

2. A microbial inoculant, characterized in that, The microbial agent contains *Lactobacillus paracasei* BHP06 as described in claim 1.

3. The microbial inoculant according to claim 2, characterized in that, The microbial agent contains the fermentation broth or dried powder of Lactobacillus paracasei BHP06.

4. The microbial inoculant according to claim 3, characterized in that, The fermentation broth is a fermentation culture medium, and the preparation method of the fermentation culture medium includes the following steps: inoculating Lactobacillus paracasei into MRS liquid culture medium and culturing at 37°C for 18 h to obtain the fermentation culture medium.

5. A microbial inoculant according to claim 4, characterized in that, The fermentation broth is either a fermentation supernatant or a bacterial suspension. The fermentation supernatant is obtained by centrifuging the fermentation culture broth, and the bacterial suspension is obtained by resuspending the precipitate after centrifugation of the fermentation culture broth.

6. The microbial inoculant according to claim 3, characterized in that, The dried bacterial powder is a freeze-dried powder.

7. The application of one or more of the following ingredients in improving the anti-allergic ability of animals or improving food allergy symptoms and their complications, characterized in that: (1) The Lactobacillus paracasei BHP06 as described in claim 1; (2) The fermentation broth or dried powder of Lactobacillus paracasei BHP06 as described in claim 1; (3) The microbial agent according to any one of claims 2-4.

8. The application according to claim 7, characterized in that, The symptoms and complications of food allergies include diarrhea and immune disorders.

9. A product for improving an animal's anti-allergic ability and / or allergy symptoms and complications, characterized in that, The product contains one or more of the following active ingredients: (1) The Lactobacillus paracasei BHP06 as described in claim 1; (2) The fermentation broth or dried powder of Lactobacillus paracasei BHP06 as described in claim 1; (3) The microbial agent according to any one of claims 2-4.

Images