Genetically engineered bacterium for producing 4-hydroxyisoleucine as well as construction method and application of genetically engineered bacterium

By heterologously expressing isocitrate dehydrogenase IDH and regulating carbon metabolism factors ramA and gntR in Corynebacterium glutamicum and replacing the promoter of the pfkA gene, the constructed genetically engineered strain solved the problem of low production efficiency in the existing technology and achieved rapid growth and efficient production of 4-hydroxyisoleucine.

CN121046282APending Publication Date: 2025-12-02VERTEXYN BIOWORKS CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511204879.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-27
Publication Date
2025-12-02

AI Technical Summary

Technical Problem

The existing method for producing 4-hydroxyisoleucine using recombinant Corynebacterium glutamicum has problems such as a long strain lag period, slow sugar consumption in the early stage, and long production time, resulting in a long fermentation cycle and low production efficiency.

Method used

The expression of isocitrate dehydrogenase IDH was heterologously expressed and regulated by the strong promoter e11. At the same time, point mutations were performed on carbon metabolism transcription factors ramA and gntR, and the strong promoter e11 was replaced to regulate the expression of the 6-phosphofructokinase gene pfkA, thus constructing a genetically engineered strain.

Benefits of technology

It significantly shortens the fermentation cycle, improves the production efficiency and yield of 4-hydroxyisoleucine, with a production intensity of 0.61 g/L/h, reduces costs, shortens the fermentation cycle, and improves the growth rate and glucose utilization efficiency of the strain.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121046282A_ABST
    Figure CN121046282A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of metabolic engineering, and particularly relates to a genetically engineered bacterium for producing 4-hydroxyisoleucine as well as a construction method and application of the genetically engineered bacterium. Corynebacterium glutamicum is used as a starting strain to replace a strong promoter e11 to regulate the expression of a 6-phosphofructokinase gene pfkA, point mutation is performed on a carbon metabolism transcription factor ramA and / or gntR, and heterologous expression is performed on an isocitrate dehydrogenase gene IDH regulated by the strong promoter e11, so that the genetically engineered bacterium is constructed. The engineering bacterium constructed through gene modification achieves the synergistic effect of rapid growth, advanced entering of a synthesis period and efficient sugar consumption, the overall period of the fermentation process can be remarkably shortened, the production efficiency can be improved, the yield of 4-HIL and the substrate utilization rate can be effectively increased, the yield of 4-HIL can reach 24.32 g / L when the strain is only fermented for 40 h, and the yield of 4-HIL can reach 24.32 g / L when the strain is fermented for 40 h. And the method has good practical application value and economic prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of metabolic engineering technology, specifically relating to a genetically engineered bacterium that produces 4-hydroxyisoleucine, its construction method, and its application. Background Technology

[0002] 4-Hydroxyisoleucine (or 4-HIL, molecular weight 147.17) is a hydroxylated form of L-isoleucine. First discovered in fenugreek seeds in 1973, it accounts for approximately 80% of the seed's free amino acids. 4-HIL can promote insulin secretion and can be used to treat diabetes caused by insulin deficiency and hyperlipidemia caused by high cholesterol. Currently, it is estimated that there are 485 million people with diabetes worldwide, and the mortality rate from diabetes is high in some low-income countries and regions. Therefore, research on 4-HIL, a low-cost and highly effective treatment for diabetes, has broad application prospects.

[0003] The main production methods for 4-hydroxyisoleucine include extraction, chemical synthesis, enzymatic catalysis, and microbial fermentation. Currently, industrial production primarily utilizes fenugreek seed extraction, requiring 6.7 kg of fenugreek seeds to extract 1.0 g of 4-HIL. Therefore, extraction of 4-HIL suffers from low yield, high raw material costs, and complex processes. Future research focuses on de novo chemical synthesis and enzymatic catalysis. Chemical synthesis primarily uses butyl bromoacetate as a substrate, undergoing a series of chemical changes to obtain racemic 4-HIL lactone, which is then catalyzed by a transferase to produce 4-HIL. However, chemical synthesis suffers from complex synthesis, slow reaction rates, poor reaction controllability, and low recovery rates. Subsequent methods employ intermediate product catalysis. Enzymatic catalysis, however, requires expensive substrates and coenzymes, demands stringent reaction conditions, and is prone to producing toxic byproducts, affecting subsequent use. In contrast, microbial fermentation, utilizing microorganisms to produce certain metabolites, offers advantages such as low production costs, high yields, and easy separation, making it the most likely ideal production method.

[0004] In the research field of synthesizing 4-HIL using genetic engineering via microbial fermentation, the main approach involves introducing the isoleucine dioxygenase encoding gene IDO from Bacillus into Escherichia coli, Corynebacterium glutamicum, or Bacillus subtilis to achieve efficient expression. The IDO expressed by the engineered bacteria is then used to convert Ile into 4-HIL. However, current methods for producing 4-HIL using recombinant Corynebacterium glutamicum still suffer from problems such as long strain lag periods, slow initial sugar consumption, and long production times. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a genetically engineered bacterium that produces 4-hydroxyisoleucine, its construction method and application, so as to effectively shorten the fermentation cycle and significantly improve the production efficiency of 4-hydroxyisoleucine.

[0006] To achieve the above objectives, the technical solution adopted by the present invention includes:

[0007] In a first aspect, the present invention provides a genetically engineered bacterium that produces 4-hydroxyisoleucine. The bacterium is based on Corynebacterium glutamicum as the starting strain, heterologously expressing the isocitrate dehydrogenase gene IDH regulated by the strong promoter e11, and making point mutations in the carbon metabolism transcription factors ramA and / or gntR to replace the strong promoter e11 in regulating the expression of the 6-phosphofructokinase gene pfkA, thereby constructing the genetically engineered bacterium.

[0008] Preferably, the mutation site of ramA is the 52nd amino acid, which is mutated from alanine to valine; the gene sequence of ramA after the coding point mutation is shown in SEQ NO.3.

[0009] Preferably, the mutation site of gntR is the 70th amino acid, which is mutated from glutamic acid to lysine; the gene sequence of gntR after the coding point mutation is shown in SEQ NO.4.

[0010] This invention enhances the activity of isocitrate dehydrogenase (IDH) through heterologous expression and regulation of its expression using the strong promoter e11, providing a more sufficient metabolic driving force for the biosynthesis of 4-HIL, thereby increasing the yield and synthesis efficiency of 4-HIL. Furthermore, the ramA mutation strategy can improve the early growth rate of the strain, enabling it to enter the product synthesis stage more quickly; the gntR mutation strategy and the use of the strong promoter e11 to enhance pfkA gene expression can further synergistically improve the growth rate and glucose consumption rate of the strain, promoting rapid cell proliferation and efficient metabolic flux.

[0011] The engineered bacteria constructed through the above-mentioned genetic modification achieve a synergistic effect of rapid growth, early entry into the synthesis phase, and efficient sugar consumption. This not only significantly shortens the overall cycle of the fermentation process and improves production efficiency, but also effectively increases the yield of 4-HIL and substrate utilization. Therefore, it has good practical application value and economic prospects.

[0012] Preferably, the gene sequence of the strong promoter e11 is shown in SEQ NO.2.

[0013] Preferably, the isocitrate dehydrogenase gene IDH is derived from Escherichia coli, and its gene sequence is shown in SEQ NO. 1.

[0014] Preferably, the heterologous expression vector of the isocitrate dehydrogenase gene IDH includes plasmid pK-18mobsacB.

[0015] Secondly, the present invention provides the application of the genetically engineered bacteria in the production of 4-hydroxyisoleucine.

[0016] Preferably, the application method includes the following steps:

[0017] S1. Inoculate the genetically engineered bacteria into the primary seed culture medium for expansion culture until the strain reaches OD. 562 >5, yielding primary seed solution;

[0018] S2. Inoculate the primary seed culture into the secondary seed culture medium and culture until the strain reaches OD. 562 >5, yielding secondary seed solution;

[0019] S3. Transfer the secondary seed culture to the fermentation medium for fermentation, and control the residual sugar concentration of the fermentation system to be maintained below 1 g / L to produce 4-hydroxyisoleucine.

[0020] This invention utilizes a genetically engineered strain to produce 4-hydroxyisoleucine through fermentation. Experimental studies revealed that the residual sugar concentration maintained during fermentation significantly impacts the production efficiency of 4-hydroxyisoleucine. Strictly controlling the residual sugar concentration below 1 g / L satisfies the nutritional requirements for the strain's normal growth and metabolism, providing a stable material basis for its growth. Simultaneously, at this concentration, the strain achieves high glucose utilization efficiency, realizing efficient carbon source conversion, thereby contributing to improved production efficiency and yield of 4-hydroxyisoleucine.

[0021] Preferably, in step S3, the fermentation temperature is controlled at 28-32℃, the pH at 7.0-7.2, the ventilation rate at 1-2 vvm, and the stirring rate at 300-700 rpm.

[0022] Preferably, the primary and secondary seed culture media comprise the following components: glucose 8-12 g / L, (NH4)2SO4 1.5-2 g / L, yeast extract 2-6 g / L, KH2PO4 1-2 g / L, MgSO4·7H2O 0.02-0.06 g / L, FeSO4·7H2O 25-35 mg / L, biotin 90-110 μg / L, and VB1 140-160 μg / L;

[0023] The fermentation medium comprises the following components: glucose 50-70 g / L, (NH4)2SO4 20-30 g / L, yeast extract 10-20 g / L, KH2PO4 1-3 g / L, MgSO4·7H2O 0.02-0.08 g / L, FeSO4·7H2O 40-60 mg / L, biotin 180-220 μg / L, VB1 180-220 μg / L, and cobalt chloride hexahydrate 0.1-0.5 g / L.

[0024] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0025] (1) This invention expresses isocitrate dehydrogenase derived from Escherichia coli and achieves its high-efficiency expression using the strong promoter e11; at the same time, the carbon metabolism transcription factors ramA and gntR are mutated to enhance the expression of the key glycolysis gene pfkA; the above gene manipulations enable the strain to take up glucose more efficiently, grow faster, and produce 4-HIL more efficiently, significantly improving the production intensity of the strain and shortening the fermentation cycle; the strain constructed in this invention can achieve a 4-HIL yield of 24.32 g / L after only 40 h of fermentation, with a production intensity of 0.61 g / L / h, which is the highest level of 4-HIL production reported by Corynebacterium glutamicum, showing the potential to be used as a starting strain for further genetic engineering modification to improve production efficiency; and the increase in production intensity will shorten the fermentation cycle, reduce the necessary expenditures such as fermentation raw materials and water and electricity, greatly reduce costs and increase profits;

[0026] (2) During the fermentation process, the residual sugar concentration is controlled at 0-1 g / L. This concentration can just maintain the normal growth and metabolism of the strain. There will be no excess glucose in the fermentation system. Compared with most fermentations, this strategy can avoid the waste of glucose and enable the strain to make efficient use of glucose. At the same time, since there is no excess glucose in the fermentation system, there is no need to wait for the strain to consume all the glucose before putting it into the tank. This not only improves the production efficiency but also avoids the strain from producing other miscellaneous acids during this period, which reduces the workload for subsequent separation and extraction and lowers the production cost. Attached Figure Description

[0027] Figure 1 The fermentation curve of strain Cg04 in Experiment Example 2 is shown. Detailed Implementation

[0028] To make the objectives, technical solutions, and effects of this invention clearer and more explicit, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

[0029] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0030] Unless otherwise specified in the following examples and comparative examples, the plasmid transformation into E. coli JM109 was carried out using chemical transformation. The chemical transformation method includes the following steps: the transformation system is added to JM109 competent cells that have been thawed on ice, mixed thoroughly in an ice bath, and placed at low temperature for about 10 min. Then, it is heat-shocked at 42°C for 90 s, placed on ice for about 4 min, and then about 850 μL of LB medium is added. The mixture is then incubated at 220 rpm and 37°C for about 40 min. After the incubation is completed, the mixture is centrifuged (10000 rpm, 1 min), 900 μL of supernatant is discarded, and the mixture is mixed with a pipette tip and spread on LB plates containing kanamycin resistance. The mixture is then incubated overnight.

[0031] The electroporation method includes the following steps: A suitable amount of plasmid is added to competent cells and mixed well, then incubated at low temperature for approximately 8 minutes. Next, the competent cells are transferred to a pre-cooled electroporation cuvette, and electroporated at 1.7 kV for approximately 4 ms, repeating twice. Immediately after electroporation, electroporation medium B is added, mixed well, and incubated at 46°C for 6 minutes. Finally, the cells are incubated at 30°C and 120 rpm. -1 Incubate in a shaker for 2 hours. After incubation, centrifuge (10000 rpm, 1 min), discard 900 μL of supernatant, mix thoroughly with a pipette tip, spread onto a plate containing kanamycin-resistant seed, and incubate overnight.

[0032] Detection of 4-hydroxyisoleucine: The 4-HIL content in the fermentation broth was determined by pre-column derivatization of amino acids with OPA, followed by quantitative analysis by HPLC. The specific steps are as follows:

[0033] The fermentation broth was first centrifuged at 12,000 rpm at room temperature for 10 min, and the supernatant was collected. 100 μL of the supernatant was mixed with 25 μL of 10% trichloroacetic acid and allowed to stand for 4 h. Then, 750 μL of ultrapure water was added, and the mixture was centrifuged at 12,000 rpm at room temperature for 10 min. The supernatant was then filtered through a 0.22 μL organic filter membrane. The concentrations of 4-HIL and other miscellaneous acids in the supernatant obtained in the above steps were determined by HPLC. Pre-column derivatization was performed using OPA (o-phthalaldehyde) as the derivatizing reagent. A UV detector with an absorption wavelength of 254 nm and a column temperature of 35 °C was used. The column was an Agilent C18 (150 mm × 4.6 mm, 5 μm).

[0034] HPLC analysis procedure: 0-7 min, mobile phase A - 100%; 7-11 min, mobile phase A - 70%; 11-14 min, mobile phase A - 40%; 14-19 min, mobile phase A - 100%. The preparation methods of the liquid phase reagents are shown in Table 1.

[0035] Table 1

[0036]

[0037] The culture medium formulations used in the following examples and comparative examples are as follows:

[0038] Seed culture medium: glucose 10 g / L, (NH4)2SO4 1.8 g / L, Angel yeast powder FM803 4 g / L, KH2PO4 1.5 g / L, MgSO4·7H2O 0.04 g / L, FeSO4·7H2O 30 mg / L, biotin 100 μg / L and VB1 150 μg / L. Adjust pH to 7.0 and autoclave at 115℃ for 15 min.

[0039] Fermentation medium: glucose 60g / L, (NH4)2SO4 25g / L, Angel Yeast powder FM301 15g / L, KH2PO4 2g / L, MgSO4·7H2O 0.05g / L, FeSO4·7H2O 50mg / L, biotin 200μg / L, VB1 200μg / L and cobalt chloride hexahydrate 0.25g / L, pH adjusted to 7.0, autoclaved at 115℃ for 15min.

[0040] All seed culture media were prepared using ultrapure water. After preparation, the pH of the media was adjusted to 7.0 using 20% ​​NaOH solution. After pH adjustment, the media was dispensed into shake flasks. To ensure adequate dissolved oxygen during seed culture, the volume of liquid in a 250mL shake flask was 30mL, and the volume in a 1000mL shake flask did not exceed 375mL. The fermentation media was not adjusted at this stage; this step was performed after the fermenter sterilization was complete.

[0041] The *Corynebacterium glutamicum* described in this invention is deposited at the China General Microbiological Culture Collection Center (CGMCC), strain number CGMCC NO:1.15673, which is abbreviated as Cg in this invention. The isocitrate dehydrogenase gene IDH is derived from *Escherichia coli*.

[0042] Example 1.4 Construction of HIL-producing strain Cg01

[0043] The gene IDH with the sequence SEQ ID NO.1 was synthesized by a gene synthesis company to obtain a complete gene fragment. This fragment was then ligated into the vector plasmid pK-18mobsacB to obtain plasmid pK-18mobsacB-IDH. Based on this, the e11 strong promoter with the sequence SEQ ID NO.2 was provided to the gene synthesis company, which replaced the original IDH promoter with the e11 strong promoter with the sequence SEQ ID NO.2. After sequencing verification, the plasmid pK-18mobsacB-e11-IDH was transformed into Corynebacterium glutamicum Cg by electroporation. Transformants with correct sequencing results were selected, cultured, and the resulting genetically engineered strain was named Cg01.

[0044] Example 2.4 - Construction of HIL-producing strain Cg02

[0045] Using the Cg01 genome as a template, PCR amplification of the ramA gene fragment containing homologous arms was performed using ramA-F / ramA-R (sequences shown in Table 2) as primers. After confirmation by nucleic acid electrophoresis, the PCR product was recovered from the gel. The plasmid pK-18mobsacB was digested with EcoRI and XbaI, and the purified plasmid product was recovered after digestion. The digested plasmid and the ramA fragment with homologous arms were then ligated using a single-fragment homologous recombinase. This plasmid was then introduced into *E. coli* JM109. Single colonies were subjected to colony PCR, and the correct sequencing of the PCR product confirmed successful construction of the reverse PCR template plasmid.

[0046] Using the plasmid constructed above as a template, and ramA'-F / ramA'-R (sequences shown in Table 2) as primers, the recombinant product was introduced into JM109 after amplification, digestion with Dpn I enzyme, and recombination at the mutation site. The successful sequencing of the colony PCR product of a single colony indicates that the point mutation plasmid was successfully constructed.

[0047] The point mutation plasmid constructed above was then introduced into Cg01 via electroporation. After successful sequencing, it was determined that the ramA mutant strain Cg02 was successfully constructed.

[0048] Table 2

[0049] Primer name Sequence (5'-3') sequence ramA-F CTATGACATGATTACGAATTCGTCGTTACCCATGTTAAAG SEQ NO.5 ramA-R TGCCTGCAGGTCGACTCTAGATTAAGGCCTTATACCGATC SEQ NO.6 ramA'-F CGTACCCCGGTTCTGCAGAATCTGGTCATTGAACC SEQ NO.7 ramA'-R ATTCTGCAGAACCGGGGTACGCAACCCAACCCACT SEQ NO.8

[0050] Example 3.4 - Construction of HIL-producing strain Cg03

[0051] Using the Cg01 genome as a template, the gntR gene fragment containing homologous arms was amplified by PCR using gntR-F / gntR-R (sequences shown in Table 3) as primers. After confirmation by nucleic acid electrophoresis, the PCR product was recovered by gel extraction. The plasmid pK-18mobsacB was digested with EcoRI and XbaI, and the purified plasmid product was recovered after digestion. The digested plasmid and the gntR fragment with homologous arms were then ligated using a single-fragment homologous recombinase. This plasmid was then introduced into *E. coli* JM109. Single colonies were subjected to colony PCR, and the correct sequencing of the PCR product confirmed successful construction of the reverse PCR template plasmid.

[0052] Using the plasmid constructed above as a template, and gntR'-F / gntR'-R (sequence shown in Table 3) as primers, the recombinant product was introduced into JM109 after amplification, digestion with Dpn I enzyme, and recombination at the mutation site. The successful sequencing of the colony PCR product of a single colony indicates that the point mutation plasmid was successfully constructed.

[0053] The point mutation plasmid constructed above was then introduced into Cg02 via electroporation. After sequencing confirmed that the gntR mutant strain Cg03 was successfully constructed.

[0054] Table 3

[0055] Primer name Sequence (5'-3') sequence gntR-F CTATGACATGATTACGAATTCATGACCCCAGCAAACGAAAG SEQ NO.9 gntR-R TGCCTGCAGGTCGACTCTAGATTAGTTCAAGCGTGCCCAGCG SEQ NO.10 gntR'-F GCGCGCTTTGAAGCAGCTCGGTCTTGTCGC SEQ NO.11 gntR'-R CCGAGCTGCTTCAAAGCGCGCATCGCTTCG SEQ NO.12

[0056] Example 4.4 - Construction of HIL-producing strain Cg04

[0057] Using the Cg01 genome as a template, a 500 bp fragment containing homologous arms was synthesized using pfkA1-F / pfkA1-R and pfkA2-F / pfkA2-R (sequences shown in Table 4) as primers. After verification, the purified PCR product was recovered. Simultaneously, plasmid pK-18mobsacB was digested with EcoRI and XbaI, and the purified plasmid product was recovered. The fragment was then ligated to the digested plasmid using a multi-fragment homologous recombinase, and the ligation was introduced into JM109. Single colonies were grown, and colony PCR was performed. Correct sequencing of the PCR product confirmed the successful construction of the pfkA promoter replacement plasmid. Finally, this plasmid was electroporated into Cg03, and correct sequencing confirmed the successful construction of the pfkA-enhanced expression strain Cg04.

[0058] Table 4

[0059]

[0060]

[0061] Experimental Example 1. Investigating the effect of residual sugar concentration on the fermentation of 4-HIL-producing strain Cg04 10L.

[0062] This experiment used strain Cg04, constructed in Example 4, as the fermentation strain to investigate the effect of different residual sugar concentrations in the system on the yield of 4-HIL during fermentation. The specific methods are as follows:

[0063] (1) Seed culture: After activating strain Cg04 on plates, colonies of normal size and color were picked and placed into 250 mL round-bottom conical flasks containing 30 mL of seed culture medium. The flasks were then placed in a reciprocating shaker and cultured at 30 °C / 120 rpm for 10 h to obtain primary seeds. The primary seeds were then inoculated at an inoculation rate of 2% (v / v) into 1000 mL baffle shakers containing 200 mL of seed culture medium and cultured in a reciprocating shaker at 30 °C / 120 rpm for 10 h to obtain secondary seeds.

[0064] (2) 10L Fermentation: The secondary seed from step (1) was inoculated into a 10L fermenter containing 4L of fermentation medium at an inoculation rate of 20% (v / v), resulting in an initial fermentation volume of 5L. Fermentation was then initiated. The pH of the fermentation system was maintained at 7.0-7.2 by adding pure ammonia, and dissolved oxygen was maintained at approximately 10% by coupling the rotation speed and adjusting the aeration rate. When the residual sugar in the fermentation system decreased to different concentrations of 25g / L, 15g / L, 10g / L, 5g / L, and below 1g / L, the feeding rate was calculated to maintain the residual sugar concentration in the fermentation system below 25g / L, 15g / L, 10g / L, 5g / L, and 1g / L, respectively, and the glucose concentration of the feed was 750g / L. During fermentation, the aeration rate was 1.5vvm, the stirring rate was 500rpm, the fermentation temperature was 30℃, and the fermentation cycle was 40h.

[0065] (3) Detection of 4-HIL in fermentation broth: After centrifugation at 12000 rpm for 10 min, the supernatant was collected, diluted several times with ultrapure water, reacted with trichloroacetic acid for several hours, and then derivatized using OPA before column derivatization. The concentration of 4-HIL was then detected by HPLC. The detection conditions were: Agilent C18 (150 mm × 4.6 mm, 5 μm), column temperature 35 ℃, and detection wavelength 254 nm. The specific detection results are shown in Table 5.

[0066] Table 5

[0067]

[0068] Table 5 shows that the lower the residual sugar concentration in the fermentation system, the greater the increase in 4-HIL yield due to the reduction in unit residual sugar. In particular, when the residual sugar concentration is below 1 g / L, the yield increase is more significant. This indicates that in the fermentation method for producing 4-HIL described in this invention, the residual sugar concentration in the fermentation system is significantly negatively correlated with the 4-HIL yield, and a low residual sugar environment (especially 0-1 g / L) is more conducive to the synthesis of 4-HIL by strain Cg04.

[0069] Experimental Example 2. Investigating the effects of different bacterial strains on the fermentation process for 4-HIL production.

[0070] This experiment used strains Cg01, Cg02, Cg03, and Cg04, constructed in Examples 1-4 respectively, as fermentation strains to investigate the effects of different engineered strains on 4-HIL production. The specific methods are as follows:

[0071] (1) Seed culture: After activating strains Cg01, Cg02, Cg03, and Cg04 on plates, colonies of normal size and color were picked and transferred to 250 mL round-bottom conical flasks containing 30 mL of seed culture medium. The flasks were then placed in a reciprocating shaker and cultured at 30 °C / 120 rpm for 10 h to obtain primary seeds. The primary seeds were then inoculated at a rate of 2% (v / v) into 1000 mL baffle shakers containing 200 mL of seed culture medium and cultured in a reciprocating shaker at 30 °C / 120 rpm for 10 h to obtain secondary seeds.

[0072] (2) 10L Fermentation: The secondary seed from step (1) was inoculated into a 10L fermenter containing 4L of fermentation medium at an inoculation rate of 20% (v / v), resulting in an initial fermentation volume of 5L. Fermentation was then initiated. The pH of the fermentation system was maintained at 7.0-7.2 by adding pure ammonia, and dissolved oxygen was maintained at approximately 10% by coupling the rotation speed and adjusting the aeration rate. When the residual sugar in the fermentation system dropped below 1g / L, the feeding rate was calculated to maintain the residual sugar concentration below 1g / L, and the glucose concentration of the feed was 750g / L. During fermentation, the aeration rate was 1.5vvm, the stirring rate was 500rpm, the fermentation temperature was 30℃, and the fermentation cycle was 40h.

[0073] (3) Detection of 4-HIL in fermentation broth: After centrifugation at 12000 rpm for 10 min, the supernatant was collected, diluted several times with ultrapure water, reacted with trichloroacetic acid for several hours, and then derivatized using OPA before column derivatization. The concentration of 4-HIL was then detected by HPLC. The detection conditions were: Agilent C18 (150 mm × 4.6 mm, 5 μm), column temperature 35 ℃, and detection wavelength 254 nm. The specific detection results are shown in Table 6.

[0074] Table 6

[0075]

[0076] Table 6 shows that the combined modification strategy of heterologously expressing the isocitrate dehydrogenase gene IDH regulated by the strong promoter e11 in Corynebacterium glutamicum, and performing point mutations on carbon metabolism transcription factors ramA and gntR, as well as replacing the 6-phosphofructokinase gene pfkA regulated by the strong promoter e11 to enhance its expression, resulted in strain Cg04, which effectively improved the fermentation yield of 4-HIL. The yield of 4-HIL reached 24.32 g / L after only 40 h of fermentation, with a production intensity of 0.61 g / L / h. This not only significantly shortened the fermentation cycle but also increased the production intensity to the highest level of 4-HIL production by Corynebacterium glutamicum to date, providing a new design idea for the efficient biosynthesis of 4-HIL.

[0077] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A genetically engineered bacterium producing 4-hydroxyisoleucine, characterized in that, Using Corynebacterium glutamicum as the starting strain, the isocitrate dehydrogenase gene IDH, which is regulated by the strong promoter e11, was heterologously expressed, and point mutations were made in the carbon metabolism transcription factors ramA and / or gntR to replace the strong promoter e11 in regulating the expression of the 6-phosphofructokinase gene pfkA, thus constructing the genetically engineered strain.

2. The genetically engineered bacteria as described in claim 1, characterized in that, The mutation site of ramA is amino acid 52, which is mutated from alanine to valine; the gene sequence of ramA after the coding point mutation is shown in SEQ NO.

3.

3. The genetically engineered bacteria as described in claim 1, characterized in that, The mutation site of gntR is amino acid 70, which is mutated from glutamic acid to lysine; the gene sequence of gntR after the coding point mutation is shown in SEQ NO.

4.

4. The genetically engineered bacteria as described in claim 1, characterized in that, The gene sequence of the strong promoter e11 is shown in SEQ NO.

2.

5. The genetically engineered bacteria as described in claim 1, characterized in that, The isocitrate dehydrogenase gene IDH is derived from Escherichia coli, and its gene sequence is shown in SEQ NO.

1.

6. The genetically engineered bacteria as described in claim 1, characterized in that, The heterologous expression vector for the isocitrate dehydrogenase gene IDH includes plasmid pK-18mobsacB.

7. The use of the genetically engineered bacteria as described in any one of claims 1-6 in the production of 4-hydroxyisoleucine.

8. The application as described in claim 7, characterized in that, The application method includes the following steps: S1. Inoculate the genetically engineered bacteria into the primary seed culture medium for expansion culture until the strain reaches OD. 562 >5, yielding primary seed solution; S2. Inoculate the primary seed culture into the secondary seed culture medium and culture until the strain reaches OD. 562 >5, yielding secondary seed solution; S3. Transfer the secondary seed culture to the fermentation medium for fermentation, and control the residual sugar concentration of the fermentation system to be maintained below 1 g / L to produce 4-hydroxyisoleucine.

9. The application as described in claim 8, characterized in that, In step S3, the fermentation temperature is controlled at 28-32℃, the pH at 7.0-7.2, the aeration rate at 1-2 vvm, and the stirring rate at 300-700 rpm.

10. The application as described in claim 8, characterized in that, The primary and secondary seed culture media comprise the following components: glucose 8-12 g / L, (NH4)2SO4 1.5-2 g / L, yeast extract 2-6 g / L, KH2PO4 1-2 g / L, MgSO4·7H2O 0.02-0.06 g / L, FeSO4·7H2O 25-35 mg / L, biotin 90-110 μg / L, and VB1 140-160 μg / L; The fermentation medium comprises the following components: glucose 50-70 g / L, (NH4)2SO4 20-30 g / L, yeast extract 10-20 g / L, KH2PO4 1-3 g / L, MgSO4·7H2O 0.02-0.08 g / L, FeSO4·7H2O 40-60 mg / L, biotin 180-220 μg / L, VB1 180-220 μg / L, and cobalt chloride hexahydrate 0.1-0.5 g / L.

Citation Information

Patent Citations

  • Genetically engineered bacterium for producing 4-hydroxyisoleucine and application of genetically engineered bacterium

    CN117866861A