Application of lncPRPD regulation and control of GLRX5 in improvement of pork quality

Abstract

The invention provides application of lncPRPD regulation and control on GLRX5 in improving pork quality, the lncPRPD is lncRNA obtained by performing whole transcriptome sequencing analysis on longissimus dorsi muscle of Laiwu pigs, and the nucleotide sequence of the lncPRPD is as shown in SEQ ID NO: 1. The method comprises the following steps: firstly, synthesizing a small interfering RNA (Ribonucleic Acid) of the lncPRPD / GLRX5 and constructing a gene overexpression vector of the lncPRPD / GLRX5; then, detecting the combination of the lncPRPD and the GLRX5 protein by utilizing a Pulldown experiment and a Western blot experiment; the expression quantity of the GLRX5 is detected after interference and overexpression of the lncPRPD, and it is found that the lncPRPD can promote expression of the GLRX5 protein level; through detection experiments such as qPCR (quantitative polymerase chain reaction), Western blot, oil red O staining and the like, the lncPRPD and the GLRX5 are detected to be capable of promoting the differentiation of the pig precursor fat cells.

Description

Technical Field

[0001] This invention belongs to the fields of cell engineering and genetic engineering technology, specifically relating to the application of lncPRPD regulation of GLRX5 in improving pork quality. Background Technology

[0002] lncRNAs are a class of long non-coding RNA molecules (transcriptigrams exceeding 200 nt) that do not encode proteins themselves. They can influence multiple biological processes through various regulatory mechanisms. lncRNAs can act as decoy molecules, binding to target proteins or miRNAs and altering the intracellular levels of these target molecules, thus affecting their function. lncRNAs can also act as molecular scaffolds, binding to different proteosome complexes to guide the assembly of various macromolecular complexes in target regions for synergistic regulatory effects. Previous studies have shown that lncRNAs can influence adipocyte proliferation and differentiation, thereby affecting adipogenesis. Therefore, research on lncRNAs and their binding proteins is helpful in further promoting adipogenic differentiation of intramuscular adipocytes and improving pork quality.

[0003] lncPRPD (positively regulates preadipocyte differentiation) is a lncRNA obtained from transcriptome sequencing of Laiwu pigs with different intramuscular fat contents. lncPRPD can promote the differentiation of porcine intramuscular preadipocytes and accelerate the formation of lipid droplets.

[0004] GLRX5 is a mitochondrial protein composed of 156 amino acids and is essential for the transfer of iron-sulfur clusters in mitochondria. The effect of GLRX5 on porcine preadipocyte differentiation is currently unclear. Investigating the effects of GLRX5 and its interaction with lncPRPD on porcine preadipocyte differentiation will contribute to a deeper understanding of the regulatory mechanisms of porcine preadipocyte differentiation and is of great significance for improving pork quality. Summary of the Invention

[0005] To address related issues, this invention provides the application of lncPRPD regulating GLRX5 in improving pork quality. First, this invention designs and synthesizes a small interfering RNA (lncPRPD / GLRX5) and constructs its gene overexpression vector. Then, pulldown and Western blot experiments are used to detect the binding of lncPRPD to GLRX5 protein. After interfering with and overexpressing lncPRPD, the expression level of GLRX5 is detected, showing that lncPRPD can promote the expression of GLRX5 protein. qPCR, Western blot, Oil Red O staining, and triglyceride content assays show that both lncPRPD and GLRX5 can promote the differentiation of porcine preadipocytes. This invention provides a theoretical basis for understanding the role of lncRNAs and their interacting proteins in regulating adipogenic differentiation and provides genetic material for improving pork quality.

[0006] The purpose of this invention is to provide the application of lncPRPD regulation of GLRX5 in improving pork quality.

[0007] To achieve the above objectives, the present invention first adopts the following technical solution: a method for regulating the expression of GLRX5 in porcine preadipocytes, characterized in that, under in vitro conditions, lncPRPD positively regulates the expression of GLRX5 in porcine preadipocytes by binding to GLRX5; by adjusting the expression level of lncPRPD to increase or decrease, the expression of GLRX5 in porcine preadipocytes can be regulated; the lncPRPD is a lncRNA obtained by whole transcriptome sequencing analysis of the longissimus dorsi muscle of Laiwu pigs, and its nucleotide sequence is shown in SEQ ID NO: 1.

[0008] Furthermore, the expression of lncPRPD was increased through gene overexpression technology. The gene overexpression vector was prepared in the following ways: (1) RNA was extracted from porcine preadipocytes and reverse transcribed into cDNA. The full-length transcript of lncPRPD was amplified using cDNA as a template. (2) The full-length transcript of lncPRPD and the pcDNA3.1 vector were digested with NheI and NotI enzymes and then ligated together to construct a recombinant vector.

[0009] The primers used in step (1) are as follows: lncPRPD-F:CTTCTCCCTCATTACAATTC (SEQ ID NO: 2); lncPRPD-R:TTCAATCAGAGCCACAGCCG (SEQ ID NO: 3).

[0010] Furthermore, the expression of lncPRPD was reduced by small interfering RNA fragments. The siRNA used was a small double-stranded RNA designed and synthesized specifically for lncPRPD, and the sequence used was as follows: lncPRPD siRNA: CAUUACAAUUCCUCUGCCA (sense strand); UGGCAGAGGAAUUGUAAUG (antisense strand).

[0011] To achieve the above objectives, the present invention also employs the following technical solution: a method for improving pork quality by regulating GLRX5 with lncPRPD, characterized in that, in an in vitro environment, the phenotype of decreased differentiation level and reduced lipid droplet formation in porcine preadipocytes caused by interfering with lncPRPD is restored after exogenously adding a GLRX5 gene overexpression vector; the phenotype of increased differentiation level and increased lipid droplet formation in porcine preadipocytes caused by exogenously increasing lncPRPD expression is inhibited after interfering with GLRX5.

[0012] Furthermore, the exogenous GLRX5 gene overexpression is achieved through overexpression technology. The gene overexpression vector is prepared in the following ways: (1) RNA is extracted from porcine preadipocytes and reverse transcribed into cDNA. The full-length transcript of GLRX5 is amplified using cDNA as a template. (2) The full-length transcript and pcDNA3.1 vector are digested with NheI and NotI enzymes and then ligated together to construct a recombinant vector.

[0013] The primers used in step (1) are as follows: GLRX5-F: 5'-GAGGCTCCTGCTGTCTAACTC-3' (SEQ ID NO: 4); GLRX5-R: 5'-TTCTTCCTTGTCCATCATTTT-3' (SEQ ID NO: 5).

[0014] Furthermore, the decrease in GLRX5 expression was achieved through a small interfering RNA (siRNA) fragment. The siRNA used was a small double-stranded RNA fragment designed and synthesized specifically for GLRX5, and the sequence used is as follows: GLRX5 siRNA: AGACAGAACCAAGACUCGAA (sense chain); UUCGAGUCUUGGUCUGUCU (antisense chain).

[0015] The technical effects of this invention are: 1. In the early stages of this invention, a small interfering RNA for lncPRPD was designed and synthesized, and its gene overexpression vector was constructed. Then, this invention detected the binding of lncPRPD to GLRX5 through RNA pulldown experiments. This invention also detected through Western blot experiments that: after overexpressing lncPRPD, GLRX5 protein expression increased; after interfering with (knocking down) lncPRPD, GLRX5 protein expression decreased.

[0016] 2. This invention, through qPCR experiments, detected that overexpression of lncPRPD increased the differentiation level of porcine preadipocytes, while interference with lncPRPD decreased the differentiation level of porcine preadipocytes. This invention, through Oil Red O staining experiments, detected that overexpression of lncPRPD accelerated lipid droplet formation in porcine preadipocytes, while interference with lncPRPD slowed lipid droplet formation in porcine preadipocytes.

[0017] 3. This invention, through qPCR experiments, detected that overexpression of GLRX5 increased the differentiation level of porcine preadipocytes, while interference with GLRX5 decreased the differentiation level of porcine preadipocytes. This invention, through Oil Red O staining experiments, detected that overexpression of GLRX5 accelerated lipid droplet formation in porcine preadipocytes, while interference with GLRX5 slowed lipid droplet formation in porcine preadipocytes.

[0018] 4. This invention focuses on lncPRPD and GLRX5, employing molecular and cell biology experiments. First, it verified the direct binding of lncPRPD to GLRX5. Then, it examined the regulatory effect of lncPRPD on GLRX5, demonstrating that lncPRPD promotes GLRX5 expression. Further research demonstrated the promoting effect of lncPRPD and GLRX5 on porcine preadipocyte differentiation, proving that lncPRPD regulates GLRX5 to improve pork quality. This invention provides a theoretical basis for understanding the role of lncRNAs and their interacting proteins in regulating adipogenic differentiation, and provides genetic material for improving pork quality. Attached Figure Description

[0019] Figure 1 The results of the experiment to detect the complexes pulled down by lncPRPD and RIP by GLRX5 are shown in the figure. In the figure, a is the Western blot verification of the binding of lncPRPD and GLRX5, and b is the PCR verification of the binding of GLRX5 and lncPRPD. The input is the positive control and the beads are magnetic beads. Figure 2Figure 1 shows the results of a Western blotting study on the effect of lncPRPD on GLRX5 expression; where a represents the effect of lncPRPD knockdown on GLRX5 protein, and b represents the effect of lncPRPD overexpression on GLRX5 protein. Figure 3 Figure 1 shows the results of a study on the effect of lncPRPD on porcine preadipocyte differentiation. Figure 2 shows the effect of lncPRPD siRNA interference detected by qPCR; Figure 3 shows the changes in the mRNA levels of adipocyte differentiation marker genes after lncPRPD interference; Figure 4 shows the changes in the protein levels of adipocyte differentiation marker genes after lncPRPD interference; Figure 5 shows the changes in lipid droplets after lncPRPD interference; Figure 6 shows the effect of lncPRPD overexpression detected by qPCR; Figure 7 shows the changes in the mRNA levels of adipocyte differentiation marker genes after lncPRPD overexpression; Figure 8 shows the changes in lipid droplets after lncPRPD overexpression. Figure 4 Figure 1 shows the results of a study on the effect of GLRX5 on porcine preadipocyte differentiation. Figure 2 shows the effect of GLRX5 siRNA interference detected by qPCR; Figure 3 shows the changes in mRNA levels of adipocyte differentiation marker genes after GLRX5 interference; Figure 4 shows the changes in protein levels of adipocyte differentiation marker genes after GLRX5 interference; Figure 5 shows the changes in lipid droplets after GLRX5 interference; Figure 6 shows the effect of GLRX5 overexpression detected by qPCR; Figure 7 shows the changes in mRNA levels of adipocyte differentiation marker genes after GLRX5 overexpression; Figure 8 shows the changes in lipid droplets after GLRX5 overexpression. Detailed Implementation

[0020] The present invention will be further described in detail below with reference to embodiments, but the implementation of the present invention is not limited thereto. It should be understood that the embodiments described in this specification are merely for explaining the present invention and are not intended to limit the present invention. The parameters, proportions, etc. of the embodiments can be selected according to local conditions without substantially affecting the results. Unless otherwise specified, the reagents and methods used in the embodiments are conventional in the art. Unless otherwise specified, the reagents and raw materials used in the present invention are all commercially available.

[0021] Example 1: 1. Isolation and culture of porcine preadipocytes (1) Wipe the pig body clean with alcohol, take the longissimus dorsi muscle at the last rib, put it into a 15cm culture dish containing PBS, and rinse twice in PBS solution with 3% double antibiotics.

[0022] (2) Remove as much of the fascia on the surface of the muscle as possible, cut it into small pieces in a 50ml centrifuge tube with long scissors, and transfer it to a digestion bottle.

[0023] (3) Add 2 times the volume of the mixed collagenase digestion and lysis solution (by volume ratio, 0.15% type I collagenase: 0.2% type II collagenase = 1:1), package it in a bag and seal it, and digest it in a shaker at 37°C and 120 rpm for 1 hour.

[0024] (4) Add an equal volume of stop solution to stop digestion. Pass the digestion solution through a 70 μm cell sieve, then centrifuge at 3000 rpm for 10 min and discard the supernatant.

[0025] (5) Resuspend the cells in DMEM, filter again through a 40μm cell sieve, centrifuge at 3000 rpm for 10 min, and discard the supernatant.

[0026] (6) Culture the cells in DMEM + 15% FBS + 1% double antibiotic complete medium; after culturing the cells for 4-6 h, discard the culture medium, wash once with PBS, add 15% FBS complete medium, and continue culturing.

[0027] 2. RNA extraction and reverse transcription Total RNA was extracted from porcine preadipocytes using Trizol from Takara. All steps were performed in a clean bench. The specific experimental procedures are as follows: (1) After washing the cells in the six-well plate twice with PBS, add 300 μL of Trizol to each well, let stand on ice for 10 min to fully lyse the cells, centrifuge at 12000 rpm for 5 min, discard the precipitate and aspirate the supernatant into a new 1.5 mL RNase-free EP tube.

[0028] (2) Add 400 μL of chloroform, shake vigorously for 30 seconds, and let stand at room temperature for 15 minutes; (3) Centrifuge at 4℃ and 12500rpm for 15min, and transfer the supernatant to a new 1.5mL RNase-free EP tube; (4) Place isopropanol on ice in advance, add 500 μL of isopropanol to each tube, invert the EP tube 10 times, and let it stand at room temperature for 10 min. (5) Centrifuge at 4℃ and 12500rpm for 10min, discard the supernatant and keep the white flocculent matter; (6) Add 1 mL of 75% ethanol to each tube and invert it to make the RNA float; (7) Centrifuge at 7500 rpm for 5 min at 4℃, discard the ethanol, place on ice and open the lid to dry the RNA; (8) Add 30 μL LEPC water, mix well, and measure the RNA concentration.

[0029] RNA reverse transcription was performed using the TaKaRa PrimeScript FASTR Treagent Kit with gDNA Eraser.

[0030] 3. Construct overexpression vectors for lncPRPD and GLRX5 (1) Construction of recombinant overexpression vector OE-lncPRPD The full-length sequence of lncPRPD was amplified using rapid cDNA end amplification technology and sequenced. Primers for lncPRPD were designed using the obtained sequence. The lncPRPD sequence was aligned to restriction enzyme sites using Primer 5. The results showed that NheI and NotI restriction enzyme sites were absent in lncPRPD. Therefore, NheI and NotI restriction enzyme sites were added to the upstream and downstream ends of the lncPRPD primers. Details are as follows.

[0031] First, RNA extracted from porcine preadipocytes was reverse transcribed to obtain cDNA. The cDNA was then used to amplify the full-length lncPRPD sequence and sequenced. Primers for lncPRPD were designed using the obtained full-length sequence. The recovered full-length lncRNA product and the pcDNA3.1 vector were double-digested with the following enzymes: NheI 1 μL; NotI 1 μL; NEBbuffer 10 μL; recovered product / plasmid 20 μL; digestion overnight. The digested fragments were recovered using a gel extraction kit. Subsequently, the full-length lncPRPD fragment was ligated to pcDNA3.1 using a Takara long fragment ligation kit.

[0032] The sequence of 1ncPRPD (SEQ ID NO: 1): CTTCTCCCTCCATTACAATTCCTCTGCCAGGCCAAGGGGAGAACAACACTGACAGGCGCCCCCCACCCCACCCAGGGGCGGCGGCGGGGCAAGGGGCCGGCTGCTCAGTAAAGGATCCCCCCCAACCCATCCTGCAGCCCGCGCCTCCCCCTTCTTCCGCGCTGCGCACGGATGGCGGCTGGGGCCGCAGAGAAATGGGCTCATATTATAAATGCAGCATCCCCGCCTTCACTCATGACCTGCTGGATGACAACCTACCTTGAACGAGAACCAAGAGCCCAGGAGATGAGGTGTAAGAACAGATTGGCCACATTCCTTGATCACGGCTGCATAGTTTAGTTTCCCACTGTTTGGCAGGGCTCTGGTTTTGTCTCCTGGTCCACTAAAAATGACTGTGCTGACTTGAAGAGTGGAAGGATAAAATGCCACTGCAGGGGTGCAGGCGTATGTGGCTGAGGGTTGATGTTCTGGGCAGAGGAATTGGCACAAGCAAAGATATCAGAGGCGTTCCTGTCGTGGCGCAGCGGAAATGAATCCAACTAGGAACCATGGGGTTGTGAGCTCCATTCCTGGCCTCACTCAGTGGGTTAAGGAGCCGGCGATGCTGTGAGCTGTGGTGTAGGCTGCAGATGTGGCTCGGATCTGATGTTGCTGTGGCTGTGGTGTAGGCTGGCGGCTGTGGCTCTGATTGAACCCCTAGCCCAGGAACCTCCATAAGCTG。

[0033] The full-length primer sequences of lncRNA are as follows: lncPRPD-F: CTTCTCCCTCCATTACAATTC (SEQ ID NO: 2); lncPRPD-R: TTCAATCAGAGCCACAGCCG (SEQ ID NO: 3).

[0034] The transformation experiment using the ligation product was performed as follows: 25 μL of competent cells placed at -80℃ was added to the ligation product; the cells were placed on ice for 30 min; the cells were then incubated in a water bath at 42℃ for 90 s; the cells were placed on ice for 30 min; 1 mL of LB medium was added; the cells were shaken at 37℃ for 1 h; after centrifugation at 4000 rpm for 3 min, approximately 100 μL of liquid was left at the bottom of the tube. After mixing the liquid with a pipette, 20 μL was spread onto a bacterial culture plate and incubated upside down overnight.

[0035] Use a 1μL pipette tip to pick up a complete colony and place it in a centrifuge tube containing 1mL of LB medium. Incubate at 37°C with shaking for 6 hours, and then perform PCR detection.

[0036] Plasmids were extracted using OMEGA's endotoxin-free plasmid extraction kit to obtain the recombinant overexpression vector OE-lncPRPD.

[0037] (2) Construction of GLRX5 overexpression vector The GLRX5 gene sequence (Gene ID: 100154744) was retrieved from the NCBI website, and primers were designed. Sequence alignment results showed that the GLRX5 sequence also lacked the NheI and NotI restriction enzyme sites. The remaining steps for constructing the GLRX5 overexpression vector were the same as above. The GLRX5 primer sequences are as follows: GLRX5-F: 5'-GAGGCTCCTGCTGTCTAACTC-3' (SEQ ID NO: 4); GLRX5-R: 5'-TTCTTCCTTGTCCATCATTTT-3' (SEQ ID NO: 5).

[0038] 4. Inoculation and transfection of porcine preadipocytes (1) After the above porcine preadipocytes reach 70-90% confluence, discard the old culture medium and wash the cells with PBS 1-2 times.

[0039] (2) Add trypsin (enzyme activity 125 CDU / mg) to cover the cell layer and incubate in an incubator for about 3 minutes. Under a microscope, when most cells become round, the edges become shiny, and there is a tendency to detach, immediately add 2-3 times the volume of complete culture medium of trypsin to stop digestion.

[0040] (3) Centrifuge at 1200 rpm, wash cells with PBS, add complete culture medium, gently pipette to mix, and then divide into six-well plates and place in an incubator for culture.

[0041] (4) Transfection is performed when the cells reach 70-90% confluence (usually 16-24 hours after inoculation, transfecting lncPRPD siRNA, GLRX5 siRNA, and overexpression vectors of lncPRPD and GLRX5, respectively). Cell status and confluence are confirmed again under a microscope before transfection. Transfection is performed according to the Invitrogen Lipofectamine 3000 reagent instructions.

[0042] The lncPRPDsiRNA used is a small double-stranded RNA fragment designed and synthesized targeting lncPRPD, and the sequence used is as follows: lncPRPD siRNA:CAUUACAAUUCCUCUGCCA;UGGCAGAGGAAUUGUAAUG.

[0043] The GLRX5 siRNA used is a small double-stranded RNA fragment designed and synthesized targeting GLRX5, and the sequence used is as follows: GLRX5 siRNA:AGACAGACCAAGACUCGAA;UUCGAGUCUUGGUCUGUCU.

[0044] (5) Collect cells at 24h, 48h or 96h after transfection according to the experimental plan.

[0045] 5. Induction of differentiation of porcine preadipocytes: (1) When the density of porcine proadipocytes transfected with siRNA or overexpression vector reaches 100%, contact inhibition is performed for 24 hours.

[0046] (2) Replace the induction differentiation medium I (DMEM / F12 medium containing 1M dexamethasone, 5g / mL insulin and 0.5mM IBMX in 10% FBS) and culture for 2 days. Then replace it with differentiation medium II (DMEM / F12 medium containing 1μg / mL insulin in 10% FBS) and continue culturing. Change the medium every two days.

[0047] RNA and protein were collected 6 days after transfection.

[0048] Example 2: Detection I. Experimental Methods 1. RNA pulldown experiment Pulldown experiment reference Thermo Fisher reagent kit MEGAscript TM T7 Transcript Kit and Pierce TMThe specific steps for using the Magnetic RNA-Protein Pull-Down Kit are as follows: (1) Preparation of biotin-labeled probes: After single-enzyme digestion of the recombinant overexpression vector OE-lncPRPD, an in vitro transcription system was prepared (RNA polymerase Mix 2 μL, ATP / CTP / GTP / UTP ribonucleotide solutions (2 μL each), 10×Reaction Buffer 2 μL, with the remainder water to a final volume of 20 μL). The transcribed RNA was then recovered. Subsequently, the target RNA was labeled with biotin using the kit to obtain a biotin-labeled probe.

[0049] (2) Binding of streptavidin magnetic beads to biotin-labeled probes: Generally, 20-50 μL of magnetic beads is suitable for 25-100 pmol of RNA; the amount of magnetic beads used in this experiment was 50 μL. Add 50 μL of streptavidin magnetic beads to a 1.5 mL EP tube, collect the beads using a magnetic rack, and remove the supernatant. Wash the beads with 50 μL of 20 mM Tris (pH 7.5), resuspending them by pipetting or vortexing. Repeat the washing process twice. Add 50 μL of 1×RNA Capture Buffer, resuspending the beads by pipetting or vortexing. Add 50 pmol of the extracted biotin-labeled target RNA and mix gently. Incubate at room temperature with stirring for 15-30 min.

[0050] (3) RNA binds to protein: Collect the beads using a magnet and remove the supernatant. Wash the beads with 50 μL of 20 mM Tris (pH 7.5), resuspending the magnetic beads by pipetting or vortexing. Repeat the resuspending process twice. Next, prepare the RNA-protein binding reaction mixture as follows: 10 μL of 10× Protein-RNA Binding Buffer, 30 μL of 50% glycerol, 1-30 μL of total protein (concentration >2 mg / ml), and add water to a final volume of 100 μL. Add 100 μL of MasterMix to the RNA-bound beads and gently pipet or vortex to mix. Incubate at 4°C with stirring or rotation for 30-60 min.

[0051] (4) Elution of RNA-protein complexes: Collect the magnetic beads with a magnet and wash them with 100 μL of 1×Wash Buffer. Repeat the above steps, washing 3-5 times in total. Add 60-80 μL of Elution Buffer to the magnetic beads and mix well. Incubate at 37°C with stirring for 30 min. Collect the magnetic beads with a magnet, aspirate the supernatant, add protein loading buffer, and then place in a 100°C water bath for 10 min to denature the protein.

[0052] Proteomic sequencing and Western blotting were used to verify the binding of GLRX5 and lncPRPD. The results are as follows: Figure 1 As shown in a.

[0053] 2. RIP experiment The RIP experiment was performed using the Millipore Magna RIP™ RNA-Binding Protein Immunoprecipitation Kit, and the specific steps are as follows: (1) Binding of magnetic beads to antibodies: Add 50 μL of magnetic bead suspension to each EP tube. Wash briefly with 500 μL of magnetic bead suspension by vortexing. Place the tube on a magnetic rack and discard the supernatant after the magnetic beads aggregate. Repeat the washing once. Resuspend the magnetic beads in 100 μL of RIP wash buffer, add 5 µg of GLRX5 antibody, and incubate at room temperature by rotation for 30 minutes. After brief centrifugation, place the tube on a magnetic rack and discard the supernatant. Add 0.5 mL of RIP wash buffer, vortex, magnetically separate, and discard the supernatant. Repeat the washing once. Finally, add 0.5 mL of RIP wash buffer, vortex, and place on ice for later use.

[0054] (2) RNA-protein binding: Prepare RIP immunoprecipitation buffer (RIP wash buffer: 860 μL; 0.5 M EDTA: 35 μL; RNase inhibitor: 5 μL; 900 μL per reaction). Place the treated antibody-bound magnetic beads and EP tubes on a magnetic rack and discard the supernatant. Add 900 μL of RIP immunoprecipitation buffer to each tube. Collect porcine proadipocyte lysate and centrifuge at 14,000 rpm for 10 minutes at 4°C. Add 100 μL of supernatant to an EP tube containing the magnetic bead-antibody complex and incubate at 4°C for 3 hours to overnight. After brief centrifugation, place on a magnetic rack and discard the supernatant. Resuspend the magnetic beads in 0.5 mL of RIP wash buffer and vortex to mix. Magnetic separation and discard the supernatant; repeat the washing process a total of 6 times.

[0055] (3) RNA purification Prepare proteinase K buffer (RIP wash buffer: 117 μL; 10% SDS: 15 μL; 10 mg / mL proteinase K: 18 μL; 150 μL per precipitate). Resuspend the magnetic bead precipitate from (2) in 150 µL of proteinase K buffer and incubate at 55°C with shaking for 30 minutes to completely digest the protein. After a short centrifugation, place the tube on a magnetic rack and transfer the supernatant to a new EP tube. Add 250 μL of RIP wash buffer to each tube. Add 400 μL of phenol:chloroform:isoamyl alcohol (25:24:1), vortex for 15 seconds, and centrifuge at 14,000 rpm for 10 minutes at room temperature to separate the layers. Carefully aspirate 350 μL of the upper aqueous phase to a new tube. Add 400 μL of chloroform, vortex for 15 seconds, and centrifuge at 14,000 rpm for 10 minutes at room temperature to separate the layers. Carefully aspirate 300 μL of the upper aqueous phase to a new tube. Salt Solution I: 50 μL, Salt Solution II: 15 μL, Precipitate Enhancer: 5 μL, Anhydrous Ethanol: 850 μL. Mix well and precipitate at -80°C for 1 hour to overnight. Centrifuge at 14,000 rpm for 30 minutes at 4°C, carefully discarding the supernatant. Wash the precipitate once with 80% ethanol, centrifuge at 14,000 rpm for 15 minutes at 4°C, discard the supernatant, and air dry. Resuspend the precipitate in 10-20 μL of RNase-free water and store on ice for later use. RNA was then detected by qPCR. The results are shown below. Figure 1 As shown in b.

[0056] 3. Western blot (1) Protein sample preparation: Remove the cell culture medium from the porcine preadipocytes transfected in Example 1, wash them once with PBS, add 200 μL of RIPA lysis buffer (with added PMSF) to each well of a 6-well plate, let stand for 10 min to allow the cells to fully lyse, centrifuge at 12000 rpm for 5 min, and collect the supernatant.

[0057] (2) The total protein extracted was accurately quantified using the BCA method.

[0058] (3) Electrophoresis: Prepare SDS-PAGE gels using the SDS-PAGE gel preparation kit manufactured by Beyotime. Carefully add the denatured protein sample (containing loading buffer) into the gel wells. Place the gel in the electrophoresis tank and add electrophoresis buffer (3.03g Tris, 14.41g Glycine, 1.00g SDS, dissolved in 1L deionized water and mixed well). Turn on the power and initially use a low voltage (e.g., 80V) to compress the sample into a band in the stacking gel. After entering the separating gel, increase the voltage (e.g., 120-150V) for separation. Determine the electrophoresis progress based on the migration position of the bromophenol blue dye. Stop electrophoresis when the dye migrates to the vicinity of the bottom of the gel.

[0059] (4) Transfer: Transfer the separated proteins from the gel to a solid support membrane for subsequent antibody hybridization. Place the clamp into the transfer tank and add transfer buffer (2.9 g glycine, 5.8 g Tris and 0.37 g SDS dissolved in 800 mL deionized water, then add 200 mL methanol). Turn on the power to perform electroblotting.

[0060] (5) Sealing: Place the membrane in a 5% skim milk powder sealing solution and incubate it on a shaker at room temperature for 1-2 hours, or overnight at 4°C (for better results).

[0061] (6) Primary antibody incubation: Dilute the specific primary antibody against the target protein with blocking buffer or TBST at the concentration recommended in the manufacturer's instructions or the concentration optimized in the pre-experiment. Place the blocked membrane in the diluted primary antibody solution and incubate at room temperature for 1-2 hours (shaking) or at 4°C overnight (shaking). Overnight incubation usually results in higher sensitivity and specificity. After incubation, wash the membrane with TBST on a shaker 3-5 times, 5-10 minutes each time, to remove unbound primary antibody and reduce background.

[0062] (7) Secondary antibody incubation: Dilute the enzyme-labeled secondary antibody (commonly HRP-horseradish peroxidase) against the primary antibody source species with blocking buffer or TBST according to the concentration recommended in the instructions. Place the membrane in the diluted secondary antibody solution and incubate on a shaker at room temperature for 1 hour. After incubation, wash the membrane thoroughly with TBST on a shaker 4-6 times, 5-10 minutes each time, to completely remove unbound secondary antibody. Select the appropriate substrate for detection based on the enzyme labeled with the secondary antibody.

[0063] 4. qPCR detection The porcine preadipocytes transfected in Example 1 were subjected to qPCR detection. The experiment was conducted using Takara's TB GreenPremix Ex Taq II FAST qPCR reagent (10 μL system preparation: 5 μL Ex Taq II + 0.2 μL forward primer + 0.2 μL reverse primer + 1 μL template + 3.6 μL water). The PCR reaction program was: 95℃ for 3 min; 95℃ for 10 s, 60℃ for 10 s, 72℃ for 10 s; 35 cycles; 72℃ for 5 min. The expression levels of lncPRPD, GLRX5, and related marker genes SCD, FASN, PPARγ, CEBPα, and FABP3 mRNA were detected.

[0064] 5. Oil Red O staining Porcine preadipocytes were observed under a microscope. After the cells formed significant lipid droplets, they were stained with Oil Red O using Solarbio's Oil Red O staining kit. The specific steps are as follows: (1) Remove the porcine preadipocytes transfected in Example 1 from the cell culture medium, wash twice with PBS, and fix with Oil Red O fixative for 20-30 min.

[0065] (2) Discard the fixative and wash twice with distilled water.

[0066] (3) Add 60% isopropanol and soak for 20-30 seconds.

[0067] (4) After discarding 60% isopropanol, add freshly prepared Oil Red O staining solution and immerse for 10-20 minutes.

[0068] (5) Discard the staining solution and rinse with 60% isopropanol for 20-30 seconds until the stroma is clear. Wash with water 2-5 times until there is no excess staining solution.

[0069] (6) Add Oil Red O buffer for 1 min, then discard.

[0070] (7) Add distilled water to cover the cells and observe them under a microscope.

[0071] 6. Triglyceride content detection The porcine preadipocytes transfected in Example 1 were subjected to triglyceride testing, which was performed according to the instructions of the triglyceride test kit from Nanjing Jiancheng Bioengineering Institute.

[0072] II. Results Analysis 1. Pulldown experiments revealed that the lncPRPD sense chain (justice chain) can pull GLRX5, while the lncPRPD anti-sense chain (anti-sense chain) cannot pull GLRX5. Figure 1 (a) ; RIP experiments showed that lncPRPD binds to GLRX5 but not to SNRNP70. Figure 1 (b)

[0073] 2. The effect of lncPRPD siRNA on GLRX5 protein was detected by Western blot experiment. Figure 2 (a) The results showed that knocking down lncPRPD significantly reduced the protein level of GLRX5; the effect of lncPRPD overexpression vector on GLRX5 protein was detected by Western blot. Figure 2 (b) The results showed that overexpression of lncPRPD significantly promoted the protein level of GLRX5.

[0074] 3. lncPRPD siRNA was transfected into porcine preadipocytes, and RNA and protein were collected 6 days post-transfection. qPCR analysis showed that lncPRPD siRNA significantly reduced lncPRPD expression. Figure 3(a) and significantly reduced the expression levels of lipid deposition-related marker genes SCD, FASN, PLIN1, PPARγ, CEBPα, and FABP3 mRNA. Figure 3 (b) Western blot experiments also showed that lncPRPD siRNA significantly reduced the expression levels of FASN, SCD, and PPARγ proteins. Figure 3 (c)

[0075] 4. The lncPRPD overexpression vector was transfected into porcine preadipocytes, and RNA and protein were collected 6 days post-transfection. qPCR analysis showed that OE-lncPRPD significantly promoted lncPRPD expression. Figure 3 (e) and significantly promote the expression of lipid deposition-related marker genes SCD, FASN, PLIN1, PPARγ, CEBPα, and FABP3 mRNA levels. Figure 3 In addition, Western blot experiments also showed that OE-lncPRPD significantly promoted the expression levels of FASN, SCD, and PPARγ proteins. Figure 3 (g).

[0076] 5. Oil Red O assay results confirmed that lncPRPD siRNA significantly inhibited lipid droplet formation and reduced triglyceride levels. Figure 3 (d).

[0077] 6. Oil Red O experiments confirmed that OE-lncPRPD significantly promotes lipid droplet formation and increases triglyceride content. Figure 3 (h).

[0078] 7. GLRX5 siRNA was transfected into porcine preadipocytes, and RNA and protein were collected 6 days post-transfection. qPCR analysis showed that GLRX5 siRNA significantly reduced GLRX5 expression. Figure 4 (a) and significantly reduced the expression levels of lipid deposition-related marker genes SCD, FASN, PPARγ, CEBPα, and FABP3 mRNA. Figure 4 (b) Western blot experiments also showed that GLRX5 siRNA significantly reduced the expression levels of GLRX5, FASN, SCD, and PPARγ proteins. Figure 4 (c)

[0079] 8. The GLRX5 overexpression vector was transfected into porcine preadipocytes, and RNA and protein were collected 6 days post-transfection. qPCR analysis showed that OE-GLRX5 significantly promoted GLRX5 expression. Figure 4(e) and significantly promote the expression of lipid deposition-related marker genes SCD, FASN, PPARγ, CEBPα, and FABP3 mRNA levels. Figure 4 In addition, Western blot experiments also showed that OE-GLRX5 significantly promoted the expression levels of FASN, SCD, and PPARγ proteins. Figure 4 (g).

[0080] 9. Oil Red O assay results confirmed that GLRX5 siRNA significantly inhibited lipid droplet formation and reduced triglyceride levels. Figure 4 (d).

[0081] 10. Oil Red O experiments confirmed that OE-GLRX5 significantly promotes lipid droplet formation and increases triglyceride content. Figure 4 (h).

Claims

1. Application of lncPRPD regulation of GLRX5 in improving pork quality, wherein the lncPRPD nucleotide sequence is shown in SEQ ID NO:

1.

2. A method for regulating GLRX5 expression in porcine preadipocytes, characterized in that, In vitro, lncPRPD positively regulates the expression of GLRX5 in porcine preadipocytes by binding to GLRX5; the expression of GLRX5 in porcine preadipocytes can be regulated by adjusting the increase or decrease of lncPRPD expression; the nucleotide sequence of lncPRPD is shown in SEQ ID NO:

1.

3. The method as described in claim 2, characterized in that, The expression of lncPRPD was increased by gene overexpression technology. The gene overexpression vector was prepared in the following way: (1) RNA was extracted from porcine preadipocytes and reverse transcribed into cDNA. The full-length transcript of lncPRPD was amplified using cDNA as a template. (2) The full-length transcript of lncPRPD and pcDNA3.1 vector were digested with NheI and NotI enzymes and then ligated together to construct a recombinant vector.

4. The method as described in claim 3, characterized in that, The primers used in step (1) are as follows: lncPRPD-F:CTTCTCCCTCATTACAATTC; lncPRPD-R:TTCAATCAGAGCCACAGCCG.

5. The method as described in claim 2, characterized in that, The expression of lncPRPD was decreased by siRNA interference fragments. The siRNA used was a small double-stranded RNA designed and synthesized for lncPRPD. The sequence used is as follows: lncPRPD siRNA: CAUUACAAUUCCUCUGCCA; UGGCAGAGGAAUUGUAAUG.

6. A method for improving pork quality by regulating GLRX5 using lncPRPD, characterized by: In vitro, the phenotype of decreased porcine preadipocyte differentiation and reduced lipid droplet formation caused by lncPRPD interference was restored after exogenous addition of the GLRX5 gene overexpression vector; the phenotype of increased porcine preadipocyte differentiation and increased lipid droplet formation caused by exogenous increase of lncPRPD expression was inhibited after GLRX5 interference; the nucleotide sequence of lncPRPD is shown in SEQ ID NO:

1.

7. The method of claim 6, characterized in that, The exogenous GLRX5 gene overexpression vector was prepared by the following method: (1) RNA was extracted from porcine preadipocytes and reverse transcribed into cDNA. The full-length transcript of GLRX5 was amplified using cDNA as a template; (2) The full-length transcript and pcDNA3.1 vector were digested with NheI and NotI enzymes and then ligated together to construct a recombinant vector.

8. The method of claim 7, characterized in that, The primers used in step (1) are as follows: GLRX5-F: 5'-GAGGCTCCTGCTGTCTAACTC-3'; GLRX5-R: 5'-TTCTTCCTTGTCCATCATTTT-3'.

9. The method of claim 6, characterized in that, The siRNA used to interfere with GLRX5 is a small double-stranded RNA designed and synthesized specifically for GLRX5. The sequence used is as follows: GLRX5 siRNA: AGACAGACACAGACUCGAA; UUCGAGUCUUGGUCUGUCU.

Images