Method for co-culturing escherichia coli to synthesize muconic acid

Abstract

The invention discloses a method for co-culturing and synthesizing muconic acid by escherichia coli, an engineering bacterium E.coli W6 delta C and an engineering bacterium E.coli MA1 delta C are constructed, the engineering bacterium E.coli W6 delta C and the engineering bacterium E.coli MA1 delta C are co-cultured and fermented to produce and accumulate muconic acid, the upstream path engineering bacterium E.coli W6 delta C is loaded with a plasmid pUC57-Ppdc-aroGELAC-trpEfbr, and the downstream path engineering bacterium E.coli MA1 delta C is a tryptophan knockout strain and is loaded with a pRSFDuet-antABC-catA gene insertion type plasmid. According to the invention, two escherichia coli genetic engineering strains with complementary functions are constructed, and a co-culture strategy is adopted, so that muconic acid synthetic route is modularly split, and continuous and efficient conversion from glucose to a target product is realized.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering, specifically relating to a method for synthesizing mucoconic acid through co-culture of Escherichia coli. Background Technology

[0002] Mucoconic acid, also known as 2,4-hexadienoic acid, is an organic compound with significant industrial value. It can serve as a key intermediate in the conversion into important chemical raw materials such as adipic acid and phthalic acid, thus finding wide applications in textile fiber production, resin synthesis, cosmetic formulation, pharmaceutical active ingredients, and food additives. According to market analysis, the global demand potential for mucoconic acid and its derivatives is enormous, with an estimated annual market size exceeding US$22 billion. The high added value of this compound has made it a focus of attention in the chemical and biomanufacturing sectors. However, the traditional production method of mucoconic acid mainly relies on a chemical synthesis route, namely, the cracking reaction of petrochemical raw materials using heavy metal catalysts. While this method meets industrial needs to some extent, it has significant drawbacks: firstly, the use of heavy metal catalysts leads to the generation of harmful byproducts during the reaction, causing serious environmental pollution, including the emission of wastewater, waste gas, and solid waste; secondly, this route is highly dependent on non-renewable petroleum resources, resulting in high resource consumption and unstable production costs due to fluctuations in crude oil prices. With increasingly stringent global environmental regulations and the growing popularity of sustainable development concepts, traditional chemical synthesis methods are no longer adequate for the requirements of modern industry. Therefore, developing green and sustainable alternative production technologies has become an urgent need for the industry.

[0003] In the field of biosynthesis, researchers have attempted to utilize microorganisms as hosts to synthesize mucoconic acid. Currently reported microbial synthesis methods mainly include two strategies: one is to construct an entire metabolic pathway using a single genetically engineered strain, directly synthesizing the target product from a substrate such as glucose through fermentation; the other is to utilize biocatalysis to transform intermediates under in vitro or semi-in vitro conditions. These methods have achieved the feasibility of biosynthesis to a certain extent and reduced dependence on chemical catalysts. However, these strategies still face challenges: a single strain undertaking the entire complex metabolic pathway significantly increases the metabolic burden on cells, leading to uneven energy distribution, growth inhibition, and low product yield. Simultaneously, intermediates in the pathway tend to accumulate, potentially causing feedback inhibition of downstream reactions and further reducing overall efficiency. Furthermore, existing biosynthetic pathways often involve multiple enzymatic reactions, making it difficult for a single strain to optimize the coordination of all steps, resulting in limited synthetic throughput.

[0004] To overcome the aforementioned problems, co-culture technology, as an emerging modular strategy, has gradually attracted attention. This technology achieves functional division and cooperation by breaking down complex metabolic pathways into multiple modules and integrating them into different strains. Different strains can focus on specific steps, thereby distributing the metabolic burden, increasing pathway throughput, and reducing the toxic accumulation of intermediate products through inter-strain material exchange. This method has proven effective in some biosynthetic systems, such as the production of amino acids or organic acids, significantly improving yield and stability. However, in the field of mucoconic acid biosynthesis, there are no reports of assigning upstream metabolic pathways (such as the shikimic acid pathway from glucose to anthranilic acid) and downstream pathways (such as the conversion from anthranilic acid to mucoconic acid) to different strains and achieving efficient de novo synthesis through co-culture. This reflects the gap in existing technologies regarding pathway modularization and strain cooperation, limiting the industrialization potential of mucoconic acid biosynthesis. Therefore, there is an urgent need to develop an E. coli-based co-culture system to achieve green and efficient production of mucoconic acid and promote the development of bioengineering technology towards a more sustainable direction. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a method for synthesizing mucoacin through co-culture of Escherichia coli.

[0006] The technical solution of the present invention is as follows:

[0007] A method for synthesizing mucocomylic acid by co-culturing Escherichia coli involves constructing engineered strains E. coli W6ΔC and E. coli MA1ΔC, co-culturing and fermenting them to produce and accumulate mucocomylic acid.

[0008] The upstream engineered strain E. coli W6ΔC was loaded with plasmid pUC57-P. pdc -aroGELAC-trpE fbr ,

[0009] The downstream engineered strain, E. coli MA1ΔC, is a tryptophan knockout strain and is loaded with the pRSFDuet-antABC-catA gene insert plasmid.

[0010] In a preferred embodiment of the present invention, the starting strains of both the upstream engineered bacterium E. coli W6ΔC and the downstream engineered bacterium E. coli MA1ΔC are E. coli W3110.

[0011] In a preferred embodiment of the present invention, in the co-culture fermentation, the total inoculum amount of the upstream engineered strain E. coli W6ΔC and the downstream engineered strain E. coli MA1ΔC is 4-6%.

[0012] More preferably, in the co-culture fermentation, the initial inoculation ratio of the upstream engineered bacteria E. coli W6ΔC and the downstream engineered bacteria E. coli MA1ΔC after activation is 5:1.

[0013] More preferably, the activation conditions are: incubation in LB medium at 37°C and 200 rpm for 8-12 h.

[0014] In a preferred embodiment of the present invention, the fermentation medium used for the co-culture fermentation of the two is an inorganic salt medium with the following composition: 5 g / L MOPS, 8 g / L glucose, 6 g / L Na2HPO4, 0.5 g / L NaCl, 3 g / L KH2PO4, 2 g / L NH4Cl, 246.5 mg / L MgSO4, 14.7 mg / L CaCl2, and 10 μg / mL VB1.

[0015] More preferably, the co-culture fermentation conditions are 200 rpm at 37°C for 48-60 h.

[0016] The beneficial effects of this invention are:

[0017] 1. This invention constructs two functionally complementary Escherichia coli genetically engineered strains and adopts a co-culture strategy to modularly decompose the mucoconic acid synthesis pathway, thereby achieving continuous and efficient conversion from glucose to the target product.

[0018] 2. This invention effectively disperses the metabolic burden of a single strain, avoids the inhibition of cell growth by complex pathways, and improves the overall synthesis throughput and product accumulation efficiency.

[0019] 3. By optimizing the inoculation ratio of strains and fermentation conditions, this invention significantly reduces the accumulation of intermediate products and feedback inhibition problems, thereby improving the stability and robustness of the pathway.

[0020] 4. This invention is a green biosynthesis pathway that reduces dependence on heavy metal catalysts and petrochemical resources, lowers the risk of environmental pollution, and meets the industrial requirements for sustainable development.

[0021] 5. This invention provides a new approach for the high-value utilization of mucoconic acid, which helps to expand its application potential in textiles, resin manufacturing, cosmetics, pharmaceuticals and food industries, and promotes innovation in bioengineering technology and industrial upgrading. Attached Figure Description

[0022] Figure 1 The plasmid pUC57-P shown in Example 1 of this invention is shown. pdc -aroG fbr Enzyme digestion fragment verification.

[0023] Figure 2 The plasmid pUC57-P shown in Example 1 of this invention is shown. pdc -aroGEL restriction fragment verification.

[0024] Figure 3 The plasmid pUC57-P shown in Example 1 of this invention is shown. pdc -aroGELAC enzyme digestion fragment verification.

[0025] Figure 4 The plasmid pUC57-P constructed in Example 1 of this invention pdc -aroGELAC-trpE fbr The map.

[0026] Figure 5 The image shows the spectrum of the plasmid pRSFDuet-antABC-catA constructed in Example 2 of this invention.

[0027] Figure 6 This is a schematic diagram of the metabolism of mucoconic acid (MA) synthesized by co-culturing W6ΔC and MA1ΔC in Example 3 of the present invention.

[0028] Figure 7 This is a diagram showing the results of MA production by de novo synthetic strain in Example 3 of the present invention.

[0029] Figure 8 This is a diagram showing the results of co-culturing MA with different inoculation ratios of W6ΔC:MA1ΔC in Example 3 of the present invention. Detailed Implementation

[0030] The technical solution of the present invention will be further explained and described below with reference to specific embodiments and accompanying drawings.

[0031] The primers used in the following examples are specifically shown in the table below:

[0032] Primer Name Sequence pUC57-F ggtttctggtgtggaattgtgagcggataacaatttcac (SEQ ID NO.01) pUC57-R catgagcgtagcctggggtgcctaatgag (SEQ ID NO.02) <![CDATA[P pdc -F]]> gcaccccaggctacgctcatgatcgcggcat (SEQ ID NO.03) <![CDATA[P pdc -R]]> caattccacaccagaaacctctaaagtgtcgttccg (SEQ ID NO.04) <![CDATA[aroG fbr -F- HindIII]]> ggaagcttatgaattatcagaacgacgatttacgcatc (SEQ ID NO.05) <![CDATA[aroG fbr -R- What]]> gggggcccttacccgcgacgcgcttttac (SEQ ID NO.06) E-F ggggtaccaaggagatataccatggaaacctatgctgt (SEQ ID NO.07) E-R ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ cgttgtaaaacgacggccaggtcgacggagctcttaccag (SEQ ID NO.18) <![CDATA[trpE fbr -F-Sac I]]> gagctcaaggagcaacagttatgcaaacacaaaaaccg (SEQ ID NO.19) <![CDATA[trpE fbr -R-Sal I]]> gtcgactcagaaagtctcctgtgcatgatgcg (SEQ ID NO.20) PtrpC-IF ggactagtgagttaagccacttcgctaagttttagagctaga aatagcaagtt (SEQ ID NO.21) PtrpC-IR acatcagtcgatcatagcac (SEQ ID NO.22) DtrpC-IF ctgttcaatgtgctggggccat (SEQ ID NO.23) DtrpC-IR attgttcctttccttaccctcgtgccgcc (SEQ ID NO.24) DtrpC-VF gcacgagggtaaggaaaggaacaatgacaacattacttaac (SEQ ID NO.25) DtrpC-VR gaaccgctatgcaccgggat (SEQ ID NO.26)

[0033] Example 1: Construction of Escherichia coli W6ΔC overexpression via shikimic acid pathway

[0034] (1) Construct tandem plasmids for overexpressing key genes aroG, aroE, aroL, aroA, aroC, and trpE in the shikimic acid pathway:

[0035] a. Plasmid pUC57 (a publicly available plasmid, see https: / / www.snapgene.com / plasmids / basic_cloning_vectors / pUC57 or https: / / www.addgene.org / 54338 / ) was selected as the overexpression vector. PCR amplification was performed using primer pairs pUC57-R and pUC57-F with the above plasmid pUC57 to obtain a 2673 bp vector fragment.

[0036] b. P synthesized by Sangon Biotech (Shanghai) Co., Ltd. pdc The fragment (as shown in SEQ ID NO.27: tacgctcatgatcgcggcatgtcctgatatttttcctctaaaaaagataaaaagtcttttcgcttcggcagaagaggttcatcatgaacaaaaattcggcatttttaaaaatgcctatagctaaatccggaacgacactttagaggtttctgg) was used as a vector, and primer pair P was used. pdc -R and P pdc PCR amplification was performed using the -F group to obtain a 153 bp pyruvate decarboxylase promoter P derived from Zymomonas mobilis. pdc ;

[0037] c. Using seamless cloning technology, the vector fragments obtained in steps a and b are combined with the pyruvate decarboxylase promoter P. pdc Connect them to obtain pUC57-P pdc ;

[0038] (2) aroG fbr This gene was obtained by site-directed mutagenesis at amino acid position 146 of the *E. coli* W3110 *aroG* gene (Asp-146-Asn, GAT-AAT). The primer *aroG* was used. fbr -F-ApaI and aroG fbr -R-HindIII affects the aroG gene fbrpdc The plasmid pUC57-P was obtained by double digestion with ApaI and HindIII, followed by enzyme ligation after recovery. pdc -aroG fbr (Enzyme digestion fragment verification as follows) Figure 1 (As shown).

[0039] (3) Using E. coli W3110 as a template, aroE (858 bp) and aroL (562 bp) were amplified using primer pairs EF and ER and primer pairs LF and LR, respectively. Primers EF and LF were designed to include the RBS sequence. These two fragments were then ligated using primers EF and LR via overlap PCR to obtain aroEL (1400 bp). pUC57-P was amplified using primers Pb-F and Pb-R. pdc -aroG fbr The linearized vector fragment was obtained, and aroEL was amplified using primers EL-F and EL-R to obtain gene fragments with the same sticky ends. These fragments were then ligated using a seamless cloning reagent to obtain pUC57-P. pdc -aroGEL (enzyme digestion fragment verification, as shown) Figure 2 (As shown). aroA (1318 bp) and aroC (1121 bp) from E. coli W3110 were amplified in the same manner and then ligated to pUC57-P. pdc In -aroGEL, pUC57-P is obtained. pdc -aroGELAC (enzyme digestion fragment verification, as shown) Figure 3 (As shown).

[0040] (4) trpE fbr This gene was obtained by site-directed mutagenesis at amino acid position 63 of the trpE gene in E. coli W3110 (Ala-63-Val, GCT-GTC), using primer trpE. fbr -F-Sac I and trpE fbrpdc -aroGELAC was double-digested with Sac I and Sal I, and after recovery, the enzymes were ligated to obtain the following: Figure 4 and plasmid pUC57-P shown in SEQ ID NO.30 pdc -aroGELAC-trpE fbr

[0041] Example 2 Construction of mucoconic acid synthesis pathway in Escherichia coli MA1ΔC

[0042] (1) Construction of gene editing plasmid pTargetF-trpC: First, an N20 fragment targeting trpC was constructed on plasmid pTargetF. Using the original plasmid pTargetF (Jiang YChen BDuan C, Sun BYang J, Yang S 2016. Erratum for Jiang et al., Multigene Editing in the Escherichia coli Genome via the CRISPR-Cas9 System. Appl Environ Microbiol 82:. https: / / doi.org / 10.1128 / AEM.01181-16) as a template, the N20 fragment of the corresponding gene trpC (gagttaagccacttcgctaa, SEQ ID NO.31) was amplified by PCR using PtrpC-IF and PtrpC-IR primer pairs, respectively. The pTargetF and N20-containing trpC modified fragments were double-digested with SpeⅠ and EcoRI, respectively. After DNA agarose gel electrophoresis, the DNA fragments were ligated back to obtain the plasmid pTargetF-trpC, which was then transformed into E. coli DH5α. Streptomycin resistance plate screening was performed on E. coli DH5α / pTargetF-trpC strains, and sequencing verification confirmed the correct pTargetF-trpC plasmid was obtained.

[0043]

[0044] (3) The anthranilic acid synthase gene (antABC, GenBank accession number: AE004091) from *Pseudomonas aeruginosa* and the catechol 1,2-dioxygenase gene (catA, GenBank accession number: AE016853) from *Pseudomonas putida* were codon-optimized and synthesized by Sangon Biotech (Shanghai) Co., Ltd. The anthranilic acid synthase gene and the catechol 1,2-dioxygenase gene were ligated using overlap PCR and inserted into pRSFDuet-1, generating the following gene: Figure 5

[0045] Example 3: Co-culture of upstream and downstream strains to synthesize mucoconic acid

[0046] Using E. coli W6ΔC from Example 1 as the upstream pathway strain and E. coli MA1ΔC from Example 2 as the downstream pathway strain, they were co-cultured to achieve de novo synthesis of mucoconic acid. The specific principle is as follows: Figure 6 As shown.

[0047] The fermentation medium used in this example is an inorganic salt medium with the following formula: MOPS (5 g / L), glucose (8 g / L), Na2HPO4 (6 g / L), NaCl (0.5 g / L), KH2PO4 (3 g / L), NH4Cl (2 g / L), MgSO4 (246.5 mg / L), CaCl2 (14.7 mg / L), and VB1 (10 μg / mL).

[0048] First, the de novo synthesized mucoconic acid strain (i.e., pUC57-P constructed in Example 1) was used. pdc -aroGELAC-trpE fbr Plasmid was introduced into the E. coli MA1ΔC strain obtained in Example 2, so that two pathways coexisted within the cells. As a reference, the strain was inoculated into fermentation medium for single-strain fermentation. The fermentation process is as follows: Figure 7 As shown, 12.1 mg / L mucoconic acid was finally obtained, and a large amount of intermediate products (such as anthranilic acid) accumulated.

[0049] On the other hand, the co-culture operation in this embodiment is as follows: Before fermentation, E. coli W6ΔC and E. coli MA1ΔC were cultured overnight for 12 h in LB medium at 37℃ and 200 rpm. After seed culture, upstream and downstream strains W6ΔC and MA1ΔC were transferred to 25 mL of fermentation medium (total inoculum of 5%) at inoculation ratios of 5:1, 2:1, 1:1, 1:2, and 1:5, respectively. After induction culture at 30℃ and 200 rpm for 48-60 h, the accumulation of metabolites such as mucoconic acid was determined by high performance liquid chromatography. The results showed that when the initial inoculation ratio of 5:1 (W6ΔC:MA1ΔC) was used for co-culture, the system could obtain the highest mucoconic acid yield, which was 51.79 mg / L (e.g., 51.79 mg / L). Figure 8 (As shown). Compared with single-strain fermentation, the yield of mucoconic acid in the co-culture system increased to 428% of the original, while the accumulation of the intermediate product anthranilic acid decreased to 21% of the original, which significantly improved the synthesis efficiency and reduced the inhibition of intermediate products.

[0050] The above description is merely a preferred embodiment of the present invention, and therefore should not be construed as limiting the scope of the present invention. All equivalent changes and modifications made in accordance with the scope of the patent and the contents of the specification should still fall within the scope of the present invention.

Claims

1. A method for synthesizing mucoacin through co-culture of Escherichia coli, characterized in that: Engineered strains E. coli W6ΔC and E. coli MA1ΔC were constructed, and co-cultured and fermented to produce and accumulate kinase. The upstream engineered strain E. coli W6ΔC was loaded with plasmid pUC57-P as shown in SEQ ID NO.

30. pdc -aroGELAC-trpE fbr , The downstream engineered strain, E. coli MA1ΔC, is a tryptophan knockout strain and is loaded with the pRSFDuet-antABC-catA gene insert plasmid as shown in SEQ ID NO.

33.

2. The method as described in claim 1, characterized in that: The starting strains of both the upstream engineered bacterium E. coli W6ΔC and the downstream engineered bacterium E. coli MA1ΔC are E. coli W3110.

3. The method as described in claim 1, characterized in that: In the co-culture fermentation of the two, the total inoculum amount of the upstream engineered strain E. coli W6ΔC and the downstream engineered strain E. coli MA1ΔC is 4-6%.

4. The method as described in claim 3, characterized in that: In the co-culture fermentation, the initial inoculation ratio of the upstream engineered strain E. coli W6ΔC and the downstream engineered strain E. coli MA1ΔC after activation is 5:

1.

5. The method as described in claim 4, characterized in that: The activation conditions were: incubation in LB medium at 37°C and 200 rpm for 8-12 h.

6. The method as described in claim 1, characterized in that: The fermentation medium used for the co-culture of the two was an inorganic salt medium with the following composition: 5 g / L MOPS, 8 g / L glucose, 6 g / L Na2HPO4, 0.5 g / L NaCl, 3 g / L KH2PO4, 2 g / L NH4Cl, 246.5 mg / L MgSO4, 14.7 mg / L CaCl2, and 10 μg / mL VB1.

7. The method as described in claim 6, characterized in that: The conditions for co-culturing and fermenting the two materials are: a rotation speed of 200 rpm and a culture temperature of 37°C for 48-60 h.

Images