Cerebral stroke methylation detection kit and application

By detecting the methylation status of four genes—PAX5, BRCA1, MACO1, and C1orf232—and combining this with quantitative real-time PCR technology, we can provide accurate early diagnosis and risk assessment for stroke, solving the problem of the lack of effective early prediction in existing technologies and achieving efficient stroke screening.

CN121046531APending Publication Date: 2025-12-02QINGDAO RUISIDE MEDICAL LABORATORY CO LTD +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511516058.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-22
Publication Date
2025-12-02

AI Technical Summary

Technical Problem

Current technologies lack effective methods for early prediction and diagnosis of stroke. Imaging examinations are costly and unsuitable for large-scale population screening. Blood biochemical markers have unsatisfactory specificity and sensitivity. Gene methylation, as an early molecular event, has not been fully utilized.

Method used

A combination of stroke biomarkers is provided, including four target genes: PAX5, BRCA1, MACO1, and C1orf232. By combining real-time quantitative PCR technology, the methylation status of these genes is detected, and a specific kit is used for joint detection to determine whether a sample has a stroke risk.

Benefits of technology

It enables early and accurate diagnosis of stroke, provides more precise risk assessment criteria, improves the accuracy and sensitivity of detection, reduces the misdiagnosis rate, and is suitable for large-scale population screening.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121046531A_ABST
    Figure CN121046531A_ABST
Patent Text Reader

Abstract

The invention discloses a cerebral apoplexy methylation detection kit and application thereof. The kit contains specific reagents, namely a PAX5 PCR reaction solution, a BRCA1 PCR reaction solution, a MACO1 PCR reaction solution and a C1orf232 PCR reaction solution, which are used for respectively carrying out methylation detection on cerebral apoplexy related markers PAX5, BRCA1, MACO1 and C1orf232 in a detection sample on the basis of a fluorescent quantitative PCR (Polymerase Chain Reaction) technology; the kit also comprises a positive reference substance and a negative reference substance. The four target genes PAX5, BRCA1, MACO1 and C1orf232 in the detection sample are subjected to methylation joint detection, so that whether the sample has the cerebral apoplexy occurrence risk or not is judged, the difference possibly caused by site selection and a reaction system is effectively supplemented, the randomness of base change is reduced, and the accuracy of cerebral apoplexy risk prediction is improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical testing technology, specifically to a reagent kit for detecting gene methylation in stroke cells based on quantitative real-time PCR technology and its application. Background Technology

[0002] Stroke is a fatal and disabling disease that seriously threatens human health. Its occurrence is a complex process involving multiple factors and gene interactions, including hypertension, diabetes, hyperlipidemia, and heart disease. However, effective early prediction and diagnostic methods are currently lacking in clinical practice, and most patients only receive a definitive diagnosis after the onset of the stroke, missing the optimal treatment and intervention window. Therefore, developing precise and efficient methods for early stroke diagnosis and risk assessment is of great clinical significance for improving stroke prevention and control.

[0003] Currently, commonly used clinical methods for stroke screening include imaging examinations (such as CT and MRI), neurological function assessments, and blood biochemical marker tests. However, these methods often only provide diagnostic evidence for strokes that have already occurred and cannot effectively predict stroke risk. Furthermore, imaging examinations are costly and unsuitable for large-scale population screening; while blood biochemical marker tests are simple, their specificity and sensitivity are not ideal. Meanwhile, gene methylation, as an important component of epigenetics, is an early molecular event in the disease process. Methylation of the gene promoter region usually leads to downregulation of that gene's expression, thereby affecting a series of intracellular molecular signaling pathways and potentially leading to disease. Compared to gene mutations, epigenetic alterations (such as DNA methylation) are more prevalent in the development and progression of diseases. DNA methylation can precisely regulate cell proliferation, apoptosis, and differentiation, and its level is closely related to the biological characteristics of diseases. Therefore, how to utilize gene methylation levels to achieve early diagnosis of stroke is a problem that needs to be solved by those skilled in the art. Summary of the Invention

[0004] To address the shortcomings of existing technologies, the objectives of this invention are twofold: first, to provide a combination of stroke biomarkers to offer a more accurate basis for early prediction of stroke; and second, to provide a stroke methylation detection kit that can perform combined gene methylation detection on the combination of stroke biomarkers provided by this invention, thereby enabling early diagnosis of stroke.

[0005] To achieve the objectives of this invention, the technical solution adopted is as follows: First, the present invention provides a combination of stroke biomarkers, characterized in that it consists of four target genes, PAX5, BRCA1, MACO1 and C1orf232, which are significantly differentially expressed in stroke patients and normal populations.

[0006] The four target genes, PAX5, BRCA1, MACO1, and C1orf232, are all closely related to the risk of stroke. Among them, the NCBI database number of the PAX5 gene sequence is NC_000009.12, and the NCBI database numbers of the BRCA1, MACO1, and C1orf232 genes are NC_000017.11, NC_000001.11, and NC_000001.11, respectively.

[0007] Second, the present invention provides a stroke methylation detection kit, which contains the following specific reagents based on real-time quantitative PCR technology for detecting the methylation of stroke-related biomarkers PAX5, BRCA1, MACO1 and C1orf232 in the test sample: PAX5 PCR reaction solution, BRCA1 PCR reaction solution, MACO1 PCR reaction solution and C1orf232 PCR reaction solution. The kit also contains a positive control and a negative control. The positive control contains a positive control substance selected from the DNA of stroke patients, and the negative control is sterile water.

[0008] The PAX5 PCR reaction solution, BRCA1 PCR reaction solution, MACO1 PCR reaction solution, and C1orf232 PCR reaction solution, based on real-time PCR technology, are used to detect the degree of methylation in at least one target region in the promoter region of the PAX5, BRCA1, MACO1, and C1orf232 genes, respectively.

[0009] The gene promoter region mentioned is not strictly limited to the region located within the promoter segment, but rather to the gene segment in the vicinity of the promoter.

[0010] The PAX5 PCR reaction solution comprises the following components: PAX5 forward and reverse primers, PAX5 probe, internal control ACTB forward and reverse primers, internal control ACTB probe, 10× buffer, dNTP, Taq enzyme, and UNG enzyme; the molar ratio of the PAX5 forward and reverse primers and the PAX5 probe is 3:3:2. The BRCA1 PCR reaction solution comprises the following components: BRCA1 forward and reverse primers, BRCA1 probe, internal control ACTB forward and reverse primers, internal control ACTB probe, 10× buffer, dNTPs, Taq enzyme, and UNG enzyme; the molar ratio of the BRCA1 forward and reverse primers to the BRCA1 probe is 3:3:2. The MACO1 PCR reaction solution comprises the following components: MACO1 forward and reverse primers, MACO1 probe, internal control ACTB forward and reverse primers, internal control ACTB probe, 10× buffer, dNTP mixture, Taq enzyme and UNG enzyme; the molar ratio of the MACO1 forward and reverse primers and the MACO1 probe is 3:3:2. The C1orf232 PCR reaction solution comprises the following components: C1orf232 forward and reverse primers, C1orf232 probe, internal control ACTB forward and reverse primers, internal control ACTB probe, 10× buffer, dNTP mixture, Taq enzyme and UNG enzyme; the molar ratio of the C1orf232 forward and reverse primers to the C1orf232 probe is 3:3:2.

[0011] The PAX5 PCR reaction solution, BRCA1 PCR reaction solution, MACO1 PCR reaction solution, and C1orf232 PCR reaction solution contain hot-start Taq enzymes and uracil-N-glycosylation enzymes.

[0012] The probes contained in the PAX5 PCR reaction solution, BRCA1 PCR reaction solution, MACO1 PCR reaction solution, and C1orf232 PCR reaction solution are labeled with a fluorescent reporter group and a fluorescent quencher group at both ends, respectively. The fluorescent reporter group labeled on the PAX5 probe, BRCA1 probe, and MACO1 probe is different from the fluorescent reporter group labeled on the internal control ACTB probe. The fluorescent reporter groups labeled on both ends of the probes are selected from FAM, HEX, ROX, JOE, VIC, TET, NED, FITC, CY3, or CY5; the fluorescent quencher groups are selected from BHQ1, BHQ2, BHQ3, TAMRA, Eclipse, and DABCYL.

[0013] The nucleotide sequence of the PAX5 forward primer is shown in SEQ ID No. 1, the nucleotide sequence of the PAX5 reverse primer is shown in SEQ ID No. 2, and the nucleotide sequence of the PAX5 probe is shown in SEQ ID No. 3. The nucleotide sequence of the BRCA1 forward primer is shown in SEQ ID No. 4, the nucleotide sequence of the BRCA1 reverse primer is shown in SEQ ID No. 5, and the nucleotide sequence of the BRCA1 probe is shown in SEQ ID No. 6. The nucleotide sequence of the MACO1 forward primer is shown in SEQ ID No. 7, the nucleotide sequence of the MACO1 reverse primer is shown in SEQ ID No. 8, and the nucleotide sequence of the MACO1 probe is shown in SEQ ID No. 9. The nucleotide sequence of the C1orf232 forward primer is shown in SEQ ID No. 10, the nucleotide sequence of the C1orf232 reverse primer is shown in SEQ ID No. 11, and the nucleotide sequence of the C1orf232 probe is shown in SEQ ID No. 12. The nucleotide sequence of the ACTB forward primer is shown in SEQ ID No. 13, the nucleotide sequence of the ACTB reverse primer is shown in SEQ ID No. 14, and the nucleotide sequence of the ACTB probe is shown in SEQ ID No. 15.

[0014] The nucleotide sequences of the gene-specific primers, probes, and internal reference gene primers and probes contained in the detection reagents of the stroke methylation detection kit provided by the present invention are shown in Table 1 below.

[0015] Table 1: Nucleotide sequences of gene-specific primers and probes and internal reference gene primers and probes in the reagents. sequence name nucleotide sequence 5'-3' serial number PAX5 forward primer TAGGTAGGATCGCGATACGGGTT SEQ ID No. 1 PAX5 reverse primer TTTTTTTTGTTTTTGAATGTTTACGTTGGT SEQ ID No. 2 PAX5 probe GCGCGTCGTATTTTCGTAGAGATTGTT SEQ ID No. 3 BRCA1 forward primer TTTTTTGTTTCGTTTTTTTTTTGAT SEQ ID No. 4 BRCA1 reverse primer TGAGTAGTATCGCGTTCGGTAGTTTTAGTTTTAT SEQ ID No. 5 BRCA1 probe TTCGAGGAAGTTAAGGTCGCGTTGG SEQ ID No. 6 MACO1 forward primer GTTTCGCGTTTTCGTTTTGTAG SEQ ID No. 7 MACO1 reverse primer ACGCGCCGACCAATCGAAAATAACGA SEQ ID No. 8 MACO12 probe CGTGGAGTTCGGGTCGTATCGTCGTAT SEQ ID No. 9 C1orf232 forward primer GTTAAGGGGTTAGGAGTAGGGTAGGGAGTA SEQ ID No. 10 C1orf232 reverse primer AACGAAAACCCGCGAAACCATACCCTTCAAT SEQ ID No. 11 C1orf232 probe TCGGTCGGATCGTTTTTGATGACGTTATT SEQ ID No. 12 Internal reference ACTB forward primer TAGGATTTTTATTTAG SEQ ID No. 13 Internal reference ACTB reverse primer TGTGAATTTTTGTTAT SEQ ID No. 14 Internal control ACTB probe TTTTAAGGGAGGAGT SEQ ID No. 15 The application of the stroke methylation detection kit of the present invention in gene methylation detection is characterized by using real-time quantitative PCR technology to detect the gene methylation of four stroke-related biomarkers, PAX5, BRCA1, MACO1, and C1orf232, in the test sample using the PAX5 PCR reaction solution, BRCA1 PCR reaction solution, MACO1 PCR reaction solution, and C1orf232 PCR reaction solution in the kit. Based on the combined detection results of the methylation of the four target genes, the risk of stroke in the sample is determined.

[0016] The detection reagents in the stroke methylation detection kit of this invention, based on real-time quantitative PCR technology, perform joint detection of methylation of four target genes PAX5, BRCA1, MACO1, and C1orf232 in blood samples, specifically including the following steps: S1. Sample extraction, sulfite conversion and preservation S1.1 Extracting cellular DNA from whole blood samples; S1.2 Cell DNA extraction is complete. The extracted DNA is then subjected to bisulfite conversion to obtain a purified Bis-DNA sample. Bis-DNA samples obtained in S1.3 should be tested promptly, or they can be stored at -20°C for testing. The storage period is generally no more than 4 months. For long-term storage, please store at -80°C.

[0017] S2. Gene methylation detection of test samples is performed using the reagents in the stroke methylation detection kit of the present invention. S2.1 Preparation of PCR reaction system for target gene methylation detection Add Bis-DNA sample and PCR reaction solution corresponding to the target gene to the eight-tube array to prepare the PCR reaction system for target gene methylation detection: Add PAX5 PCR reaction solution and Bis-DNA sample to prepare a PCR reaction system for PAX5 gene methylation detection; Add BRCA1 PCR reaction solution and Bis-DNA sample to prepare a BRCA1 gene methylation detection PCR reaction system; Add MACO1 PCR reaction solution and Bis-DNA sample to prepare a PCR reaction system for detecting MACO1 gene methylation; Add C1orf232 PCR reaction solution and Bis-DNA sample to prepare a PCR reaction system for C1orf232 gene methylation detection.

[0018] S2.2. Perform PCR amplification and detection Using purified Bis-DNA as a template, PCR amplification reactions were performed with PAX5 PCR reaction solution, BRCA1 PCR reaction solution, MACO1 PCR reaction solution, and C1orf232 PCR reaction solution, respectively. For the four target genes PAX5, BRCA1, MACO1, and C1orf232, ACTB was selected as the internal reference gene. The target gene and the internal reference ACTB gene were detected simultaneously by multi-channel fluorescent probe labeling, and the ΔCt value of the target gene was obtained (ΔCt value = target Ct value - internal reference Ct value).

[0019] S2.3. Judgment of Test Results Substituting the ΔCt values ​​of the four target genes PAX5, BRCA1, MACO1, and C1orf232 into the logistic regression equation: Y = A0 + A1*X1 + A2*X2 + A3*X3 + A4*X4, where A0, A1, A2, A3, and A4 are clinical coefficients, constant A0 = 6.945, PAX5 proportion coefficient A1 = 0.263, BRCA1 proportion coefficient A2 = -0.439, MACO1 proportion coefficient A3 = -0.55, and C1orf232 proportion coefficient A4 = -0.257; X1, X2, X3, and X4 are the ΔCt values ​​of PAX5, BRCA1, MACO1, and C1orf232, respectively. When Y≥0, the sample is determined to be positive for stroke methylation; when Y<0, the sample is determined to be negative for stroke methylation.

[0020] This invention, based on quantitative real-time PCR technology, performs combined detection of methylation of PAX5, BRCA1, MACO1, and C1orf232 genes in blood cells of test samples. The invention provides a matching method for sample nucleic acid extraction and sulfite conversion. The sulfite-converted DNA is used as a template for the PCR reaction, and the nucleic acid is amplified using specific primers and fluorescent probes contained in the detection reagent of this invention. This enables rapid detection of methylation-related genes PAX5, BRCA1, MACO1, and C1orf232 methylation, providing a simpler and more accurate screening method for clinical use.

[0021] The beneficial effects of this invention are as follows: This invention provides a set of biological markers that can identify truly high-risk individuals, providing a more accurate basis for the early prediction of stroke.

[0022] This invention provides a stroke methylation detection kit. The specific detection reagent contains specific primers and probes designed for target genes. Based on real-time PCR technology, it can achieve rapid methylation detection of target genes. By jointly detecting the methylation of four target genes, PAX5, BRCA1, MACO1, and C1orf232, the randomness of base changes is reduced, and the accuracy of blood cell gene methylation detection is improved, providing a guarantee for early stroke screening. At the same time, the methylation detection region of each target gene contains multiple CpGs, effectively compensating for differences caused by site selection and reaction system, providing a reliable guarantee for early stroke screening and risk assessment. Attached Figure Description

[0023] Figure 1 The present invention relates to the PCR amplification curves of target genes PAX5, BRCA1, MACO1, and C1orf232 methylation in stroke patients during experimental application of this invention. Figure 2 The images show the PCR amplification curves of methylation of target genes PAX5, BRCA1, MACO1, and C1orf232 in normal individuals during the application experiments of this invention. Figure 3 The receiver operating characteristic (ROC) curves were established for 200 test samples used in the application experiment of this invention. Figure 4 This is a comparison table of experimental test results and clinical diagnostic results for the application of this invention; Figure 5 This invention validates the PCR amplification curves of methylation of target genes PAX5, BRCA1, MACO1, and C1orf232 in stroke patients during the experiment. Figure 6This is a verification experiment of the methylation PCR amplification curve of the target gene in a normal human population. Figure 7 This is a comparison table of the detection results and clinical diagnosis results in the verification experiment of this invention. Detailed Implementation

[0024] Example 1

[0025] Example 1 illustrates the screening of stroke biomarker combinations and the preparation of a stroke methylation detection kit according to the present invention.

[0026] (I) Screening of the stroke biomarker combination of the present invention 1. Experimental Samples A total of 39 oral swab samples were collected, including: Case group: 26 cases, all of whom were stroke patients diagnosed by Qingdao Municipal Hospital according to the "Guidelines for the Diagnosis and Treatment of Acute Ischemic Stroke in China"; Control group: 13 cases, who were healthy volunteers of the same age and gender.

[0027] 2. Sample Sources and Ethics All samples were obtained from Qingdao Municipal Hospital and approved by the hospital's ethics committee. All participants signed informed consent forms. The collected clinical information included gender, age, diagnosed disease, and disease symptoms.

[0028] 3. DNA extraction and sulfite conversion Genomic DNA was extracted from oral swabs using a DNA extraction / purification kit from Qingdao Ruiside Medical Laboratory Co., Ltd. Subsequently, 500 ng of genomic DNA was converted to bisulfite using the same company's methylation detection sample pretreatment kit. The converted DNA was then used for downstream analysis.

[0029] 4. Methylation chip detection Methylation expression profiling was performed using an Illumina Infinium HumanMethylation450K BeadChip, strictly following the manufacturer's standard procedures, to obtain a β-value matrix.

[0030] 5. Data Analysis and Biomarker Screening Quality control, normalization, and differential methylation analysis revealed that the promoter methylation levels of PAX5, BRCA1, MACO1, and C1orf232 genes were significantly higher in stroke patients than in the control group, and can serve as methylation biomarkers related to stroke.

[0031] (II) Preparation of the methylation detection kit for stroke of the present invention.

[0032] As a preferred embodiment, the present invention provides a methylation detection kit for stroke, the reagents contained therein, the composition of the reagents and the specifications of the reagents are shown in Table 2 below.

[0033] Table 2: Kit Composition reagents Main ingredients Specification PAX5 PCR reaction solution PAX5 forward primer, PAX5 reverse primer, PAX5 probe, internal control ACTB forward primer, internal control ACTB reverse primer, internal control ACTB probe, 10× buffer, 10mM dNTP mixture, Taq enzyme and UNG enzyme. 400ul BRCA1 PCR reaction solution BRCA1 forward primer, BRCA1 reverse primer, BRCA1 probe, internal control ACTB forward primer, internal control ACTB reverse primer, internal control ACTB probe, 10× buffer, 10mM dNTP mixture, Taq enzyme and UNG enzyme. 400ul MACO1 PCR reaction solution MACO1 forward primer, MACO1 reverse primer, MACO1 probe, internal control ACTB forward primer, internal control ACTB reverse primer, internal control ACTB probe, 10× buffer, 10mM dNTP mixture, Taq enzyme and UNG enzyme. 400ul C1orf232PCR reaction solution C1orf232 forward primer, C1orf232 reverse primer, C1orf232 probe, internal control ACTB forward primer, internal control ACTB reverse primer, internal control ACTB probe, 10× buffer, 10mM dNTP mixture, Taq enzyme and UNG enzyme. 400ul Positive control Hela cell DNA 50ul negative control sterile water 50ul As shown in Table 2, the components of the PAX5 PCR reaction solution of this invention are as follows: PAX5 forward and reverse primers, PAX5 probe, internal control ACTB forward and reverse primers, internal control ACTB probe, 10× buffer, 10 mM dNTP mixture, Taq enzyme, and UNG enzyme. In the PAX5 PCR reaction solution of this invention, the concentration of the PAX5 forward primer is 300 nM, the concentration of the PAX5 reverse primer is 300 nM, and the concentration of the PAX5 probe is 200 nM.

[0034] As shown in Table 2, the BRCA1 PCR reaction solution of this invention comprises the following components: BRCA1 forward and reverse primers, BRCA1 probe, internal control ACTB forward and reverse primers, internal control ACTB probe, 10× buffer, 10 mM dNTP mixture, Taq enzyme, and UNG enzyme. In the BRCA1 PCR reaction solution of this invention, the concentration of the PAX5 forward primer is 300 nM, the concentration of the BRCA1 reverse primer is 300 nM, and the concentration of the BRCA1 probe is 200 nM.

[0035] As shown in Table 2, the components of the MACO1 PCR reaction solution of the present invention are as follows: MACO1 forward and reverse primers, MACO1 probe, internal control ACTB forward and reverse primers, internal control ACTB probe, 10× buffer, 10 mM dNTP mixture, Taq enzyme, and UNG enzyme. In the MACO1 PCR reaction solution of the present invention, the concentration of the MACO1 forward primer is 300 nM, the concentration of the MACO1 reverse primer is 300 nM, and the concentration of the MACO1 probe is 200 nM.

[0036] As shown in Table 2, the components of the C1orf232 PCR reaction solution of this invention are as follows: C1orf232 forward and reverse primers, C1orf232 probe, internal control ACTB forward and reverse primers, internal control ACTB probe, 10× buffer, 10 mM dNTP mixture, Taq enzyme, and UNG enzyme. In the C1orf232 PCR reaction solution of this invention, the concentration of the C1orf232 forward primer is 300 nM, the concentration of the C1orf232 reverse primer is 300 nM, and the concentration of the C1orf232 probe is 200 nM.

[0037] The nucleotide sequences of the gene-specific primers, probes, and internal reference gene primers and probes contained in the PAX5 PCR reaction solution, BRCA1 PCR reaction solution, MACO1 PCR reaction solution, and C1orf232 PCR reaction solution of this invention are shown in Table 1.

[0038] The Taq enzyme contained in the PAX5 PCR reaction solution, BRCA1 PCR reaction solution, MACO1 PCR reaction solution, and C1orf232 PCR reaction solution of this invention is a hot-start Taq enzyme, and the UNG enzyme contained is uracil-N-glycosylation enzyme.

[0039] The PAX5, BRCA1, MACO1, C1orf232, and internal control ACTB probes involved in the PAX5, BRCA1, MACO1, and C1orf232 PCR reaction solutions of this invention are labeled with fluorescent reporter groups and fluorescent quencher groups at both ends. The fluorescent reporter groups labeled on the PAX5, BRCA1, MACO1, and C1orf232 probes are different from those labeled on the internal control ACTB probe. The fluorescent reporter groups labeled on both ends of the probes are selected from FAM, HEX, ROX, JOE, VIC, TET, NED, FITC, CY3, or CY5; the fluorescent quencher groups are selected from BHQ1, BHQ2, BHQ3, TAMRA, Eclipse, and DABCYL.

[0040] In a preferred embodiment, the PAX5 PCR reaction solution of the present invention has a 5' fluorescent reporter group of FAM and a 3' fluorescent quencher group of BHQ1 at its 5' end, and an internal control ACTB probe has a 5' fluorescent reporter group of VIC and a 3' fluorescent quencher group of BHQ1 at its 3' end.

[0041] In the BRCA1 PCR reaction solution of this invention, the 5' end fluorescent reporter group of the BRCA1 probe is FAM, and the 3' end fluorescent quencher group is BHQ1; the 5' end fluorescent reporter group of the internal control ACTB probe is VIC, and the 3' end fluorescent quencher group is BHQ1.

[0042] In the MACO1 PCR reaction solution of this invention, the 5' end fluorescent reporter group of the MACO1 probe is FAM, and the 3' end fluorescent quencher group is BHQ1. The 5' end fluorescent reporter group of the internal control ACTB probe is VIC, and the 3' end fluorescent quencher group is BHQ1.

[0043] In the C1orf232 PCR reaction solution of this invention, the 5' end fluorescent reporter group of the C1orf2322 probe is FAM, and the 3' end fluorescent quencher group is BHQ1. The 5' end fluorescent reporter group of the internal control ACTB probe is VIC, and the 3' end fluorescent quencher group is BHQ1.

[0044] The stroke methylation detection kit used in subsequent experiments adopted the preferred embodiment of the kit in Example 1 in terms of composition and specifications of the detection reagents.

[0045] Example 2 Example 2 illustrates the application of the stroke methylation detection kit of the present invention in gene methylation detection and the establishment of a stroke detection model.

[0046] The application of this stroke methylation detection kit in gene methylation detection: Based on real-time quantitative PCR technology, the kit uses reagents to perform combined methylation detection of four stroke-related markers—PAX5, BRCA1, MACO1, and C1orf232—in the test sample, thereby diagnosing whether the test sample has a stroke risk. The specific steps include: S1. Sample extraction, sulfite conversion and preservation The specific steps are as follows: S1.1. Extract cellular DNA from whole blood samples. After extraction, the concentration of DNA and the OD260 / OD280 ratio were measured using a Nano-500 micro spectrophotometer. The OD260 / OD280 ratio was between 1.8 and 2.0.

[0047] S1.2. After cell DNA extraction is completed, the extracted DNA is subjected to bisulfite conversion, which converts unmethylated cytosine (C) to uracil (U), while methylated cytosine (C) remains unchanged, thus obtaining a purified Bis-DNA sample.

[0048] S1.3. Bis-DNA samples should be tested promptly upon acquisition. Alternatively, they can be stored at -20°C for testing. The storage period is generally no more than 4 months. For long-term storage, please store at -80°C.

[0049] S2. Gene methylation detection of test samples is performed using the reagents in the stroke methylation detection kit of the present invention. S2.1 Preparation of PCR reaction system for target gene methylation detection Add Bis-DNA sample and PCR reaction solution corresponding to the target gene to the eight-tube array to prepare the PCR reaction system for target gene methylation detection: Add 15 μL of PAX5 PCR reaction solution, 2-5 μL of Bis-DNA sample, and purified water up to a final volume of 20 μL per tube to prepare the PAX5 gene methylation detection PCR reaction system. Add 15 μL of BRCA1 PCR reaction solution, 2-5 μL of Bis-DNA sample, and purified water up to a final volume of 20 μL per tube to prepare the BRCA1 gene methylation detection PCR reaction system. Add 15 μL of MACO1 PCR reaction solution, 2-5 μL of Bis-DNA sample, and purified water up to a final volume of 20 μL per tube to prepare the MACO1 gene methylation detection PCR reaction system. Add 15 μL of C1orf232 PCR reaction solution, 2-5 μL of Bis-DNA sample, and purified water up to a final volume of 20 μL per tube to prepare the C1orf232 gene methylation detection PCR reaction system. After the PCR reaction system for detecting the methylation of the target gene is prepared, the caps of the eight-tube strips are tightly closed, and the tubes are centrifuged briefly at low speed. Then, PCR amplification is performed on the PCR instrument.

[0050] The composition of the PCR reaction system for detecting methylation of the target genes PAX5, BRCA1, MACO1, and C1orf232 in this invention is shown in Tables 3-6 below: Table 3: PCR reaction system for PAX5 gene methylation detection constitute Total volume (uL) PAX5 PCR reaction solution 15 Bis-DNA sample 2~5 Purified water up to 20 Table 4: PCR reaction system for BRCA1 gene methylation detection constitute Total volume (uL) BRCA1 PCR reaction solution 15 Bis-DNA sample 2~5 Purified water up to 20 Table 5: PCR reaction system for MACO1 gene methylation detection constitute Total volume (uL) MACO1 PCR reaction solution 15 Bis-DNA sample 2~5 Purified water up to 20 Table 6: PCR reaction system for C1orf232 gene methylation detection constitute Total volume (uL) C1orf232 PCR reaction solution 15 Bis-DNA sample 2~5 Purified water up to 20 S2.2. PCR amplification and detection Select the fluorescence detection channel and set the amplification cycle parameters for the PCR instrument as shown in Table 7. The selection of the fluorescence detection channel corresponds to the fluorescent reporter groups labeled with the target gene probe and the internal control ACTB probe contained in the detection reagents of this invention (PAX5 PCR reaction solution, BRCA1 PCR reaction solution, MACO1 PCR reaction solution, and C1orf232 PCR reaction solution). In the detection reagents used in the embodiments of this invention, the fluorescent reporter groups labeled with the PAX5 probe, BRCA1 probe, MACO1 probe, and C1orf232 probe are all FAM, and the fluorescent reporter group labeled with the internal control ACTB probe is VIC.

[0051] Table 7. Fluorescence detection channel selection and amplification cycle parameter settings step temperature time Cycle number Step 1 (Sex Change) 95°C 30 seconds 1 Step 2 (Amplification) 95°C 10 seconds 45 Step 2 (Amplification) 60°C (fluorescence acquisition) 30 seconds 45 Note: Do not select ROX correction, and select None for quenching groups; after setting, save the file and run the reaction program.

[0052] Using purified Bis-DNA as a template, PCR amplification reactions were performed using primer and probe combinations from the PAX5 PCR reaction solution, BRCA1 PCR reaction solution, MACO1 PCR reaction solution, and C1orf232 PCR reaction solution in the kit of this invention. For the four target genes PAX5, BRCA1, MACO1, and C1orf232, ACTB was selected as the internal reference gene. Simultaneous detection of the target genes (PAX5, BRCA1, MACO1, C1orf232) and the internal reference ACTB gene was achieved using multi-channel fluorescent probe labeling, obtaining the ΔCt value of the target gene (ΔCt value = target Ct value - internal reference Ct value).

[0053] S2.3. Judgment of Test Results Substitute the ΔCt values ​​of the target genes (PAX5, BRCA1, MACO1, C1orf232) obtained in the above steps into the logistic regression equation: Y = A0 + A1*X1 + A2*X2 + A3*X3 + A4*X4, where A0, A1, A2, A3, and A4 are clinical coefficients, and the weighting relationships of the clinical coefficients are as follows: PAX5 proportion coefficient A1 = 0.195, BRCA1 proportion coefficient A2 = -0.694, MACO1 proportion coefficient A3 = 0.366, C1ORF232 proportion coefficient A4 = -1.056, and constant proportion coefficient A0 = 9.234. X1, X2, X3, and X4 are the ΔCt values ​​of PAX5, BRCA1, MACO1, and C1orf232, respectively. When Y ≥ 0, it is determined that the test sample is positive for gene methylation, indicating that the patient has a risk of stroke; when Y < 0, it is determined that the test sample is negative for gene methylation, indicating that the patient does not have a risk of stroke.

[0054] Based on the fluorescence quantitative PCR technology, the present invention jointly detects the methylation of PAX5, BRCA1, MACO1 and C1orf232 genes in the test sample, and accordingly judges whether the sample has a risk of stroke, which provides a new stroke detection model for clinical detection.

[0055] The present invention provides a method for nucleic acid extraction and bisulfite conversion of the sample, uses the bisulfite-converted DNA as the template for the PCR reaction, and uses the specific primers and fluorescent probes contained in the detection reagent of the present invention to amplify the nucleic acid, so as to achieve the rapid detection of methylation of methylation-related genes PAX5, BRCA1, MACO1, and C1orf232, providing a simpler and more accurate screening method for clinical use.

[0056] Example 3 Example 3 is an application experiment of the stroke detection model provided in Example 2 of the present invention.

[0057] Experimental subjects: 73 whole blood samples, and the clinical diagnosis results are as follows: 20 are normal human whole blood samples, and 53 are stroke patient samples.

[0058] For the extraction, bisulfite conversion and preservation of 73 whole blood samples, and for the steps of methylation detection of four stroke-related markers PAX5, BRCA1, MACO1, and C1orf232 in the test sample based on the fluorescence quantitative PCR technology using the reagent, refer to Example 2.

[0059] Using the detection reagent provided by the stroke methylation detection kit of the present invention, methylation detection is performed on four target genes PAX5, BRCA1, MACO1, and C1orf232 in 73 test samples. The specific detection is as follows Figures 1 to 4 shown.

[0060] Figure 1 It is the methylation PCR amplification curve of the target genes PAX5, BRCA1, MACO1, and C1orf232 of stroke patients in the application experiment of the present invention; as shown by Figure 1 the amplification map, the Ct values of the PAX5 gene, BRCA1 gene, MACO1 gene, and C1orf232 gene in stroke patients are all ≤ 32.

[0061] Figure 2PCR amplification curves of the target genes PAX5, BRCA1, MACO1, and C1orf232 in the normal population in the application experiment of the present invention; from Figure 2 The amplification maps shown indicate that in the normal population, the Ct values of the genes PAX5, BRCA1, MACO1, and C1orf232 are all > 32.

[0062] From Figure 1 and Figure 2 It can be seen that there are significant differential expressions of the four target genes PAX5, BRCA1, MACO1, and C1orf232 targeted by the detection reagent of the present invention in stroke patients and the normal population. The four target genes PAX5, BRCA1, MACO1, and C1orf232 are all closely related to the risk of stroke and can be used as markers to distinguish stroke patients from the normal population.

[0063] At the same time, Figure 1 and Figure 2 The amplification maps shown also indicate that the detection reagent provided by the stroke methylation detection kit of the present invention has high sensitivity and specificity for the four target genes PAX5, BRCA1, MACO1, and C1orf232.

[0064] Figure 3 The receiver operating characteristic (ROC) curve established for 73 test samples in the application experiment of the present invention. The detection reagent provided by the stroke methylation detection kit of the present invention performs methylation detection on the corresponding four target genes PAX5, BRCA1, MACO1, and C1orf232 in 73 test samples. The area under the ROC curve (AUC) is 0.967 (95% CI 0.922 - 1; P < 0.001). This indicates that the stroke detection model of the present invention performs methylation combined detection on the four target genes PAX5, BRCA1, MACO1, and C1orf232 and has high detection accuracy, and can significantly distinguish high-risk stroke populations from the normal population.

[0065] Figure 4 Comparison table of the detection results and clinical diagnosis results in the application experiment of the present invention; using the detection reagent provided by the stroke methylation detection kit of the present invention to perform methylation detection on the corresponding four target genes PAX5, BRCA1, MACO1, and C1orf232 in 73 test samples. Among the 53 patients clinically diagnosed with stroke, 51 cases were detected as methylation positive in this application experiment; among the normal population with 20 cases clinically diagnosed as stroke, 18 cases were detected as methylation negative for stroke-related genes in this application experiment.

[0066] The results of the application experiment of this invention were compared with the clinical diagnosis results, and it was found that the detection sensitivity (positive concordance rate) of the stroke detection model of this invention for the target gene was 96.2%, the specificity (negative concordance rate) was 90%, and the accuracy of the application experiment was 94.5%.

[0067] Application Experiment Logistic Regression Analysis The ΔCt values ​​of the target genes (PAX5, BRCA1, MACO1, C1orf232) obtained from this application experiment (73 test samples) were substituted into the logistic regression equation: Y=A0+A1*X1+ A2*X2+A3*X3+A4*X4, where A0, A1, A2, A3, and A4 are clinical coefficients. The weighting relationships of the clinical coefficients are as follows: PAX5 proportion coefficient A1=0.195, BRCA1 proportion coefficient A2=-0.694, MACO1 proportion coefficient A3=0.366, C1ORF232 proportion coefficient A4=-1.056, and constant proportion coefficient A0=9.234. X1, X2, X3, and X4 are the ΔCt values ​​of PAX5, BRCA1, MACO1, and C1orf232, respectively. When Y≥0, the sample is determined to be positive for methylation of stroke-related genes; when Y<0, the sample is determined to be negative for methylation of stroke-related genes.

[0068] By analyzing the methylation fitting regression analysis of four target genes, the combined detection of stroke patients and normal individuals showed a sensitivity and specificity far superior to the detection analysis results of single genes PAX5, BRCA1, MACO1, or C1orf232.

[0069] Example 4 Example 4 is a verification experiment of the stroke detection model provided in Example 2 of the present invention.

[0070] To verify the accuracy of the stroke detection model constructed in this invention, the following verification experiments are provided: Experimental subjects: 200 whole blood samples. Clinical diagnostic results are as follows: 142 cases were stroke patients and 58 cases were normal individuals.

[0071] The extraction, sulfite conversion and preservation of 200 whole blood samples, as well as the steps for detecting the methylation of four stroke-related biomarkers PAX5, BRCA1, MACO1, and C1orf232 in the samples using reagents based on real-time PCR technology, are all described in Implementation 2.

[0072] The methylation of four target genes, PAX5, BRCA1, MACO1, and C1orf232, in 100 test samples was detected using the detection reagents provided in the stroke methylation detection kit of this invention. Specific detection details are as follows: Figures 5 to 7As shown.

[0073] Figure 5 To verify the PCR amplification curves of target genes PAX5, BRCA1, MACO1, and C1orf232 methylation in stroke patients during the experiment of this invention, [the following was observed]. Figure 5 The amplification map shown indicates that the Ct values ​​of the PAX5, BRCA1, MACO1, and C1orf232 genes are all ≤32 in stroke patients.

[0074] Figure 6 To verify the PCR amplification curves of methylation of the target genes PAX5, BRCA1, MACO1, and C1orf232 in normal individuals in the present invention, the following methods were used: Figure 6 The amplification patterns shown indicate that the Ct values ​​of the PAX5, BRCA1, MACO1, and C1orf232 genes are all >32 in the normal population.

[0075] Depend on Figure 5 , Figure 6 It can be seen that the four target genes PAX5, BRCA1, MACO1, and C1orf232 targeted by the detection reagent of this invention show significant differential expression between stroke patients and normal individuals. These genes are all closely related to the progression of stroke and can serve as biomarkers to distinguish between stroke patients and normal individuals. This also demonstrates that the detection reagent provided by the stroke methylation detection kit of this invention has high sensitivity and specificity for the four target genes PAX5, BRCA1, MACO1, and C1orf232.

[0076] Figure 7 This table compares the experimental results with clinical diagnostic results of this invention. Using the detection reagents provided by this invention, methylation detection and comprehensive assessment of four target genes (PAX5, BRCA1, MACO1, and C1orf232) were performed on 200 test samples. The experimental results are as follows: In 142 samples with a clinical diagnosis of stroke, this experimental verification detected 136 positive cases of stroke-related gene methylation; in 58 samples with a clinical diagnosis of normal individuals, this experimental verification detected 53 negative cases of stroke-related methylation.

[0077] The results of the validation experiment were compared with the clinical diagnosis results, and it was found that the stroke detection model provided by this invention has a detection sensitivity (positive concordance rate) of 95.77% for the target gene, that is, a false negative rate of 4.23%; a specificity (negative concordance rate) of 91.38%, that is, a false negative rate of 8.62%; and an overall accuracy of 94.6% for all 180 samples in the validation set.

[0078] In summary, this invention provides a set of stroke-related biomarkers, PAX5, BRCA1, MACO1, and C1orf232, and a stroke methylation detection kit. Based on these, a stroke detection model is constructed. This model utilizes quantitative real-time PCR technology and the reagents in the stroke methylation detection kit to jointly detect the methylation of these four stroke-related biomarkers (PAX5, BRCA1, MACO1, and C1orf232) in test samples, thereby diagnosing the presence of stroke risk in the test samples. This invention improves the accuracy of stroke risk prediction and provides a guarantee for early stroke screening.

Claims

1. A combination of stroke biomarkers, characterized in that, It consists of four target genes, PAX5, BRCA1, MACO1 and C1orf232, which are significantly differentially expressed in stroke patients and normal individuals.

2. A methylation detection kit for stroke, characterized in that, The kit contains the following specific reagents for detecting the methylation of stroke-related biomarkers PAX5, BRCA1, MACO1, and C1orf232 in test samples based on real-time quantitative PCR technology: PAX5 PCR reaction solution, BRCA1 PCR reaction solution, MACO1 PCR reaction solution, and C1orf232 PCR reaction solution. The kit also contains positive and negative controls. The positive control contains a positive control substance selected from the DNA of stroke patients, and the negative control is sterile water.

3. A stroke methylation detection kit according to claim 2, characterized in that, The PAX5 PCR reaction solution, BRCA1 PCR reaction solution, MACO1 PCR reaction solution, and C1orf232 PCR reaction solution, based on real-time PCR technology, are used to detect the degree of methylation in at least one target region in the promoter region of the PAX5, BRCA1, MACO1, and C1orf232 genes, respectively.

4. A stroke methylation detection kit according to claim 2, characterized in that, The PAX5 PCR reaction solution comprises the following components: PAX5 forward and reverse primers, PAX5 probe, internal control ACTB forward and reverse primers, internal control ACTB probe, 10× buffer, dNTPs, Taq enzyme, and UNG enzyme; the molar ratio of the PAX5 forward and reverse primers to the PAX5 probe is 3:3:2; (this ratio does not have an inclusion relationship with the ratio in Example 1). The BRCA1 PCR reaction solution comprises the following components: BRCA1 forward and reverse primers, BRCA1 probe, internal control ACTB forward and reverse primers, internal control ACTB probe, 10× buffer, dNTPs, Taq enzyme, and UNG enzyme; the molar ratio of the BRCA1 forward and reverse primers to the BRCA1 probe is 3:3:

2. The MACO1 PCR reaction solution comprises the following components: MACO1 forward and reverse primers, MACO1 probe, internal control ACTB forward and reverse primers, internal control ACTB probe, 10× buffer, dNTP mixture, Taq enzyme and UNG enzyme; the molar ratio of the MACO1 forward and reverse primers and the MACO1 probe is 3:3:

2. The C1orf232 PCR reaction solution comprises the following components: C1orf232 forward and reverse primers, C1orf232 probe, internal control ACTB forward and reverse primers, internal control ACTB probe, 10× buffer, dNTP mixture, Taq enzyme and UNG enzyme; the molar ratio of the C1orf232 forward and reverse primers to the C1orf232 probe is 3:3:

2.

5. A stroke methylation detection kit according to claim 4, characterized in that, The nucleotide sequence of the PAX5 forward primer is shown in SEQ ID No. 1, the nucleotide sequence of the PAX5 reverse primer is shown in SEQ ID No. 2, and the nucleotide sequence of the PAX5 probe is shown in SEQ ID No.

3. The nucleotide sequence of the BRCA1 forward primer is shown in SEQ ID No. 4, the nucleotide sequence of the BRCA1 reverse primer is shown in SEQ ID No. 5, and the nucleotide sequence of the BRCA1 probe is shown in SEQ ID No.

6. The nucleotide sequence of the MACO1 forward primer is shown in SEQ ID No. 7, the nucleotide sequence of the MACO1 reverse primer is shown in SEQ ID No. 8, and the nucleotide sequence of the MACO1 probe is shown in SEQ ID No.

9. The nucleotide sequence of the C1orf232 forward primer is shown in SEQ ID No. 10, the nucleotide sequence of the C1orf232 reverse primer is shown in SEQ ID No. 11, and the nucleotide sequence of the C1orf232 probe is shown in SEQ ID No.

12. The nucleotide sequence of the ACTB forward primer is shown in SEQ ID No. 13, the nucleotide sequence of the ACTB reverse primer is shown in SEQ ID No. 14, and the nucleotide sequence of the ACTB probe is shown in SEQ ID No.

15.

6. A stroke methylation detection kit according to claim 4, characterized in that, The PAX5 PCR reaction solution, BRCA1 PCR reaction solution, MACO1 PCR reaction solution, and C1orf232 PCR reaction solution contain hot-start Taq enzymes and uracil-N-glycosylation enzymes.

7. The application of a stroke methylation detection kit in gene methylation detection, characterized in that, Based on real-time PCR technology, the PAX5 PCR reaction solution, BRCA1 PCR reaction solution, MACO1 PCR reaction solution, and C1orf232 PCR reaction solution in the kit were used to detect the gene methylation of four stroke-related biomarkers, PAX5, BRCA1, MACO1, and C1orf232, in the test samples. The results of the combined detection of the methylation of the four target genes were used to determine whether the sample had a risk of stroke.