Saccharomyces cerevisiae with low fusel oil yield and high alcohol yield as well as screening method and application of saccharomyces cerevisiae

Abstract

The invention provides saccharomycetes with low fusel oil yield and high alcohol yield as well as a screening method and application of the saccharomycetes, and belongs to the field of wine brewing. The saccharomycetes are Kazachstania humilis HHL-004, the preservation number is CCTCC (China Center for Type Culture Collection) NO: M 2025523, the preservation address is China Center for Type Culture Collection, and the preservation time is 2025-03-18. When a solid-state fermentation method is adopted for brewing, the total fusel oil content is only smaller than or equal to 1.6 g / L, irritant substances in a wine body can be effectively reduced, and the drinking experience is improved; meanwhile, under the same solid-state fermentation process, the wine yield of the strain is greater than or equal to 51.0%, relatively high ethanol production capacity is embodied, and fusel oil reduction effect and wine brewing economy are both considered; in addition, the strain has excellent high-sugar resistance and high-alcohol resistance, and can be adapted to a high-sugar and high-alcohol fermentation environment in a white spirit brewing process.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of brewing, in particular to a yeast strain with low fusel oil yield and high alcohol yield, a screening method and application thereof. BACKGROUND

[0002] Fusel oil is a mixture of fatty alcohols with more than 2 carbon atoms, containing more than 20 components such as isoamyl alcohol, isobutyl alcohol, n-propanol, etc. In the detection spectrum of gas chromatograph, these substances show unique peak shape, in which isoamyl alcohol usually accounts for more than 50% of the total amount, constituting the main feature of fusel oil, and is commonly found in the by-products of grain fermentation for ethanol or beer. These substances are derived from the deamination of amino acids and the branch reaction of sugar metabolism in the fermentation process, and are the metabolic products of yeast in the hypoxic environment to maintain life activities. Fusel oil can combine with organic acids to generate esters with unique aroma, and also has certain toxicity, which can cause dizziness and headache when the content is too high in the human body. In terms of taste, fusel oil is both a carrier and a stimulant. Fusel oil can make the wine body present a comfortable and mellow feeling, and when the content is too high, it will produce a significant throat irritation. Xiaquqingxiang Baijiu (Chinese liquor) adopts the production process of saccharification followed by fermentation, clear steaming and burning, and continuous distillation and ingredient addition. The relatively short fermentation period is one of the reasons why the fusel oil content of Xiaquqingxiang Baijiu is slightly higher than that of other flavor types of Baijiu. High fusel oil content can cause a "head" feeling after drinking, but appropriate amount can give the wine body the "sweet" quality, which is an important support for the Xiaquqingxiang flavor The current industry generally uses a multi-strain co-fermentation system to control the content of fusel oil, for example, by adding ester-producing yeast to compete for and consume precursor substance α-keto acid, thereby inhibiting the generation of fusel oil. However, this method has significant limitations: the metabolic stability of the associated bacteria is poor, and is easily affected by fluctuations in fermentation temperature (a temperature deviation of ±2℃ can cause a 18% fluctuation in the content of fusel oil); and an imbalance in the proportion of the bacterial population can cause a loss of flavor substances, such as a more than 30% decrease in the synthesis of ethyl acetate. The existing patent technology discloses a genetic editing of a yeast strain modification scheme, which reduces the production of isoamyl alcohol by 15%-20% by knocking out genes, but this technology causes a 41% decrease in the absorption efficiency of the strain for valine, thereby affecting the growth rate of the bacterial body. In addition, the traditional process relies on physical separation means of segmented distillation, which can remove high-concentration fusel oil (>2.5g / L) in the head and tail of the wine, but will cause a loss of 12%-15% of high-quality wine liquid, and cannot accurately separate the aroma substances with similar molecular weights (such as the difference in molecular weight between n-propanol and ethyl acetate is only 4.02g / mol). The use of strain modification or physical means can achieve the effect of reducing fusel oil, but there is a possibility of mutation or affecting the liquor yield in the process, therefore, it is more reliable to screen the low-fusel oil-producing strains in nature. SUMMARY

[0003] The application provides a yeast strain with low fusel oil yield and high alcohol yield, and a screening method and application thereof, to solve the technical problem of how to reduce the content of fusel oil in Xiaoqu liquor with high liquor yield during the production of Xiaoqu liquor.

[0004] In a first aspect, the application provides a yeast strain with low fusel oil yield and high alcohol yield, wherein the yeast strain is Candida plicata Kazachstania humilis HHL-004 The accession number is CCTCC NO: M 2025523, the preservation address is China Center for Type Culture Collection, and the preservation time is March 18, 2025.

[0005] Optionally, the 16S rDNA sequence of the yeast strain is shown as SEQ ID NO. 1.

[0006] In a second aspect, the application provides a screening method of the yeast strain with low fusel oil yield and high alcohol yield in the first aspect, and the method comprises the following steps: S1, mixing a sample of Xiaoqu liquor dregs with sterile water, shaking, gradient dilution, and then coating on a YPD solid culture medium and culturing at 28-30°C for 2-3 days to separate single colonies; S2, inoculating the single colonies obtained in step S1 into a lactic acid culture medium and culturing at 28°C for 2-3 days to screen strains with a colony diameter of ≤2 mm; S3, inoculating the screened strains in step S2 into a YPD culture medium and culturing for 48 h, then covering a TTC color developing medium and dark culturing for 3-4 h to screen strains with red color and a chroma ≥ a standard control, to obtain the yeast strain.

[0007] Optionally, the YPD solid culture medium comprises 20 g / L of proteose peptone, 10 g / L of yeast extract, 20 g / L of glucose, and 20 g / L of agar.

[0008] Optionally, the lactic acid culture medium comprises 40 g / L of lactic acid, 5 g / L of ammonium sulfate, 1 g / L of potassium dihydrogen phosphate, 0.1 g / L of sodium chloride, 0.5 g / L of magnesium sulfate, 0.1 g / L of calcium chloride, 0.2 g / L of yeast extract, and 20 g / L of agar.

[0009] In a third aspect, the application provides an application of the yeast strain in the first aspect in liquor production.

[0010] Optionally, the liquor is Xiaoqu liquor.

[0011] Optionally, in a solid-state fermentation process, the yeast strain can make the 60° liquor produced by fermentation of liquor dregs have a fusel oil content of ≤1.6 g / L and a liquor yield of ≥51.0%.

[0012] Optionally, the fusel oil comprises isoamyl alcohol, isobutyl alcohol and n-propyl alcohol, wherein the content of isoamyl alcohol is ≤1.5 g / L, the content of isobutyl alcohol is ≤0.40 g / L, and the content of n-propyl alcohol is ≤0.25 g / L.

[0013] Optionally, the yeast can grow well in an environment with a glucose concentration of 30% and an ethanol concentration of 10% during the liquor brewing process.

[0014] The above technical solutions provided by the embodiments of the present application have the following advantages compared with the prior art: The present application provides a yeast strain with low fusel oil production and high alcohol production, which is Candida plicata Kazachstania humilis HHL-004 , the preservation number of which is CCTCC NO: M 2025523, the preservation address of which is China Center for Type Culture Collection, and the preservation time of which is 2025-03-18. When brewed by solid-state fermentation, the total fusel oil content of the liquor produced by the strain is ≤1.6 g / L after being converted into 60°, which can effectively reduce the irritating substances in the liquor body and improve the drinking experience. At the same time, under the same solid-state fermentation process, the liquor yield (calculated by conversion into 60°) of the strain is ≥51.0%, which reflects strong ethanol production capacity, and takes into account the fusel oil reduction effect and the economy of liquor brewing. In addition, the strain has excellent high-sugar and high-alcohol tolerance. In a YPD liquid medium with a glucose concentration of 30%, the strain can still grow well. In a YPD liquid medium with an ethanol concentration of 10%, the growth state is also stable, which can adapt to the high-sugar and high-alcohol fermentation environment in the liquor brewing process. BRIEF DESCRIPTION OF DRAWINGS

[0015] The drawings incorporated into the specification and forming a part thereof, illustrate embodiments consistent with the present application and, together with the specification, serve to explain the principles of the present application.

[0016] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or the prior art description will be briefly introduced as follows. Obviously, for those skilled in the art, other drawings can also be obtained from these drawings without creative labor.

[0017] Figure 1 The flowchart of the screening method of the yeast strain with low fusel oil production and high alcohol production provided by the embodiments of the present application is shown in the figure. Figure 2 The Candida plicata provided by the embodiments of the present application is shown in the figure. HHL-004 The colony map of the Candida plicata on the YPD solid medium is shown in the figure. Figure 3 The Candida plicata provided by the embodiments of the present application is shown in the figure. HHL-004The morphology of the bacteria under a microscope. DETAILED DESCRIPTION

[0018] In order to make the purposes, technical solutions and advantages of the embodiments of the present application clearer, the technical solutions in the embodiments of the present application will be described clearly and completely below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments of the present application. Based on the embodiments in the present application, all other embodiments obtained by a person of ordinary skill in the art without creative labor fall within the scope of protection of the present application.

[0019] Unless otherwise specifically stated, various raw materials, reagents, instruments and equipment used in the present application can be purchased from the market or prepared by existing methods.

[0020] In a first aspect, the present application provides a yeast strain with low fusel oil yield and high alcohol yield, which is Candida plicata Kazachstania humilis HHL-004 , the preservation number of which is CCTCC NO: M2025523, the preservation address of which is China Center for Type Culture Collection, and the preservation time of which is 2025-03-18.

[0021] In some embodiments, the 16S rDNA sequence of the yeast strain is shown in SEQ ID NO. 1.

[0022] It should be noted that the "molecular tag" of the 16S rDNA strain classification identification can accurately determine the taxonomic status of the strain (Candida plicata Kazachstania humilis ), which is different from other related strains, and ensures the specificity of the strain.

[0023] Figure 1 The flowchart of the screening method of the yeast strain with low fusel oil yield and high alcohol yield provided in the embodiments of the present application is shown.

[0024] As shown in Figure 1 , the present application provides a screening method of the yeast strain with low fusel oil yield and high alcohol yield according to the first aspect, which comprises the following steps: S1, mixing a Fen-flavor liquor dregs sample with sterile water, shaking, gradient dilution, and then coating on a YPD solid culture medium, and culturing at 28-30°C for 2-3 days to separate single colonies; The Saccharomyces cerevisiae strain of the present application is obtained by separation and purification from the Fen-flavor liquor dregs of Hubei Huanghe Tower Distillery (Xianning) Co., Ltd. The strain has the following characteristics: Candida plicata HHL-004 The morphological characteristics of the strain are as follows: the bacteria are round and convex, the surface is smooth, and the color is light pink.

[0025] In some embodiments, the YPD solid medium comprises peptone 20 g / L, yeast extract 10 g / L, glucose 20 g / L, agar 20 g / L.

[0026] In the S1 step, the sample is selected as "Fen-flavor liquor dregs", which is a natural ecological system of Xiaoqu Fen-flavor liquor brewing, and the microorganisms in it have adapted to the brewing process (such as high sugar, acidic, and anaerobic environment), and are more likely to screen strains that meet the "low fusel oil yield and high alcohol yield" and adapt to the brewing conditions.

[0027] The sterile water is mixed and shaken to wash the bacteria in the dregs from the solid substrate by mechanical shaking and disperse them into the liquid, which is convenient for subsequent separation.

[0028] Gradient dilution can reduce the concentration of the bacterial solution, so that single and independent colonies are formed on the culture medium after coating (to avoid overlapping of colonies), and ensure that the subsequent screening is a pure strain.

[0029] The YPD solid medium can provide the basic nutrients for the growth of yeast (glucose as carbon source, peptone and yeast extract as nitrogen source, vitamins and growth factors), and agar as a coagulant to make the colonies observable and pickable.

[0030] 28-30℃ culture for 2-3 days, which is the optimal growth temperature of yeast (highest enzyme activity), and the culture time ensures that the bacteria form visible colonies (1-3mm in diameter) from inoculation, which is convenient for picking.

[0031] S2, inoculate the single colonies obtained in step S1 into lactic acid medium and culture at 28℃ for 2-3 days to screen strains with a colony diameter of ≤2mm; In some embodiments, the lactic acid medium comprises lactic acid 40 g / L, ammonium sulfate 5 g / L, potassium dihydrogen phosphate 1 g / L, sodium chloride 0.1 g / L, magnesium sulfate 0.5 g / L, calcium chloride 0.1 g / L, yeast extract 0.2 g / L, and agar 20 g / L.

[0032] In the S2 step, the lactic acid medium screens strains with low fusel oil yield by the type of carbon source (mainly lactic acid) and nutrient limitation.

[0033] Fusel oil is mainly derived from the deamination of amino acids by microorganisms (Ehrlich pathway) and sugar metabolism branch. If a strain relies excessively on amino acids as nitrogen source or carbon source, it is easy to produce a large amount of fusel oil precursors (such as α-keto acid).

[0034] The carbon source in the lactic acid medium is lactic acid (non-sugar, non-amino acid), and the nitrogen source is inorganic nitrogen (ammonium sulfate), which can inhibit the growth of strains that rely on organic nitrogen (amino acid) metabolism; at the same time, the acidic environment of lactic acid (low pH) further screens strains that adapt to the brewing environment.

[0035] The strains with low fusel alcohol yield usually have weak lactic acid metabolism ability (or do not rely on excessive decomposition of amino acids to obtain energy) and slow growth rate, so the colony is small; the strains with high fusel alcohol yield grow faster due to excessive metabolism of amino acids to obtain more energy, so the colony is larger (>2 mm).

[0036] The culture temperature of 28°C is consistent with the culture temperature in step S1, so as to ensure the stability of the screening conditions and avoid the influence of temperature fluctuation on the growth difference of the strains.

[0037] In step S3, the screening strains in step S2 are inoculated in YPD culture medium and cultured for 48 h, and then TTC color developing medium is covered for dark culture for 3-4 h, so as to screen the strains with red color and color depth greater than or equal to the standard control, thereby obtaining the yeast strains.

[0038] In step S3, the YPD culture medium is cultured for 48 h, the YPD provides sufficient nutrients, so that the strains enter the logarithmic growth phase (the most active metabolism), and the fermentation alcohol production capacity is ensured to be at the peak, thereby facilitating the subsequent color developing reaction.

[0039] TTC (2,3,5-chlorinated triphenyl tetrazolium) is an oxidation-reduction indicator. When the yeast strains ferment to produce alcohol, a reduction reaction (to generate NADH and other reducing substances) is accompanied. The colorless TTC is reduced to red triphenylmethyrazonium (TF) by the reductase. The deeper the color is, the stronger the reduction capacity is, and the higher the alcohol production capacity is.

[0040] The dark culture is performed for 3-4 h, and the light will inhibit the reduction reaction of TTC. The dark culture ensures the color development to be stable. 3-4 h is the best time for color developing reaction (too short color developing is insufficient, and too long color saturation cannot distinguish the difference).

[0041] The color depth is greater than or equal to the standard control. By comparing with the color depth of the known high-alcohol-producing strains, the strains with standard alcohol yield are quantitatively screened, thereby avoiding subjective judgment errors.

[0042] In a third aspect, the present application provides an application of the yeast strain of the first aspect in liquor brewing.

[0043] In some embodiments, the liquor is a Xiaoqu clear-flavor liquor.

[0044] In some embodiments, in the solid-state fermentation process, the yeast strain can make the 60° liquor produced by the fermentation of fermented grains have a fusel alcohol content of ≤1.6 g / L and an alcohol yield of ≥51.0%.

[0045] The fusel oil in the present application is ≤1.6 g / L, which is directly aimed at the problem of high fusel oil in Xiaoqu Qingxiang Baijiu (about 2.7 g / L in traditional process), ensures that the wine body does not cause "head" after drinking, and improves the quality; the liquor yield is ≥51.0%, which ensures that the alcohol yield is not sacrificed while reducing fusel oil (about 50% in traditional process), and takes into account the economy, solving the contradiction between "reducing fusel oil and preserving yield".

[0046] In some embodiments, the fusel oil comprises isoamyl alcohol, isobutyl alcohol and n-propyl alcohol, wherein the content of isoamyl alcohol is ≤1.5 g / L, the content of isobutyl alcohol is ≤0.40 g / L, and the content of n-propyl alcohol is ≤0.25 g / L.

[0047] Isoamyl alcohol accounts for more than 50% of the total amount of fusel oil and is the main component causing "head", and controlling its content can significantly reduce the toxicity of fusel oil; isobutyl alcohol and n-propyl alcohol are less important, and the sub-index ensures accurate control of fusel oil to avoid exceeding the standard of a certain component.

[0048] In some embodiments, the yeast can grow well in an environment with a glucose concentration of 30% and an ethanol concentration of 10% during the brewing process of Baijiu.

[0049] In the early stage of Xiaoqu Qingxiang Baijiu fermentation, raw material saccharification will produce high-concentration glucose (up to 20%-30%), and the 30% glucose tolerance ensures that the strain does not dehydrate and die in a high-osmotic environment, maintaining activity; the alcohol concentration in fermented fermented grains gradually increases (up to 8%-12%), and the 10% ethanol tolerance ensures that the strain continues to metabolize in a high-alcohol environment, ensuring stable liquor yield.

[0050] The present application exhibits significant advantages in the field of Xiaoqu Qingxiang Baijiu brewing, as follows: (1) Strain performance is outstanding, balancing fusel oil reduction and high alcohol yield: low fusel oil production is outstanding, and the Pseudozyma parasitica strain obtained by screening has the following characteristics: Kazachstania humilis HHL-004 In solid-state fermentation, the fusel oil content of 60° Baijiu can be reduced to ≤1.6 g / L, of which isoamyl alcohol (the main component causing "head") is ≤1.5 g / L, isobutyl alcohol is ≤0.40 g / L, and n-propyl alcohol is ≤0.25 g / L, effectively solving the problem of high fusel oil in Xiaoqu Qingxiang Baijiu due to process characteristics, significantly improving the drinking comfort of the wine body; at the same time, the high alcohol yield is stable, and the strain can achieve a liquor yield of ≥51.0% while ensuring fusel oil reduction, which is higher than the traditional process (about 50%), breaking the industry pain point of "reducing fusel oil at the expense of liquor yield", balancing quality and economy; in addition, it has strong environmental adaptability and can grow well in an environment with a glucose concentration of 30% (high-sugar environment in the early stage of fermentation) and an ethanol concentration of 10% (high-alcohol environment in the late stage of fermentation), adapting to the whole fermentation process of Xiaoqu Qingxiang Baijiu and ensuring metabolic stability. (2) Screening method is scientific and efficient, and has strong targeting: accurate sampling, screening from Fen-flavor liquor dregs, the strain naturally adapts to the brewing environment (high sugar, acidity, hypoxia, etc.), without additional domestication, it can be directly applied, reducing the process adaptation cost; at the same time, the screening logic is rigorous, through the three-step method of "YPD medium separation single colony→lactic acid medium preliminary screening low fusel oil-producing strain (colony diameter≤2mm)→TTC color re-screening high alcohol-producing strain (color≥standard control)", layer by layer progressive function directional screening, avoiding blindness; in addition, the culture medium and parameters are optimized, YPD medium provides basic nutrition, lactic acid medium inhibits high fusel oil-producing strain through carbon and nitrogen source design (lactic acid as carbon source, ammonium sulfate as nitrogen source), TTC color quantifies the alcohol production capacity through oxidation-reduction reaction, and each link parameter (such as 28-30℃ culture, dark culture for 3-4h) has been verified to ensure that the screening result is stable and reliable.

[0051] (3) Significant application value, solving the industry pain points: avoiding the defects of traditional technology, without relying on multi-strain co-fermentation (avoiding flavor loss caused by imbalance of microbial community), gene editing (avoiding strain growth inhibition) or segmented distillation (avoiding 12%-15% loss of high-quality liquor), realizing green and low-cost fusel oil control through natural strain screening; at the same time, adapting to Xiaoqu Fen-flavor process: according to the process characteristics of this flavor type "saccharification followed by fermentation, short fermentation period", the strain can be directly applied to solid-state fermentation without adjusting the existing production process, easy to popularize and land; in addition, it guarantees the balance of liquor flavor, reduces fusel oil without damaging the characteristic flavor substance system of Fen-flavor liquor, balances "low irritation" and "sweetness", and meets the market demand for high-quality liquor. In summary, the present application provides a solution for the Fen-flavor liquor industry that balances quality improvement and economic benefits through excellent strain performance, scientific screening method and efficient application effect, which has important practical value. The present application will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present application and not to limit the scope of the present application. The experimental methods in the following examples are not specified, which are usually determined according to the industry standard. If there is no corresponding industry standard, the general international standard, conventional conditions, or the conditions recommended by the manufacturer are used.

[0052] Example 1: Isolation and screening of Ogataea parasp. HHL-004 1.1 Materials and culture medium Low fusel oil-producing Ogataea parasp. of the present example HHL-004 Isolated from Fen-flavor liquor dregs. The YPD enrichment medium contains: peptone 20g / L, yeast extract 10g / L, glucose 20g / L, agar 20g / L.

[0053] The lactic acid culture medium ingredients are: lactic acid 40 g / L, ammonium sulfate 5 g / L, potassium dihydrogen phosphate 1 g / L, sodium chloride 0.1 g / L, magnesium sulfate 0.5 g / L, calcium chloride 0.1 g / L, yeast extract 0.2 g / L, and agar 20 g / L. The TTC culture medium is prepared by: taking 1 g of 2,3,5-chlorinated triphenyl tetrazolium powder and dissolving it in 100 mL of pure water, stirring thoroughly to dissolve the TTC powder completely, and preparing the TTC culture medium; after the strain is transferred to the YPD culture medium for 48 h, pour the TTC culture medium on the plate, and then perform subsequent experimental observation. 1.2 Screening step (1) Take 5 g of Qingxiang daqu and add 95 mL of sterilized distilled water, put it in a 150 r / min shaker for 30 min; put the suspension after shaking into a clean bench, perform gradient dilution, take 10 -2 , 10 -3 , 10 -4 three gradient bacterial suspensions are dropped on the YPD solid culture medium for plate coating, and placed in a 30℃ incubator for culture, and observed after 2-3 days.

[0054] (2) After colonies grow on the plate, pick the colonies and inoculate them on the YPD solid culture medium for separation and purification to obtain single strains.

[0055] (3) Prepare TTC culture medium, pour it into the YPD solid culture medium plate with colonies, and perform dark culture for 4 h, and observe the color development of the colonies.

[0056] (4) Prepare lactic acid culture medium, take the darker colored colonies, and transfer them to the YPD solid culture medium for repeated verification.

[0057] Example 2: Liquid fermentation performance verification of low fusel oil producing strain 2.1 Materials and culture medium Glucose culture medium: glucose 230 g / L, yeast extract 20 g / L, ammonium sulfate 10 g / L. YPD liquid culture medium: peptone 20 g / L, yeast extract 10 g / L, glucose 20 g / L. 2.2 Verification steps (1) Take the single colonies verified by TTC culture, inoculate them into 100 mL YPD liquid culture medium, and place them in a shaker at 28℃, 150 rpm for overnight culture. (2) Prepare 250 mL of highland millet culture medium, pour it into a flask with a fermentation plug, sterilize at 121℃ for 20 min; inoculate the strain in the logarithmic growth phase into the sterilized and cooled glucose culture medium at a ratio of 1%, and then inject pure water to seal after installing the fermentation plug. (3) Weigh the Erlenmeyer flask and record the weight loss to two decimal places. Measure the weight loss every 24 hours. After one week, stop the weight loss and end the fermentation. Select strains with higher weight loss in liquid fermentation for solid-state fermentation verification.

[0058] Example 3: Validation and identification of strains with low fusel oil production by solid-state fermentation 3.1 Solid-state fermentation verification (1) Soaking the grain: Weigh 2 kg of sorghum used for brewing with Huanghelou Winery's small-batch light aroma, and soak the grain in pure water for 24 hours. (2) Steaming the grain: After soaking the grain, steam the soaked grain for 30 minutes, steam for 20 minutes and steam again for 10 minutes until the sorghum cracks and the starch is exposed, and keep a sample for testing; after the second steaming, cool the sorghum and remove the surface water, sprinkle koji, mix well, and saccharify for 24 hours. (3) Mixing the mash and putting it into the fermentation tank: After the saccharification is completed, weigh the mash from the Xiaoqu Qingxiang workshop. The ratio of mash to grain is 2:1. Mix the mash with the grain after saccharification and pour it into the fermentation tank for fermentation. (4) Distillation: After the fermentation of the mash is completed, an appropriate amount of rice husk is added to reduce the moisture content. Then, the mash is distilled in a still. The alcohol content is calculated at 60° and the sample is sent for testing. The gas chromatography results of solid-state fermentation are shown in Table 1.

[0059] Table 1. Gas Chromatography Results of Solid-State Fermentation 3.2 Candida albicans HHL-004 Identification The strains were identified based on morphological characteristics, physicochemical tests, and 16S rDNA gene sequence analysis. The 16S rDNA sequence (SEQ ID NO. 1) of the strain is as follows: ATAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGTAGAGGGCGACTTTGGGGCGGCTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCCGTGTAAAGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCCCCGCTCCTCGTGGGTGGGGGACTCTCGCAGCTCACTGGGCCAGCATCAGTTTTGGCGGCCGGACAAAACTGCAGGAACGTAGCTTGCTTCGGGAAGTGTTACAGCCTGCAGGAATACGGCCAGCCGGGACTGAGGAATGCGATTCGTCAAGGATGCTGGCATAATGGTTATATGCCGCCCGTCT Through the alignment analysis of the sequence with known model strains, it is confirmed that the strain is Candida plicata (Candida plicata) Kazachstania humilis , named HHL-004 .

[0060] Morphological feature observation: the colony grows on YPD solid culture medium for 2-3 days, is light red in color, and the surface is smooth, as shown in Figure 2 and Figure 3 ; the cell body is oval in shape after being cultured in liquid culture medium at 28°C for 14-16 hours. Physicochemical test determination results: (1) Alcohol tolerance test: prepare YPD liquid culture medium containing ethanol at concentrations (v / v) of 0%, 8%, 10%, 12%, and 15%, inoculate Candida plicata HHL-004 into the medium at a proportion of 1%, and then culture at 30°C and 150 rpm for 48 hours. After that, the OD600 value is measured using an ultraviolet spectrophotometer, and the results are shown in Table 2.

[0061] Table 2 Alcohol tolerance of Candida peltata Ethanol concentration (v / v) 0 8 10 12 15 OD600 2.54 2.42 2.27 1.79 1.08 As shown in Table 2, compared with the medium without added ethanol, the strain added with 8% ethanol can grow better, the growth ability of the strain added with 12% and 15% ethanol decreases rapidly, and the Candida peltata HHL-004 still has strong growth ability in the medium added with 10% ethanol.

[0062] (2) High-sugar tolerance test: the Candida peltata HHL-004 was inoculated into YPD liquid medium with glucose concentration of 0%, 10%, 20%, 30%, 40% and 50% respectively, and cultured at 30°C and 150 rpm for 48 h, and then the OD600 value was measured by using ultraviolet spectrophotometer, and the results are shown in Table 3.

[0063] Table 3 High-sugar tolerance of Candida peltata The results show that in the medium with concentration of 10% to 30%, the growth ability of the strain shows a slow downward trend, and in the medium with concentration of 40%, the growth ability decreases rapidly, and in the medium with concentration of 50%, the growth ability of the Candida peltata HHL-004 is obviously inhibited.

[0064] From Examples 1 to 3, it can be seen that: (1) Effectiveness of strain isolation and screening: through sampling from the fragrant liquor dregs, isolating single colonies on YPD solid medium, screening high-alcohol-producing strains (deeper color) on TTC medium, and verifying low-fusel oil-producing characteristics (repeat verification) on lactic acid medium, the target strain Candida peltata HHL-004 can be successfully obtained, and the screening method is scientific and targeted.

[0065] (2) Excellent fermentation performance of the strain: in liquid fermentation, the strain has high weight loss, which shows strong potential for producing alcohol; at the same time, solid-state fermentation verification shows that compared with conventional brewing, the content of fusel oil in the 60° liquor brewed by the strain is reduced from 2.75 g / L to 1.53 g / L (including 0.23 g / L of n-propyl alcohol, 0.40 g / L of isobutyl alcohol and 1.48 g / L of isoamyl alcohol), and the liquor yield is increased from 50.45% to 51.16%, realizing the dual advantages of "low fusel oil production and high alcohol production".

[0066] (3) The strain identification result is clear: the morphological characteristics are that the colonies on YPD solid medium grow for 2-3 days, the colonies are light red and the surface is smooth, and the cells in liquid medium are oval after 14-16 hours of culture at 28°C; the physicochemical characteristics are that the strain can grow well in YPD medium with 10% ethanol and 30% glucose, which is suitable for the high-sugar and high-alcohol environment of liquor brewing; the 16S rDNA gene sequence (SEQ ID NO. 1) comparison analysis confirms that the strain is Kazachstania humilis, and is named HHL-004 , and the classification status of the strain is clear.

[0067] In summary, Kazachstania humilis HHL-004 has the characteristics of adapting to the brewing of Xiaocu light-flavor liquor, can effectively reduce the content of fusel oil and increase the liquor yield, and has practical application value.

[0068] Various embodiments of the present application can exist in the form of a range; it should be understood that the description in the form of a range is merely for the convenience and brevity, and should not be understood as a hard limit on the scope of the present application; therefore, it should be considered that the described range has specifically disclosed all possible sub-ranges and single values within the range. For example, it should be considered that the range description from 1 to 6 has specifically disclosed sub-ranges, such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., as well as single numbers within the range, such as 1, 2, 3, 4, 5 and 6, regardless of the range. In addition, whenever a numerical range is indicated in the present application, it refers to any cited number (fraction or integer) within the indicated range.

[0069] In addition, in the description of the present application, the terms "include", "contain" and the like mean "include but not limited to". In the present text, the relationship terms such as "first" and "second" are merely used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between the entities or operations. In the present text, "and / or" describes the association relationship of the associated objects, which means that there can be three kinds of relationships, for example, A and / or B can represent the cases of A alone, A and B together, and B alone. Wherein A and B can be singular or plural.

[0070] The above is only a specific embodiment of the present application, which enables those skilled in the art to understand or implement the present application. Various modifications of these embodiments will be apparent to those skilled in the art, and the general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present application. Therefore, the present application will not be limited to these embodiments shown herein, but will conform to the widest scope consistent with the principles and novel features applied herein.

Claims

1. A yeast strain producing less fusel oil and more alcohol, characterized in that, The yeast is Candida plicata Kazachstania humilis HHL-004 , the preservation number is CCTCC NO: M 2025523, the preservation address is China Center for Type Culture Collection, and the preservation time is 2025-03-18.

2. The low-fusel oil producing high-alcohol producing yeast of claim 1, wherein, The 16S rDNA sequence of the yeast is shown as SEQ ID NO.

1.

3. A method for screening a low-fusel oil-producing high-alcohol-producing yeast strain according to claim 1 or 2, characterized by, The method comprises the following steps: S1, mixing the Fen-flavor liquor dregs sample with sterile water, shaking, gradient dilution, and then coating on YPD solid culture medium, and culturing at 28-30℃ for 2-3 days to isolate single colonies; S2, inoculating the single colonies obtained in step S1 into lactic acid culture medium and culturing at 28℃ for 2-3 days to screen strains with colony diameter ≤2mm; S3, inoculating the screened strains in step S2 into YPD culture medium and culturing for 48h, then covering TTC color developing medium and dark culturing for 3-4h to screen strains with red color and color depth ≥standard control, to obtain the yeast.

4. The method for screening yeast with low fusel oil production and high alcohol production according to claim 3, characterized in that, The YPD solid culture medium comprises peptone 20g / L, yeast extract 10g / L, glucose 20g / L, and agar 20g / L.

5. The method for screening yeast with low fusel oil production and high alcohol production according to claim 3, characterized in that, The lactic acid culture medium comprises lactic acid 40g / L, ammonium sulfate 5g / L, potassium dihydrogen phosphate 1g / L, sodium chloride 0.1g / L, magnesium sulfate 0.5g / L, calcium chloride 0.1g / L, yeast extract 0.2g / L, and agar 20g / L.

6. Application of the yeast of claim 1 or 2 in liquor brewing.

7. Use according to claim 6, characterized in that, The liquor is Fen-flavor liquor.

8. Use according to claim 6, characterized in that, In the solid-state fermentation process, the yeast can make the 60° liquor produced by the fermentation of dregs contain ≤1.6g / L of fusel oil, and the liquor yield ≥51.0%.

9. Use according to claim 8, characterized in that, The fusel oil comprises isoamyl alcohol, isobutyl alcohol, and n-propyl alcohol, wherein the content of isoamyl alcohol is ≤1.5g / L, the content of isobutyl alcohol is ≤0.40g / L, and the content of n-propyl alcohol is ≤0.25g / L.

10. Use according to claim 6, characterized in that, The yeast can grow well in the environment with glucose concentration of 30% and ethanol concentration of 10% during the liquor brewing process.

Images