Candida citriodora and application thereof

By using Candida citrinum XP0136 for fruit wine fermentation, the problem of flavor homogenization caused by traditional brewing yeasts was solved, the aroma quality of high-tannin fruit wines was improved, and the typical flavor of fruit wines was highlighted.

CN121064985APending Publication Date: 2025-12-05LUZHOU LAOJIAO CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511480725.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-16
Publication Date
2025-12-05

AI Technical Summary

Technical Problem

The current reliance on traditional brewing yeast in fruit wine production leads to flavor homogenization. In particular, fruit wines made from high-tannin fruits are unable to fully transform flavor precursors and cannot reflect the typical flavor characteristics of the raw materials.

Method used

Fruit wine fermentation was carried out using Candida quercitrusa XP0136, which has high tannin tolerance and good fermentation performance, and can enhance the volatile aroma components of fruit wine.

Benefits of technology

Candida citrinum XP0136 performs well in high-tannin environments, significantly enhancing the typical aromas of fruit wines, strengthening characteristic aromas such as fruit and rose, and reducing the generation of undesirable flavors.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121064985A_ABST
    Figure CN121064985A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of microbial fermentation, and particularly relates to a Candida citrina strain and an application of the Candida citrina strain. In order to develop more non-saccharomyces cerevisiae resources applied to fruit wine fermentation, the invention provides a new Candida citriodora, the preservation number of the Candida citriodora is CGMCC No.34757, and the Candida citriodora is applied to fruit wine fermentation. Compared with commercial non-saccharomyces cerevisiae NS-D, the Candida citriodora XP0136 provided by the invention shows good fermentation performance in a high tannin environment, has good adaptability to various stress environments such as high sugar, high ethanol, high SO2 and high acidity conditions, simultaneously produces H2S and acetic acid at low yield, and is beneficial to reducing generation of bad flavors. Besides, in the application of aronia melanocarpa fruit wine aroma enhancement brewing, the strain can enhance the typical aroma of brewed fruit wine, and a new strain source is provided for yeast suitable for brewing high-tannin fruit wine.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of microbial fermentation, and particularly relates to a Candida humilis and application thereof. BACKGROUND

[0002] The fruit wine industry, as an important direction of deep processing of agricultural products, has great potential in solving fruit oversupply and improving added value. However, the current fruit wine production generally relies on traditional Saccharomyces cerevisiae, Saccharomyces cerevisiae For example, the Chinese wolfberry fruit wine uses only wine-making Saccharomyces cerevisiae, and the natural yeasts attached to the surface of the fruit are removed in the cleaning process before fermentation, so that the finished product has the defects of "unobtrusive fruit aroma and poor typicality". In a deeper sense, Saccharomyces cerevisiae has a relatively single metabolic spectrum while dominating the alcoholic fermentation, and it is difficult to fully convert the flavor precursor substances in the fruit. Especially for fruits with high tannin content (such as blueberries and some grape varieties), the utilization rate of polyphenol substrates by Saccharomyces cerevisiae is limited, resulting in a single aroma level of the wine body and failing to reflect the typical flavor characteristics of the raw materials. This technical bottleneck seriously restricts the development of high-value specialty fruit wine, and urgently needs to be broken through by microbial resource innovation.

[0003] Non-Saccharomyces cerevisiae Non-Saccharomyces Yeasts refers to a group of natural yeasts other than Saccharomyces cerevisiae, including Candida humilis, Candida quercitrusa Hanseniaspora, Hanseniaspora Pichia, Pichia Zygosaccharomyces, Zygosaccharomyces and more than 20 genera and species. Recent studies have shown that this type of yeast can significantly enrich the volatile aroma components of fruit wine through unique secondary metabolic pathways in the early fermentation stage. Therefore, sequential inoculation of non-Saccharomyces cerevisiae and Saccharomyces cerevisiae has become one of the important brewing technologies for improving the flavor quality and optimizing the product characteristics of fruit wine. Although some commercial non-Saccharomyces cerevisiae (such as NS-D) are suitable for fruit wine brewing, the fermentation of some extreme characteristic fruits such as high-tannin Aronia melanocarpa and high-acid Prunus mume fruit wine still needs non-Saccharomyces cerevisiae with strong stress resistance and good fermentation performance to assist in the flavor regulation of these fruit wines. SUMMARY

[0004] In order to develop more non-Saccharomyces cerevisiae resources for fruit wine fermentation, the present application provides a new Candida humilis and uses it for fruit wine fermentation. Candida quercitrusa

[0005] To achieve the above application purposes, the technical solutions adopted by the present application are as follows: In a first aspect, the present application provides a Candida humilis, Candida quercitrusa ​XP0136, with a preservation number of CGMCC No. 34757. The preservation time is June 4, 2025, and the preservation unit is the General Microbiological Center of China (CGMCC), located at No. 1, Xibei Road, Yard 3, Beijing Chaoyang District, with a postal code of 100101. The classification name is: Candida quercitrusa .

[0006] The nucleotide sequence of the 26S rRNA of the above-mentioned C. aurantiacus XP0136 is shown in SEQ ID NO: 1: SEQ ID NO: 1: In the above, the morphological characteristics of Candida citri XP0136 on WLN solid medium are: creamy opaque, milky white with a little yellow, smooth and regular edge, oval colony texture.

[0007] In the above, the Candida citri XP0136 has tolerance to high concentration of tannin. Further, the tannin is selected from at least one of gallotannin, ellagitannin or condensed tannin. Preferably, the tannin concentration is 2-10 g / L.

[0008] In the second aspect, the present application provides a microbial inoculant containing the above-mentioned Candida citri XP0136.

[0009] Further, in the microbial inoculant, the addition amount of Candida citri XP0136 is 10 6 CFU / mL or more.

[0010] In the third aspect, the present application provides a fermenting agent containing the above-mentioned Candida citri XP0136 or microbial inoculant.

[0011] In the fourth aspect, the present application provides the application of the above-mentioned Candida citri XP0136, microbial inoculant or fermenting agent in fruit wine brewing.

[0012] Further, the fruit wine includes at least one of black chokeberry fruit, mulberry, persimmon, blueberry, wolfberry, green plum, snow pear, black grape, pomegranate, banana, cranberry, hawthorn, lychee, longan, black currant or apple fruit wine.

[0013] In the fifth aspect, the present application provides a fruit wine fermentation method, including the following steps: adding the above-mentioned Candida citri XP0136, microbial inoculant or fermenting agent into fruit juice, and then fermenting.

[0014] Further, during the fermentation process, the above-mentioned Candida citri XP0136, microbial inoculant or fermenting agent is co-fermented with other Saccharomyces cerevisiae.

[0015] Further, the inoculation amount of the Candida citri XP0136 is ≥10 6 CFU / mL.

[0016] Further, the fermentation temperature is 18-25℃.

[0017] Further, the end time of the fermentation is determined by the end standard of total sugar content being less than 4.0 g / L.

[0018] Further, the initial sugar degree of the fruit juice is controlled to be greater than 200 g / L before fermentation.

[0019] Further, during the fermentation process, oxygen is supplied in the early stage and not supplied in the later stage.

[0020] In a sixth aspect, the present application provides a method for improving the volatile flavor compounds of fruit wine, comprising the following steps: adding the above-mentioned Candida oleophila XP0136, microbial inoculant or leavening agent into fruit juice, and then performing fermentation.

[0021] Further, the volatile flavor substances include at least one of ethyl octanoate, ethyl hexanoate, isoamyl acetate, damascone, ethyl laurate or eugenol.

[0022] Beneficial effects: The present application isolates and screens a strain of Candida oleophila XP0136 with significant flavor enhancement effect and high tannin tolerance from natural fermentation liquor of snow pear, and the preservation number is CGMCC No. 34757. Compared with the commercial non-Saccharomyces NS-D, the Candida oleophila XP0136 provided by the present application still has good tolerance when the tannin concentration is 10 g / L, and can enter the logarithmic growth phase faster. Meanwhile, it has good adaptability to various stress environments such as high sugar, high ethanol, high SO2 and high acidity, and is superior to the commercial non-Saccharomyces NS-D. Moreover, compared with the commercial non-Saccharomyces NS-D, the Candida oleophila XP0136 of the present application produces less H2S and acetic acid, which is beneficial to reduce the generation of undesirable flavors.

[0023] In addition, in the flavor enhancement brewing application of black chokeberry fruit wine, compared with the commercial non-Saccharomyces NS-D, the Candida oleophila XP0136 provided by the present application has better physical and chemical indicators such as color and hue. Moreover, it produces ethyl octanoate 1012.91±4.90 μg / L, ethyl hexanoate 19575.81±428.8 μg / L, isoamyl acetate 31650.06±116.55 μg / L, damascone 2241.7±94.6 μg / L, ethyl laurate 8334.62±538.39 μg / L, and eugenol 240.9±109.5 μg / L, and has stronger aroma substance capacity, which significantly highlights the fruity aroma, rose fragrance and other characteristic aromas of black chokeberry fruit wine, indicating that it has significant flavor enhancement effect. It can be seen that the Candida oleophila XP0136 provided by the present application not only can perform good fermentation performance in high tannin environment, but also can enhance the typical aroma of brewed fruit wine, and provides a new strain source for the brewing of fruit wine with high tannin property. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 Fig. 1 is a) colony morphology and b) NS-D microscopic examination of Candida oleophila XP0136 in Example 1 of the present application in WLN medium; Figure 2 Fig. 2 is a result graph of tannin resistance and stress resistance characteristics of commercial non-Saccharomyces NS-D and Candida oleophila XP0136 in Example 2 of the present application; Figure 3 Figure 3 is a graph showing the tannin tolerance growth curves of commercial non-Saccharomyces yeast NS-D and Candida pektinovora XP0136 in Example 3 of the present application; Figure 4 Figure 4 is a graph showing the results of a) glucose, b) alcohol, c) SO2 and d) pH tolerance of commercial non-Saccharomyces yeast NS-D and Candida pektinovora XP0136 in Example 3 of the present application; Figure 5 Figure 5 is a graph showing the acetic acid production characteristics of commercial non-Saccharomyces yeast NS-D and Candida pektinovora XP0136 in Example 4 of the present application; Figure 6 Figure 6 is a graph showing the H2S production characteristics of commercial non-Saccharomyces yeast NS-D and Candida pektinovora XP0136 in Example 5 of the present application; Figure 7 Figure 7 is a graph showing the volatile substance analysis results in the black chokeberry fruit wine sequentially inoculated and fermented by commercial non-Saccharomyces yeast A) NS-D, B) Candida pektinovora XP0136 and commercial yeast BV818 in Example 6 of the present application.

[0025] Preservation instruction of Candida pektinovora XP0136 of the present application: Candida pektinovora (Candida pektinovora) Candida quercitrusa XP0136, with the preservation number of CGMCC No. 34757. The preservation time is June 4, 2025, and the preservation unit is China General Microbiological Culture Collection Center (CGMCC), located at No. 1, Beichen West Road, Haidian District, Beijing, China, with the postcode of 100101. The classification name is: Candida quercitrusa .DETAILED DESCRIPTION In order to make the technical problems, technical solutions and beneficial effects to be solved in the present application more clear and explicit, the present application will be further described in detail in combination with the embodiments. Unless otherwise defined, all the scientific and technical terms used in the present application have the same meanings as understood by those skilled in the art.

[0026] In one embodiment of the present application, a strain XP0136 is isolated and screened from natural fermentation liquid of snow pear, and the strain is identified as Candida pektinovora (Candida pektinovora) by combining the cell morphology, physiological and biochemical characteristics and molecular biology.

[0027] Candida quercitrusa

[0028] ​In an embodiment of the present application, the Candida utilis XP0136 described in the present application is found to have high tannin tolerance, i.e. it has good tolerance even in the presence of 10 g / L of tannin. Moreover, the Candida utilis XP0136 has stronger sugar tolerance, alcohol tolerance and pH tolerance compared to the NS-D strain. Meanwhile, it has relatively low level of H2S and acetic acid production characteristics and is more advantageous for fermentation.

[0029] In an embodiment of the present application, the Candida utilis XP0136 is used for the fruit wine of black chokeberry, and the physicochemical indexes such as color and hue are better than those of the NS-D strain, and the production of compounds such as ethyl octanoate, ethyl hexanoate, isoamyl acetate, damascone, ethyl laurate or eugenol that can enhance the typical aroma of the fruit wine is higher.

[0030] In an embodiment of the present application, the Candida utilis XP0136 is prepared into a microbial agent or a fermenting agent for fruit wine brewing.

[0031] In an embodiment of the present application, the fruit wine comprises at least one of black chokeberry, mulberry, persimmon, blueberry, Chinese wolfberry, green plum, snow pear, black grape, pomegranate, banana, cranberry, hawthorn, lychee, longan, blackcurrant or apple fruit wine.

[0032] The following specific examples will be listed to explain the scheme of the present application. Those skilled in the art will understand that the following examples are only used to illustrate the present application, and should not be regarded as limiting the scope of the present application. If the specific techniques or conditions are not specified in the examples, the techniques or conditions described in the literature in the art or according to the product instructions are used. If the reagents or instruments are not specified by the manufacturer, they are all conventional products that can be obtained by purchase.

[0033] WLN solid medium: tryptone 5.0 g / L, yeast extract powder 4.0 g / L, glucose 50.0 g / L, potassium dihydrogen phosphate 0.55 g / L, potassium chloride 0.425 g / L, agar 20.0 g / L.

[0034] YNB liquid medium: ammonium sulfate 5.0 g / L, biotin 2.0 μg / L, calcium pantothenate 400.0 μg / L, folic acid 2.0 μg / L, nicotinic acid 400.0 μg / L, myo-inositol 2000.0 μg / L, p-aminobenzoic acid 200.0 μg / L, pyridoxine hydrochloride 400.0 μg / L, riboflavin 200.0 μg / L, thiamine hydrochloride 400.0 μg / L, boric acid 500.0 μg / L, copper sulfate 40.0 μg / L, potassium iodide 100.0 μg / L, ferric chloride 200.0 μg / L, manganese sulfate 400.0 μg / L, sodium molybdate 200.0 μg / L, zinc sulfate 400.0 μg / L, potassium dihydrogen phosphate 1.0 g / L, magnesium sulfate 0.5 g / L, sodium chloride 0.1 g / L, calcium chloride 0.1 g / L.

[0035] YPD medium: peptone 20.0 g / L, glucose 20.0 g / L, yeast extract 10.0 g / L.

[0036] Calcium carbonate agar medium: calcium carbonate 3.0 g / L, agar 20.0 g / L, glucose 10.0 g / L, yeast extract 3.0 g / L.

[0037] BIGGY medium: agar 16.0 g / L, bismuth ammonium citrate 5.0 g / L, sodium sulfite 3.0 g / L, glucose 10.0 g / L, glycine 10.0 g / L, yeast extract 1.0 g / L.

[0038] Example 1: Isolation and identification of Candida humilis XP0136 The bacteria liquid was picked from the natural fermentation liquid of Sydney and streaked on WLN solid medium, and cultured at 28°C for 36-48 h, to form visible single colonies. The single colony was picked and streaked on WLN solid medium again for culture until a pure culture was obtained, numbered as XP0136. The colony morphology of the strain on WLN medium is shown in FIG. a. The colony color and morphology are creamy opaque, milky white with a little yellow, and the colony texture is smooth and regular at the edge, oval. Figure 1

[0039] The sterilized 50% glycerol was mixed with the purified bacteria liquid at 1:1 (V / V) for storage in a -80°C refrigerator.

[0040] ​The DNA of the screened strain was extracted by using Ezup columnar yeast genomic DNA extraction kit (Shanghai Genechem Co., Ltd.) according to the instructions, and was stored at -20℃ for standby. The SanPrep columnar DNA gel recovery kit (Shanghai Genechem Co., Ltd.) was used to recover the target fragment of the PCR product, and a gene sequencing company was used for gene sequencing. The primers used for PCR amplification were NL1 (SEQ ID NO: 2: GCATATCAATAGCGGAGGAAAAG) and NL4 (SEQ ID NO: 3: GGTCCGTGTTTCAAGACGG), and the nucleotide sequence of the 26S rRNA of the strain was as shown in SEQ ID NO: 1.

[0041] The sequence alignment software was used for homologous sequence search in the nucleotide sequence database, and the test strain XP0136 was identified as Candida aurantia by comprehensively analyzing the cell morphology, physiological and biochemical characteristics and the alignment results. The test strain XP0136 was preserved in the China General Microbiological Culture Collection Center (CGMCC) on June 4, 2025, and the address of the China General Microbiological Culture Collection Center (CGMCC) is No. 3, Institute of Microbiology, Chinese Academy of Sciences, Beijing Chaoyang District Beichen West Road No. 1, and the postcode is 100101. The classification name is: Candida quercitrusa . The preservation number is: CGMCC No. 34757.

[0042] Example 2: Determination of high tannin tolerance of Candida aurantia XP0136 The commercial non-Saccharomyces cerevisiae strain NS-D was used as a control strain, and the Candida aurantia XP0136 was activated twice using YNB liquid medium. The yeast strain liquid after the second activation was inoculated into YNB liquid medium with a tannin concentration of 2-10 g / L at an inoculation amount of 1%, and the change of OD 600 nm (optical density value) was determined after 48 h of culture in a 28℃ constant temperature incubator to compare the tannin tolerance of the strains, and the change of OD nm was used as a re-screening basis for tannin-tolerant yeast.

[0043] The results show that the Candida aurantia XP0136 grows well under high tannin stress, and the growth state is good and the growth is rapid. According to Figure 2 , compared with the NS-D strain, the Candida aurantia XP0136 of the present application has obvious high tannin tolerance. Especially when the tannin content is 10 g / L, it has good tolerance.

[0044] Example 3: Determination of growth characteristics of Candida aurantia XP0136 (1) Yeast growth curve: Candida aurantia XP0136 and NS-D strain were respectively inoculated into YNB liquid medium at 10 6The inoculation amount of 10 600 nm, and the yeast growth curve was plotted as shown in Figure 3 Fig. 2. The orange Candida XP0136 had the strongest growth ability, and its maximum growth rate was similar to that of the commercial non-Saccharomyces NS-D. The orange Candida entered the logarithmic phase more quickly than the commercial non-Saccharomyces NS-D. Thus, the adaptability of the orange Candida XP0136 was better than that of the commercial non-Saccharomyces NS-D.

[0045] (2) Tolerance evaluation: Yeast plays an important role in the production of fruit wine, but it is inevitably subjected to various environmental stresses during the fermentation process, the most common of which are sugar concentration, alcohol content, and pH. These environmental stresses inhibit the growth and metabolism of yeast, leading to prolonged fermentation time or even fermentation stagnation, which affects the quality of the final fruit wine product. Therefore, the present application used the commercial non-Saccharomyces NS-D as a control to study the tolerance of the orange Candida XP0136 to sugar concentration, alcohol content, SO2, and pH. The specific operation was as follows: The activated seed liquid of the two strains was inoculated into 30 mL of YPD medium with different treatments at an inoculation amount of 10 6 CFU / mL, and incubated at 28°C for 48 h. The OD value at 600 nm was measured using a UV spectrophotometer, and three replicates were set to evaluate the sugar tolerance, alcohol tolerance, SO2 tolerance, and pH tolerance of the strains. The results are shown in Figure 4 When the glucose concentration was 250 g / L, the orange Candida XP0136 grew best, but as the glucose concentration continued to increase, the growth of XP0136 was significantly inhibited. The OD 600 nm values of non-Saccharomyces NS-D and XP0136 decreased with increasing ethanol concentration, and when the ethanol concentration was 6% vol, the orange Candida XP0136 showed better tolerance than the commercial non-Saccharomyces NS-D. The commercial yeast NS-D grew best at pH 3-4, while the orange Candida XP0136 not only grew well at pH 3-4, but also grew more vigorously than the commercial non-Saccharomyces NS-D at pH 2.5.

[0046] In summary, the orange Candida XP0136 had stronger sugar tolerance, alcohol tolerance, and pH tolerance than the NS-D strain.

[0047] Example 4: Acetic acid production ability test of orange Candida XP0136 Acetic acid is a by-product of yeast during the process of fruit wine fermentation, which has obvious vinegar and sour taste. When the content is too high, it will affect the aroma of fruit wine itself and cause adverse effects on the sensory of fruit wine. In this experiment, the size of halo produced by yeast on calcium carbonate medium was used to explore the acetic acid production ability of each yeast strain. The specific operation is as follows: Under sterile conditions, 5 μL of activated non-Saccharomyces NS-D and Candida aurantica XP0136 bacterial liquid were spotted on calcium carbonate agar medium, and cultured at 28℃ for 72 h. The halo size around the colony was used to evaluate the acetic acid production ability of each yeast strain. The halo smaller than 1 mm was non-acetic acid producing bacteria, the halo between 1-3 mm was low acetic acid producing bacteria, the halo between 3-5 mm was medium acetic acid producing bacteria, and the halo larger than 5 mm was high acetic acid producing bacteria. From Figure 5 It can be seen that the halo produced by XP0136 on the medium is smaller than that of NS-D, and there is no obvious calcium dissolution ring (NS-D is 1.73±0.31 mm, XP0136 is 0.63±0.22 mm), which shows that Candida aurantica XP0136 is a low acetic acid producing yeast.

[0048] Example 5: Test of H2S production ability of Candida aurantica XP0136 Hydrogen sulfide (H2S) has a strong "rotten egg" smell, which is an undesirable flavor in fruit wine brewing, and its sensory threshold is low, so even low levels of H2S can be easily perceived. In this invention, the color of each strain on BIGGY medium was used to evaluate the H2S production ability of yeast. The specific operation is as follows: Under sterile conditions, 5 μL of activated non-Saccharomyces NS-D and Candida aurantica XP0136 bacterial liquid were spotted on BIGGY medium, and cultured at 28℃ for 48 h. The H2S production ability of each strain was evaluated by observing the color of the colony. On BIGGY agar medium, the colony color was white, which was considered as non-H2S producing bacteria, light brown was low producing strain, dark brown was medium producing strain, and black was high producing strain. From Figure 6 It can be seen that NS-D is dark brown and XP0136 is light brown. Therefore, XP0136 is a low H2S producing strain. From the H2S production characteristics, Candida aurantica XP0136 has relatively low level of H2S production characteristics, which is more advantageous for fermentation.

[0049] Example 6: Application of Candida aurantica XP0136 in the production of black chokeberry fruit wine (1) Fresh Sorbus aucuparia fruits were used as raw material, washed and squeezed by a screw press to obtain juice, which was sealed and stored at 0±1℃ for later use. Candida olea XP0136 was pre-activated in YPD liquid medium at 20℃ for 48 h, then centrifuged at 5000 rpm, 4℃ for 5 min, and the cell pellet was washed twice with sterile physiological saline, and then the concentration of the bacterial liquid was adjusted to 10 6 CFU / mL with physiological saline to obtain the starter.

[0050] (2) The initial sugar content of the above-mentioned Sorbus aucuparia juice was 58.86±0.22 g / L, and the sugar content was supplemented to 216 g / L according to the proportion of 18 g sucrose producing 1° alcohol, then pasteurized at 65℃ for 30 min, and supplemented with 0.4 g / L commercially available yeast extract; rapidly cooled to 20℃, then non-Saccharomyces NS-D and Candida olea XP0136 were inoculated into the prepared Sorbus aucuparia juice at a concentration of 10 6 CFU / mL, respectively, and fermented at 20℃. After 24 h, 10 6 CFU / mL of commercial yeast BV818 was inoculated for further fermentation. During the fermentation, the specific gravity was measured every day and the fermentation temperature was monitored. When the total sugar content was less than 4.0 g / L, it was considered that the fermentation was completed. Oxygen was supplied regularly in the early stage of fermentation, and no oxygen was supplied in the later stage of fermentation. The fermentation temperature was controlled at 20±2℃. The alcohol content, total sugar, total acid, pH, color, hue, and volatile compounds of the fermented Sorbus aucuparia fruit wine were determined.

[0051] The results of the physicochemical indexes of the fermented Sorbus aucuparia fruit wine inoculated with commercial non-Saccharomyces NS-D or Candida olea XP0136 followed by commercial yeast BV818 are shown in Table 1. Due to the low total sugar content of the original Sorbus aucuparia juice, exogenous sucrose was supplemented to make the initial sugar content of the fermentation 216 g / L. As the fermentation proceeded, the final alcohol content of the commercial non-Saccharomyces NS-D group and the Candida olea XP0136 group was 10.50 %v / v and 10.80 %v / v, respectively.

[0052] Color is one of the important indicators for evaluating the quality of fruit wine. Color saturation (C*ab) reflects the saturation degree of the color of fruit wine, and the higher the saturation value, the more concentrated the color of fruit wine. Compared with the color of the original Sorbus aucuparia juice, the color of the Sorbus aucuparia fruit wine fermented by XP0136 was more saturated than that fermented by NS-D. Hue (hab*) represents the color phase of fruit wine, and the closer the hab* value to 0, the closer the color to red. Fruit wine with high hue value mostly has a more obvious yellow hue. As shown in Table 1, the hue of the Sorbus aucuparia fruit wine fermented by XP0136 was closer to red than that fermented by NS-D. The comprehensive color difference value (ΔE) indicates that XP0136 can improve the color quality of the Sorbus aucuparia fruit wine better than NS-D.

[0053] Table 1. Basic Physicochemical Indicators of Mixed Fermentation Black Chordata Wine

[0054] Depend on Figure 7 It was found that a total of 89 volatile compounds were detected during the fermentation of black chokeberry wine, including 38 esters, 22 alcohols, 8 acids, 7 volatile phenols, 2 aldehydes and ketones, and 12 other compounds. Compared to commercial non-brewing yeast NS-D (… Figure 7 A), Candida citrinum XP0136 ( Figure 7 B) Fermented black chokeberry wine contains high levels of volatile compounds, including ethyl caprylate (1012.91±4.90 μg / L), ethyl hexanoate (19575.81±428.8 μg / L), isoamyl acetate (31650.06±116.55 μg / L), damascene (2241.7±94.6 μg / L), ethyl laurate (8334.62±538.39 μg / L), and eugenol (240.9±109.5 μg / L). These compounds contribute to the more prominent fruity aromas (banana, pineapple) and rose aromas in black chokeberry wine.

[0055] Considering the volatile substances in both fermented wines, the *Candida citrinum* XP0136 of this invention, when fermenting black chokeberry wine, exhibits more prominent fruit and rose aromas compared to the commercial non-brewing yeast NS-D. This demonstrates that the application of *Candida citrinum* XP0136 in high-tannin fruit wines helps inhibit the formation of undesirable flavor compounds, making it the most suitable high-tannin-tolerant yeast for fermenting high-tannin fruit wines and enhancing their aroma-enhancing properties.

Claims

1. Candida citrinum ( Candida quercitrusa XP0136, characterized in that, CGMCC No. 34757.

2. A microbial inoculant, characterized in that, The Candida quercitrusa XP0136 of claim 1.

3. The microbial inoculant of claim 2, wherein, Candida auris XP0136 addition level of 10 6 CFU / mL and above.

4. A leavening agent, characterized in that, The microbial inoculant of claim 2 or the fermenting agent of claim 4.

5. The use of the Candida quercitrusa XP0136 of claim 1, the microbial inoculant of claim 2 or the fermenting agent of claim 4 in fruit wine brewing.

6. Use according to claim 5, characterized in that, The fruit wine is at least one of black aronia melanocarpa fruit wine, mulberry fruit wine, persimmon fruit wine, blueberry fruit wine, Chinese wolfberry fruit wine, green plum fruit wine, snow pear fruit wine, black grape fruit wine, pomegranate fruit wine, banana fruit wine, cranberry fruit wine, hawthorn fruit wine, lychee fruit wine, longan fruit wine, blackcurrant fruit wine or apple fruit wine.

7. A method of fruit wine fermentation, characterized by, The method comprises the following steps: adding the Candida quercitrusa XP0136 of claim 1, the microbial inoculant of claim 2 or the fermenting agent of claim 4 into fruit juice, and then fermenting.

8. The method of fruit wine fermentation according to claim 7, characterized in that, During the fermentation, the Candida quercitrusa XP0136, the microbial inoculant or the fermenting agent is co-fermented with other Saccharomyces cerevisiae.

9. A method of enhancing volatile flavour compounds in a fruit wine, characterised by, The method comprises the following steps: adding the Candida quercitrusa XP0136 of claim 1, the microbial inoculant of claim 2 or the fermenting agent of claim 4 into fruit juice, and then fermenting.

10. The method of enhancing volatile flavour compounds of a fruit wine according to claim 9, wherein, The volatile flavor substances comprise at least one of ethyl octanoate, ethyl hexanoate, isoamyl acetate, damascone, ethyl laurate or eugenol.