Recombinant cordyceps militaris strain with high yield of beta-glucan as well as construction method and application of recombinant cordyceps militaris strain

Abstract

The invention provides a recombinant cordyceps militaris strain with high yield of beta-glucan as well as a construction method and application of the recombinant cordyceps militaris strain, and belongs to the technical field of bioengineering and genetic breeding of edible fungi. According to the invention, a cordyceps militaris CmGls super-safe overexpression vector is constructed through a CRISPR-Cas9 technology, and then the cordyceps militaris CmGls super-safe overexpression vector is transferred into cordyceps militaris to obtain a recombinant cordyceps militaris strain with high yield of beta-glucan. According to the recombinant cordyceps militaris strain, membrane binding type beta-1, 3-glucan synthetase gene CmGls is accurately inserted into a safe port site CmSh1 of a cordyceps militaris genome, compared with a wild type cordyceps militaris strain, the growth rate of the recombinant cordyceps militaris strain is remarkably increased by 15% or above, and yellow phenotype and cell wall stress resistance are remarkably enhanced; after 6 days of submerged fermentation, the mycelium amount and the extracellular beta-glucan yield are respectively improved by more than 10%, and the strain has good application in improving beta-glucan synthesis.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of bioengineering and edible fungus genetic breeding, and particularly relates to a recombinant Cordyceps militaris strain with high β-glucan yield, a construction method thereof and application. BACKGROUND

[0002] Cordyceps militaris is a fungus with significant food and medicinal value, rich in cordyceps polysaccharides, cordyceps acid, cordycepsin and other bioactive components. At present, the researches on cordyceps polysaccharides and glucans mainly focus on the isolation and purification of fruiting body polysaccharides, mycelium polysaccharides and fermentation extracellular polysaccharides, fine structure analysis, in vivo and in vitro anti-tumor, immune enhancement, anti-virus, antioxidant and other functional activity evaluation. However, the researches on improving the synthesis of cordyceps polysaccharides are relatively insufficient. For example, Zhu et al. changed the fermentation conditions to affect the transcription level and enzyme activity of polysaccharide synthesis related enzyme system of Cordyceps militaris, and affected the yield of mycelium polysaccharides and extracellular polysaccharides.

[0003] Fungal glucans play an important functional role in cell wall structure, host-pathogen interaction and energy storage processes. Among them, β-1,3-glucans from edible fungi are considered to be the main contributors to various nutritional and supplementing effects, including immune regulation, anti-inflammatory, anti-tumor, antibacterial, blood lipid-lowering and blood glucose-lowering activities. However, edible fungi belong to large higher fungi, and compared with yeasts and filamentous fungi, their genetic background is unclear, lack of precise and efficient genome editing and stable and reliable genetic transformation technology, which seriously hinders the functional analysis of their genes / enzymes, and also leads to the lagging behind of the research on the mining and molecular regulation of their polysaccharide / glucan synthesis pathways. Therefore, carrying out the analysis of the biosynthesis pathway of functional components of edible fungi, elucidating the key enzyme system and its function in the synthesis pathway, and purposefully modifying the genome of edible fungi to cultivate new varieties of edible fungi with high yield of functional active ingredients, are the main strategies to fundamentally solve the problem of low yield of β-1,3-glucan in edible fungi.

[0004] The insertion of a target gene into the genome to achieve its overexpression is the cornerstone of studying its function and improving / creating germplasm resources. However, the random insertion / integration of a target gene is prone to be silenced by nearby elements, and affects the expression of nearby endogenous genes, thereby changing the behavior of cells. A genome safe site (Safe harbor / haven) provides a safe and reliable "port" for foreign genes, meets the stable and efficient expression of foreign genes, and does not cause any identifiable phenotypic changes. A plurality of safe sites for inserting foreign / target genes have been identified in the genomes of filamentous fungi such as Aspergillus fumigatus. For example, a group led by Xiaorong Lin of the University of Georgia identified a region located between Afu1g03670 and Afu1g03680 of Aspergillus fumigatus as a safe site SH1, and the insertion of a DNA fragment carrying a fluorescent protein gene did not significantly change its growth phenotype. In addition, the genome editing technology based on CRISPR / Cas9 provides a core enabling technology for identifying the function of target genes and improving / creating germplasm resources. For example, patent CN 119061044 A discloses a CRISPR / Cas9 scarless knockout of Cordyceps militaris type I hydrophobin encoding gene Cmhyd4, which creates a high-yield strain of Cordyceps militaris, and realizes directional breeding. However, the use of genome-targeted editing technology to improve the synthesis of β-1,3-glucan in Cordyceps militaris is still blank.

[0005] Therefore, it is necessary to develop a fungal gene editing system that is convenient to operate, has high editing efficiency and high biological safety, and further obtain a genetically engineered strain with high β-glucan yield, thereby providing solid technical support and protection for the research in the fields of molecular breeding of edible and medicinal fungi, multi-gene function research and high-throughput gene screening. SUMMARY

[0006] In view of the deficiencies in the prior art, the present application provides a recombinant Cordyceps militaris strain with high β-glucan yield and a construction method and application thereof. The present application constructs a Cordyceps militaris CmGls super-safe overexpression vector by CRISPR-Cas9 technology, and then transfers the Cordyceps militaris CmGls super-safe overexpression vector into Cordyceps militaris to obtain a recombinant Cordyceps militaris strain with high β-glucan yield. The recombinant Cordyceps militaris strain realizes the precise insertion of the membrane-bound β-1,3-glucan synthase gene CmGls into the safe harbor site CmSh1 of the Cordyceps militaris genome. Compared with the wild-type Cordyceps militaris strain, the growth rate is significantly improved by more than 15%, the yellow phenotype and cell wall stress resistance are obviously enhanced, the mycelial biomass and extracellular β-glucan yield are increased by more than 10% after 6 days of submerged fermentation, and the recombinant Cordyceps militaris strain has good application in improving the synthesis of β-glucan.

[0007] In order to achieve the above technical purposes, the present application adopts the following technical means:

[0008] The application provides a Cordyceps militaris CmGls super-safe overexpression vector.

[0009] The vector carries AMA1 with a replication initiation function, a Cas9 gene sequence derived from Streptococcus pyogenes, and an antibiotic resistance gene such as a hygromycin resistance gene;

[0010] The nucleotide sequence of the 5S rRNA is shown in SEQ ID NO: 1.

[0011] The nucleotide sequence of the sgRNA is shown in SEQ ID NO: 2.

[0012] The GenBank accession number of the Cordyceps militaris CmGls gene is ON352052.

[0013] Preferably, the vector of the Cordyceps militaris CmGls super-safe overexpression vector comprises pAMA1-Hyg-Cas9.

[0014] Preferably, the construction method of the Cordyceps militaris CmGls super-safe overexpression vector comprises:

[0015] The 5S rRNA, gRNA, and Cordyceps militaris CmGls gene are sequentially and seamlessly cloned into the pAMA1-Hyg-Cas9 vector by homologous recombination to obtain the Cordyceps militaris CmGls super-safe overexpression vector.

[0016] The application also provides a recombinant Cordyceps militaris strain with high β-glucan production. The recombinant Cordyceps militaris strain with high β-glucan production comprises the Cordyceps militaris CmGls super-safe overexpression vector.

[0017] Preferably, the host strain of the recombinant Cordyceps militaris strain with high β-glucan production comprises Cordyceps militaris CM01.

[0018] Preferably, the construction method of the recombinant Cordyceps militaris strain with high β-glucan production comprises:

[0019] The recombinant Cordyceps militaris strain with high β-glucan production is obtained by transforming the Cordyceps militaris CmGls super-safe overexpression vector into protoplasts of the host strain, and then screening and verifying.

[0020] Preferably, the construction method of the protoplast comprises: incubating spore liquid of the host strain in MY medium for 4 days, then washing with 0.4-0.6M mannitol solution, adding 0.8-1.5% (w / w) lywallzyme for enzymolysis at 28-40℃ for 1.5-4.5h after washing, centrifuging to collect the insoluble matter after enzymolysis, filtering, and obtaining the protoplast.

[0021] Preferably, the concentration of the spore liquid of the host fungus is greater than 1×10 6 / mL.

[0022] The transformation method includes electric shock transformation and PEG transformation.

[0023] Preferably, the step of PEG transformation is as follows:

[0024] The CmGls overexpression vector, protoplast and PEG transformation agent are mixed together, and then the protoplast is coated on a plate with hygromycin resistance, and the CmGls overexpression strain is obtained through screening.

[0025] Preferably, the dosage of the CmGls overexpression vector is 1 μg to 5 μg.

[0026] Preferably, the resistance gene used in the screening is hygromycin. Specifically, a regeneration Re-PDA medium plate containing hygromycin with a concentration of 100-800 μg / mL is configured, the protoplast is added to the CmGls protoplast after being static on ice for 1 h, and then the protoplast is coated on the regeneration plate after PEG-mediated transformation, and the high-yield β-glucan recombinant CmGls strain is obtained through screening at 20-30 ℃.

[0027] The application further provides the use of the CmGls overexpression vector or the recombinant CmGls strain in improving the content of β-glucan in CmGls.

[0028] The application further provides a method for improving the synthesis amount of β-glucan in CmGls. The method comprises inoculating the seed liquid of the recombinant CmGls strain into a fermentation medium to produce β-glucan through fermentation culture.

[0029] Preferably, the mycelium wet weight of the seed liquid is 5-15 g / L, and the inoculation amount of the seed liquid is 3-20% of the volume of the fermentation medium.

[0030] Preferably, the fermentation culture condition is that the temperature is 20-30 ℃, the pH is 5-7.5, the culture time is 5-15 days, and the fermentation yield of β-glucan is 5-40 g / L.

[0031] Preferably, the components of the fermentation medium include glucose 10-60 g / L, peptone 1-10 g / L, magnesium ions 0.1-2.0 g / L and phosphorus ions 0.1-2.0 g / L. More preferably, the magnesium ions are magnesium sulfate heptahydrate, and the phosphorus ions are potassium dihydrogen phosphate.

[0032] Compared with the prior art, the application has the following beneficial effects:

[0033] This invention constructs an ultra-safe overexpression vector for *Cordyceps militaris* CmGls using CRISPR-Cas9 technology, and then transforms this vector into *Cordyceps militaris* to obtain a recombinant *Cordyceps militaris* strain that produces high levels of β-glucan. This recombinant strain achieves precise insertion of the 5.9-kb membrane-bound β-1,3-glucan synthase gene CmGls into the safe harbor site CmSh1 in the *Cordyceps militaris* genome. Comparison of mycelial growth and fermentation characteristics reveals that, compared to wild-type *Cordyceps militaris* strains, the recombinant strain exhibits a significantly increased mycelial growth rate of over 15%, a pronounced yellow phenotype, and significantly enhanced resistance to cell wall stress.

[0034] The recombinant Cordyceps militaris strain of this invention upregulates the transcriptional levels of polysaccharide / glucan synthesis-related genes such as CmPgm, CmPgi, and CmUgp, thereby increasing the yield and molecular weight of extracellular polysaccharides. After 6 days of submerged fermentation, mycelial mass and extracellular β-glucan yield increased by more than 10% without altering their basic structural characteristics. This invention not only provides direct evidence for elucidating the fungal glucan biosynthesis pathway but also lays a technical foundation for developing safe and efficient high-yield polysaccharide / glucan strains in edible fungi.

[0035] The method provided by this invention does not require the introduction of specific antibiotic selection markers, is simple and convenient to operate, and has high efficiency in editing the target gene. It can effectively increase the content of β-glucan in Cordyceps militaris, providing a new method and direction for efficient and high-yield β-glucan production, and has good prospects for industrial application. Attached Figure Description

[0036] Figure 1 This diagram illustrates the process of constructing an ultra-safe overexpression vector of Cordyceps militaris CmGls using the Safe harbor (CmSh1) targeting CRISPR / Cas9 system; in the diagram, a represents pAMA1-Hyg-Cas9; and b represents pAMA1-Cas9-sgRNA. Cmsh1 c represents the constructed ultra-safe CmGls overexpression vector pAMA1-Cas9-sgRNA-CmGls OE ;d shows the PCR validation results, where the upper gel image is the CmGls gene fragment carrying the homologous arm, and the lower gel image is the CmGls gene overexpression vector pAMA1-Cas9-sgRNA-CmGls. OE .

[0037] Figure 2This figure shows the screening and validation of Cordyceps militaris CmGls overexpressing strains; in the figure, a represents the gene fragments of clones corresponding to primers P1 and P2 for validating the gene sequence; P1 and P2 represent the results of screening and validation with different primers, respectively. In the figure, lane M: marker; lanes 1-3: CmGlsOE-1, CmGlsOE-2 and CmGlsOE-3; lane 4: WT; lane 5: deionized water.

[0038] Figure 3 The growth performance of Cordyceps militaris CmGls overexpression strains on PPDA (a-b), hygromycin-containing PPDA (c-d), H2O2 (e-f), Congo red (g-h), CFW (i-j), and FDA (k-l) media was evaluated.

[0039] Figure 4 The yields of mycelial polysaccharides (a) and extracellular polysaccharides (b) of Cordyceps militaris CmGls overexpression strains on days 2, 4, and 6 of fermentation.

[0040] Figure 5 The figures show the changes in the monosaccharide composition of mycelium and extracellular polysaccharides of the *Cordyceps militaris* CmGls overexpression strain during fermentation on days 2, 4, and 6. The left panel shows the changes in monosaccharide composition in extracellular polysaccharides during days 2, 4, and 6 of fermentation, while the right panel shows the changes in monosaccharide composition in mycelial polysaccharides (intracellular polysaccharides) during days 2, 4, and 6 of fermentation.

[0041] Figure 6 for 1 H / 13 The polysaccharide structure was identified by C10 NMR; in the figure, a represents the extracellular polysaccharide fermented by WT strain and recombinant Cordyceps militaris strain. 1 ¹H NMR spectrum; b represents the extracellular polysaccharide fermented from WT strain and recombinant Cordyceps militaris strain. 13 C NMR spectrum;

[0042] Figure 7 FT-IR configuration diagrams for identifying glycosidic bonds in polysaccharides; in the figure, a is the FT-IR spectrum of extracellular polysaccharides fermented by WT strain and recombinant Cordyceps militaris strain; b is the FT-IR spectrum of extracellular polysaccharides fermented by WT strain and recombinant Cordyceps militaris strain.

[0043] Figure 8 WT strains and recombinant Cordyceps militaris strain CmGls were compared at different fermentation times. OE-2 A graph showing the changes in transcriptional levels of 18 genes related to polysaccharide / glucan synthesis and cell wall assembly; where the horizontal axis represents the names of the 18 genes related to polysaccharide / glucan synthesis and cell wall assembly, and the vertical axis represents their transcriptional levels; a represents day 2 of fermentation; b represents day 4 of fermentation; c represents day 6 of fermentation. Detailed Implementation

[0044] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the scope of protection of the present invention is not limited thereto. The following embodiments are for a clear and complete description of the technical solutions of the present invention. Obviously, the described embodiments are some embodiments of the present invention, but not all embodiments. Based on the described embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0045] In the following embodiments, various processes and methods not described in detail are all conventional methods known in the art. The source, trade name, and, where necessary, composition of the reagents used are indicated upon their first appearance; subsequent use of the same reagents, unless otherwise specified, follows the same source as initially indicated. All reagents and materials involved, unless otherwise specified, are obtained for commercial use. Unless otherwise defined, the technical or scientific terms used herein should be understood in their ordinary sense by one of ordinary skill in the art to which this invention pertains.

[0046] The culture medium used in the following examples is:

[0047] PPDA medium: peeled potatoes (200g boiled juice filtered), glucose 20g / L, peptone 10g / L, natural pH;

[0048] MY medium: glucose 20 g / L, peptone 10 g / L, KH2PO4 2 g / L, MgSO4·7H2O 1 g / L, pH natural;

[0049] Re-PDA medium: peeled potatoes (200g boiled juice filtered), tryptone 3g / L, KH2PO4 1g / L, MgSO4·7H2O 0.5g / L, sorbitol 182.1g / L, glucose 20g / L, pH natural;

[0050] Cordyceps militaris seed culture medium: glucose 20 g / L, peptone 10 g / L, KH2PO4 1 g / L, MgSO4·7H2O 1 g / L, pH natural.

[0051] Cordyceps militaris fermentation medium: glucose 30g / L, peptone 10g / L, KH2PO4 1.5g / L, MgSO4·7H2O 1.5g / L, pH natural.

[0052] The Cordyceps militaris CM01 used in the following examples is Cordyceps militaris CICC14015, purchased from the China Industrial Microbial Culture Collection Center.

[0053] Example 1: Construction of an ultra-safe overexpression vector for Cordyceps militaris CmGls

[0054] This embodiment constructs an ultra-safe overexpression vector of Cordyceps militaris CmGls, and the construction process is as follows: Figure 1 As shown, the construction steps are as follows:

[0055] Obtaining S1.5S rRNA:

[0056] Using the vector pAMA1-Hyg-Cas9 (purchased from Biovector China Plasmid Vector Strain Cell Line Gene Depository) carrying AMA1 with replication initiation function, the Cas9 gene sequence derived from Streptococcus pyogenes, and resistance genes such as hygromycin as a template, 5S rRNA was cloned using primers Bste-5srRNA-F and Bste-5srRNA-R. The nucleotide sequence of the 5S rRNA is shown in 5S rRNA (SEQ ID NO:1).

[0057] 5S rRNA (SEQ ID NO:1):

[0058] ACATACGACCATACCCACTGGAAAACTCGGGATCCCGTCCGCTCTCCCATAGATAAGCCAGTGAGGGCCAGACTAGTAGTTGGGTCGGTGACGACCAGCGAATCCCTGGTGTTGTATGTT.

[0059] Among them, Bste-5srRNA-F (SEQ ID NO:3):

[0060] 5'- GAATGATCCGCCTAAAGCGT GGTCACCACATACGACCATACCCACTGGAA-3';

[0061] Bste-5srRNA-R (SEQ ID NO:4):

[0062] 5'- CGACTATTGTCTGCACGTAC AACATACAACACCAGGGATTCGC-3';

[0063] The bolded underlined parts are the homologous arm sequences used in homologous recombination to construct plasmids.

[0064] PCR conditions: 10 μl of 2×Rapid Mix Vazyme; 9.2 μl of vector template; 0.4 μl each of forward and reverse primers; PCR reaction conditions: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, annealing for 30 s, annealing temperature (4℃, 72℃ extension for 30 s), 35 cycles. PCR product as shown... Figure 1 The gel image (top) shows the purified 5S rRNA fragment.

[0065] Obtaining S2.sgRNA:

[0066] The sgRNA of the target safe overexpression site CmSh1 was designed and edited online using CRISPOR (http: / / crispor.tefor.net / ) or CHOPCHOP (http: / / chopchop.cbu.uib.no / ). The vector pAMA1-Hyg-Cas9, which carries the replication initiation function of AMA1, the Cas9 gene sequence derived from Streptococcus pyogenes, and resistance genes such as hygromycin, was used as a template. The sgRNA sequence was cloned using primers Bste-gRNA-scaf-F and Bste-gRNA-scaf-R. The nucleotide sequence of the sgRNA was GTACGTGCAGACAATAGTCG (SEQ ID NO:2).

[0067] Bste-gRNA-scaf-F:

[0068] 5'- GTACGTGCAGACAATAGTCG GTTTTAGAGCTAGAAATAGCAAGT-3' (SEQ ID NO: 5);

[0069] Bste-gRNA-scaf-R:

[0070] 5'- TCACCGGGCGGCTCGTACAAGGTCACC GCCTGTCAAAAAAGCACCGACTC-3' (SEQ ID NO: 6).

[0071] The bolded underlined parts are the homologous arm sequences used in homologous recombination to construct plasmids.

[0072] PCR conditions: 10 μl of 2×Rapid Mix Vazyme; 9.2 μl of vector template; 0.4 μl each of forward and reverse primers; PCR reaction conditions: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, annealing for 30 s, annealing temperature (4℃, 72℃ extension for 30 s), 35 cycles. PCR product as shown... Figure 1 The gel image (top) shows the purified and recovered target fragment sgRNA.

[0073] S3. Overexpression of recombinant vector pAMA1-Cas9-sgRNA CmSh1 Construction:

[0074] By digesting pAMA1-Hyg-Cas9 with the BsteII enzyme, the 5S rRNA and sgRNA sequences were homologously recombinated seamlessly into the BsteII-digested vector pAMA1-Hyg-Cas9, yielding the recombinant vector pAMA1-Cas9-sgRNA. CmSh1Then, the expression of the recombinant vector pAMA1-Cas9-sgRNA was verified by transforming it into E. coli DH5α. CmSh1 Successfully built.

[0075] S4. Cordyceps militaris CmGls ultra-safe overexpression vector pAMA1-Cas9-sgRNA CmSh1 -CmGls OE Obtaining:

[0076] The recombinant vector pAMA1-Cas9-sgRNA obtained by PmeI digestion of S3 was... CmSh1 The gene CmGls (GenBank accession number: ON352052) was seamlessly cloned into pAMA1-Cas9-sgRNA digested with PmeI. CmSh1 The ultra-safe overexpression vector pAMA1-Cas9-sgRNA for Cordyceps militaris CmGls was obtained. CmSh1 -CmGls OE PCR validation products such as Figure 1 The gel image (bottom) confirms overexpression of the recombinant vector pAMA1-Cas9-sgRNA. CmSh1 -CmGls OE Successfully built.

[0077] Example 2: Construction and fermentation expression of a recombinant Cordyceps militaris strain with high β-glucan production

[0078] S1. Preparation of grassland biomass from pupae:

[0079] Cordyceps militaris CM01 was grown on PPDA plates for 7-10 days. After scraping off the spores, the spores were filtered and transferred to MY medium for static culture for 3-6 days. After the culture was completed, the supernatant was removed by centrifugation at 8600 rpm for 5 minutes, and the mycelium was collected.

[0080] The bacterial cells were washed twice with 0.4-0.6M mannitol solution, and then centrifuged at 8000 rpm for 5 min to remove the mannitol. Enzyme solution (0.8-1.5% (w / w) lysozyme, prepared for membrane filtration) was added to the washed bacterial cells, mixed thoroughly, and incubated at 28-40℃ and 90 rpm for 1.5-4.5 h. The incubated bacterial cells were filtered through a filter cloth, and the filtrate was collected. Protoplasts were collected by centrifugation at 4000 rpm for 12 min, and resuspended in STC buffer (containing 1.2M sorbitol, 10mM Tris pH 7.5, and 50mM CaCl2) for later use.

[0081] S2. PEG-mediated transformation:

[0082] The protoplasts obtained in step S1 were diluted to 1×10⁻⁶. 6 -108 The volume of PEG was 1-5 μg / mL, and the mixture was pre-cooled on ice for 1 h. Then, 1-5 μg of the Cordyceps militaris CmGls ultrasafe overexpression vector constructed in Example 1 was added. A small amount of PEG was added to each centrifuge tube, and the mixture was mixed by pipetting. The tubes were then incubated on ice for 30 min.

[0083] After incubation, add 100-1000 μL of PEG and mix well, then add STC buffer. Centrifuge at 3000 rpm for 15 min, collect the precipitate, and resuspend in STC buffer. Spread the resuspended solution onto Re-PDA plates containing hygromycin resistance. Transfer the transformants grown on the Re-PDA plates to PPDA plates containing hygromycin resistance. Incubate at 20-30℃ for 6-10 days to obtain Cordyceps militaris CmGls ultrasafe overexpression positive transformants.

[0084] Genomic DNA was extracted from positive transformants using the CTAB method. A suitable amount of hyphae was picked and placed in a centrifuge tube. CTAB extraction buffer was added, and the genome was extracted by incubating in a 65°C water bath for 20-30 min. Then, chloroform:isoamyl alcohol (24:1) was added, and the mixture was mixed by inverting. The supernatant was collected by centrifuging at 13,000 rpm for 3-5 min. Isoamyl alcohol was added, and the mixture was centrifuged at 12,000 rpm for 6 min to collect the precipitate. The precipitate was washed with 70% ethanol and dried to obtain post-genomic DNA.

[0085] Using water as a control group, and with the genome of the proposed positive transformant as a template, two pairs of primers were designed on the CmSh1 genome (intermediate region between CCM_00870 and CCM_00871) to verify the transformant.

[0086] The primers used were CmGls-UP-CHECK-F1: 5'-AAGGAGGTTATTAGTCGTGG-3' (SEQ ID NO: 7);

[0087] CmGls-UP-CHECK-R1: 5'-AAATGGTACTCAATGGGCTG-3' (SEQ ID NO: 8);

[0088] CmGls-DOWN-CHECK-F2): 5'-ATGTAGTCGGCATGGAGGGA-3' (SEQ ID NO: 9;

[0089] CmGls-DOWN-CHECK-R2:5'-CATCTTTTTGTCGGGAGATT-3' (SEQ ID NO: 10).

[0090] Three positive transformants were identified and identified as Cordyceps militaris CmGls overexpressing strains: CmGls OE-1 ~CmGls OE-3PCR verification results are as follows Figure 2 As shown in the figure, the target band P1 (including part of CmGls and TtrpC) is 2348bp, and the target band P2 (including part of CmGls and CmGpd) is 3336bp. After testing, it was found that the CmGls gene of Cordyceps militaris was successfully integrated into the safe harbor site CmSh1 of the Cordyceps militaris genome.

[0091] The growth performance of WT and Cordyceps militaris CmGls overexpression strains, for example Figure 3 As shown. After 5 days of culture on PPDA plates, the average growth rate of the WT strain was 3.50 ± 0.2 mm / d, while overexpression of CmGls increased the mycelial growth rate to 4.42 ± 0.2 mm / d; the WT strain could not grow on PPDA plates containing a certain concentration of hygromycin, while CmGls... OE-1 -CmGls OE-3 The mycelial growth rate of the transformants reached 4.58 ± 0.2 mm / d. The recombinant Cordyceps militaris strain showed enhanced sensitivity to various cell wall disruptors, including: 100 μg / mL Congo red mycelial growth rate: 4.12 ± 0.2 mm / d; 10 μg / mL CFW (CalcofluorWhite): 3.62 ± 0.2 mm / d; 3 mM H₂O₂: 3.91 ± 0.2 mm / d; 50 μg / mL FDA: 3.87 ± 0.2 mm / d. These growth rates were significantly higher than those of the WT strain, indicating that the recombinant Cordyceps militaris strain significantly improved the strain's tolerance to cell wall stress. This change in sensitivity is mainly attributed to the increased glucan content in the cell wall of the recombinant Cordyceps militaris strain and the enhanced cell wall integrity.

[0092] S3. Fermentation synthesis of extracellular polysaccharides and mycelial polysaccharides:

[0093] The recombinant Cordyceps militaris strain with high β-glucan production obtained in S2 was transferred to a non-resistant PPDA plate and cultured in an incubator for 6-10 days. After inoculation, the strain was cut into approximately 3×3 mm pieces and transferred to Cordyceps militaris seed culture medium (250 mL / bottle), with approximately 8-10 pieces per bottle. After culturing at 150 rpm and 20-30℃ for 5 days, the strain was transferred to Cordyceps militaris fermentation medium (500 mL / bottle) at a 10% inoculation rate and fermented at 150 rpm and 20-30℃ for 2, 4, and 6 days, respectively. The mycelia and fermentation broth were collected by centrifugation at 8000 rpm for 20 min and 15℃, respectively.

[0094] After 2, 4, and 6 days of fermentation, the supernatant was rotary evaporated to 1 / 5 of its original volume, precipitated with alcohol for 24 hours, and centrifuged to remove the supernatant. The precipitate was the crude polysaccharide, which was then freeze-dried for 48 hours to determine the extracellular polysaccharide yield. The mycelium was washed with deionized water, freeze-dried for 48 hours, and weighed. Deionized water was added at a material-to-liquid ratio of 1:25, and the mixture was thoroughly mixed. The mixture was then incubated in a 90°C water bath for 2 hours, centrifuged to collect the intracellular polysaccharide extract, rotary evaporated to 1 / 5 of its original volume, and 4 times its volume of anhydrous ethanol was added. The mixture was precipitated with alcohol for 24 hours, centrifuged to remove the supernatant, and freeze-dried for 48 hours to obtain the intracellular polysaccharide.

[0095] like Figure 4 As shown, the biomass of the WT strain after 2d, 4d, and 6d fermentation reached 5.88 g / L, 9.68 g / L, and 11.03 g / L, respectively, while CmGls OE-1 -CmGlsO E-3 The biomass yields increased by 8.26–9.14 g / L, 12.01–12.99 g / L, and 12.65–13.73 g / L, respectively. The polysaccharide yield of the WT strain increased from 3.48 g / 100 g on day 2 to 4.76 g / 100 g on day 6, while CmGls overexpression significantly increased polysaccharide yield, from 4.85–4.97 g / g on day 2 to 7.89–8.9 g / 100 g on day 6. Furthermore, the experimental results showed that the extracellular polysaccharide yield of the recombinant Cordyceps militaris strain after 6 days of fermentation was higher than that of the wild type (4.32 g / L), which confirms that CmGls directly affects the mycelial growth and polysaccharide synthesis of Cordyceps militaris.

[0096] Effects of S4.CmGls overexpression on the monosaccharide composition and structure of extracellular and mycelial polysaccharides:

[0097] Changes in mycelial and extracellular polysaccharide / monosaccharide composition between WT strain and recombinant Cordyceps militaris strain are as follows: Figure 5As shown, the mycelial polysaccharides of the WT strain after 2 days of fermentation mainly consisted of glucose (43.23%), galactose (20.78%), mannose (21.08%), fructose (9.49%), galacturonic acid (GalA, 2.09%), and glucuronic acid (GlcA, 1.6%). With the fermentation time extended to 6 days, the contents of glucose and fructose decreased to 33.92% and 3.45%, respectively, while the contents of galactose, GalA, and GlcA increased to 28.07%, 2.93%, and 3.43%, respectively. Notably, 3.45% fructose was still detectable in the mycelial polysaccharides after 6 days of fermentation. In the recombinant Cordyceps militaris strain, the glucose content of mycelial polysaccharides showed a decreasing trend, from 45.59% on day 2 to 36.01% on day 6. Fructose was detected on day 2 (10.82%), and its content gradually decreased to 4.25% on day 6. With prolonged fermentation time, the contents of monosaccharides such as galactose, mannose, galacturonic acid (GalA), and glucuronic acid (GlcA) increased significantly, while the content of glucosamine showed a decreasing trend. Compared with the WT strain, the recombinant Cordyceps militaris strain increased the proportion of mannose and galactose in mycelial polysaccharides, while decreasing the proportion of other monosaccharides. The extracellular polysaccharides of both the WT strain and the recombinant Cordyceps militaris strain were mainly composed of glucose (76.79-93.09%), with small amounts of galactose (1.33-7.59%), mannose (0.17-2.16%), GalA (1.27-6.69%), and GlcA (1.08-6.17%). This confirmed that the extracellular polysaccharides of Cordyceps militaris have a glucan backbone structure, and that CmGls overexpression can increase the glucose content in the extracellular polysaccharides.

[0098] The intracellular / extracellular polysaccharides were freeze-dried and ground into powder. 0.04 g of the polysaccharide powder (extracellular / intracellular polysaccharides) was dissolved in deuterated water (D2O). 1 H / 13 The polysaccharide structure was identified by C10 NMR, measured on an ARX400 spectrometer (Bruker, Switzerland) at frequencies of 600 MHz and 125 MHz. Figure 6 It can be seen that, 1 H / 13 The polysaccharide structure was identified by C10 NMR, and the sample was... 1 ¹H spectrum δ 4.03-5.25 ppm, 13 The C-chromatogram (δ 51.49–95.97) represents the carbon proton chemical shifts, indicating that all mycelial polysaccharides contain β-glycoside configurations. A typical β-glycoside configuration has four signals in… 1 H and 13CNMR spectroscopy also revealed chemical shifts in the ectopic regions of the extracellular polysaccharide WT strain and the recombinant Cordyceps militaris strain at δ4.84, 44.75, δ58, and δ4.23485, respectively, with carbon peaks at 61.77, 63.19, 77.01, 76.44, 80.12, and 98.63 ppm. This demonstrates the presence of β-1,3-glycosidic bonds in C6, C4, C2, C5, C3, and C1, and that the recombinant Cordyceps militaris strain had no significant effect on the glycosidic configuration of the hyphae and extracellular polysaccharides.

[0099] Weigh 0.03 g of polysaccharide (extracellular / intracellular polysaccharide) powder and dry it in an oven at 60℃ to constant weight. Use Fourier transform infrared spectroscopy to resolve the polysaccharide structure at 400-4000 cm⁻¹. -1 Recordings were performed using an FT-IR spectrometer (Thermo Nicolet, Massachusetts, USA) within the specified range, and the results were plotted as a percentage of transmittance versus wavenumber. The results are as follows: Figure 7 As shown in the figure, FT-IR is a general method for identifying the glycosidic bond configuration in polysaccharides. Extracellular / intracellular polysaccharide spectra of WT mycelia and recombinant Cordyceps militaris strains were measured after 2, 4, and 6 days of fermentation. The figures reveal that the mycelial polysaccharides of the WT strain and the recombinant Cordyceps militaris strain exhibit similar typical polysaccharide spectral characteristics in the 3600-3000 cm⁻¹ range. -1 The strong absorption peak at 3000-2500 cm⁻¹ is attributed to the stretching vibration of the OH bond. -1 The weak absorption peak at 1800-1500 cm⁻¹ indicates the CH stretching vibration of the methylene group (-CH₂-); -1 The absorption peak at 1500-1200 cm⁻¹ corresponds to the C=O stretching vibration; -1 The range belongs to CH bending vibration; 1150-1050cm -1 The absorption peaks reflect the vibrations of COC and COH, indicating the presence of pyranose structures. The extracellular polysaccharides of the WT strain and the recombinant Cordyceps militaris strain after fermentation for 2, 4, and 6 days also showed similar Fourier transform infrared (FT-IR) characteristics: 3253-3269 cm⁻¹. -1 Strong absorption peak at 2930-2974 cm⁻¹ -1 The weak absorption peaks at these locations indicate the presence of pyranose ring structures and β-configurations in the polysaccharides. Therefore, it can be concluded that the recombinant Cordyceps militaris strain has no significant effect on the β-glycosidic bond configuration of the extracellular polysaccharides.

[0100] Effects of S5.CmGls overexpression on transcriptional levels of genes related to polysaccharide synthesis:

[0101] This step uses ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) to investigate the effect of CmGls overexpression on the transcriptional levels of genes related to polysaccharide / glucan synthesis and cell wall assembly by quantitative real-time PCR (qRT-PCR). The specific steps are as follows:

[0102] Total RNA was extracted from 100 mg of fermentation mycelium. Using a fungal total RNA isolation kit (Takara, Japan), cDNA was reverse transcribed using qPCR with HiScript III RT SuperMix (Vazyme, Nanjing, China) using total RNA as a template. The cDNA was then analyzed by quantitative real-time PCR (qRT-PCR) using ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China). The results are shown below. Figure 8 As shown.

[0103] like Figure 8 The changes in transcriptional levels of the WT strain and the recombinant Cordyceps militaris strain at 2, 4, and 6 days of fermentation were shown: the expression level of CmGls in the WT strain increased from 5.86 on day 2 to a peak of 10.07 on day 4, and then decreased to 6.50 on day 6. As expected, overexpression of CmGls led to a significant increase in its transcriptional level, reaching 21.64, 90.93, and 44.52 on days 2, 4, and 6, respectively (P<0.01), confirming that inserting CmGls into the CmSh1 site effectively enhanced the expression level of CmGls in Cordyceps militaris.

[0104] In summary, this invention provides a high-β-glucan-producing recombinant Cordyceps militaris strain, its construction method, and its applications. This invention constructs a highly safe overexpression vector of Cordyceps militaris CmGls using CRISPR-Cas9 technology, and then transforms this vector into Cordyceps militaris to obtain a high-β-glucan-producing recombinant Cordyceps militaris strain. This recombinant Cordyceps militaris strain achieves precise insertion of the membrane-bound β-1,3-glucan synthase gene CmGls into the safe harbor site CmSh1 in the Cordyceps militaris genome. Compared to the wild-type Cordyceps militaris strain, its growth rate is significantly increased by more than 15%, and its yellow phenotype and cell wall stress resistance are significantly enhanced. After 6 days of submerged fermentation, mycelial mass and extracellular β-glucan production are increased by more than 10%, demonstrating excellent application in enhancing β-glucan synthesis.

[0105] The embodiments described above are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments. Any obvious improvements, substitutions or modifications that can be made by those skilled in the art without departing from the essence of the present invention shall fall within the protection scope of the present invention.

Claims

1. A Cordyceps militaris CmGls ultra-safe overexpression vector, characterized in that, The Cordyceps militaris CmGls super-safe overexpression vector comprises 5S rRNA, sgRNA and Cordyceps militaris CmGls gene and vector; The vector carries AMA1 with replication initiation function, Cas9 gene sequence derived from Streptococcus pyogenes and hygromycin resistance gene; The nucleotide sequence of the 5S rRNA is shown in SEQ ID NO: 1; The nucleotide sequence of sgRNA is shown in SEQ ID NO: 2; The GenBank accession number of the Cordyceps militaris CmGls gene is ON352052.

2. The CmGls ultra-safe overexpression vector of Cordyceps militaris according to claim 1, characterized in that, The vector of the Cordyceps militaris CmGls super-safe overexpression vector comprises pAMA1-Hyg-Cas9.

3. A recombinant Cordyceps militaris strain producing high yield of β-glucan, characterized in that, The high-yield β-glucan recombinant Cordyceps militaris strain comprises the Cordyceps militaris CmGls super-safe overexpression vector of claim 1 or 2.

4. The recombinant C. pruinosa strain of claim 3, wherein, The host fungus of the high-yield β-glucan recombinant Cordyceps militaris strain comprises Cordyceps militaris CM01.

5. The method for constructing a recombinant Cordyceps militaris strain with high β-glucan production according to claim 3, characterized in that, It comprises: The high-yield β-glucan recombinant Cordyceps militaris strain is obtained by transforming the Cordyceps militaris CmGls super-safe overexpression vector of claim 1 into the protoplast of the host fungus, and then screening and verifying.

6. The method for constructing a recombinant C. pruinosa strain with high β-glucan production according to claim 5, characterized in that, The construction method of the protoplast comprises: culturing spore solution of the host fungus in MY medium for 4 days, then washing with 0.4-0.6M mannitol solution, adding 0.8-1.5% (w / w) lywallzyme for enzymolysis at 28-40℃ for 1.5-4.5h, centrifuging to collect the insoluble matter after enzymolysis, and filtering to obtain the protoplast.

7. The method for constructing a recombinant C. pruinosa strain with high β-glucan production according to claim 5, characterized in that, The dosage of the Cordyceps militaris CmGls super-safe overexpression vector is 1-5μg. The resistance gene used in the screening is hygromycin.

8. The Cordyceps militaris CmGls super-safe overexpression vector of claim 1 or the above-mentioned recombinant Cordyceps militaris strain of claim 3 is applied to improve the content of β-glucan in Cordyceps militaris.

9. A method for increasing the amount of β-glucan synthesis in Cordyceps militaris, characterized by, The method comprises: inoculating seed liquid of the recombinant Cordyceps militaris strain of claim 3 into fermentation medium, and fermenting to produce β-glucan.

10. The method for increasing the synthesis of β-glucan of Cordyceps militaris according to claim 9, characterized in that, The mycelium wet weight of the seed liquid is 5-15g / L; and the inoculation amount of the seed liquid is 3-20% of the volume of the fermentation medium. The fermentation conditions are: temperature is 20-30℃, pH is 5-7.5, culture time is 5-15 days, and the amount of β-glucan produced by fermentation reaches 5-40g / L. The components of the fermentation medium comprise: glucose 10-60g / L; peptone 1-10g / L; magnesium ions 0.1-2.0g / L; and phosphorus ions 0.1-2.0g / L.

Images