Vector for plant promoter dual-system quantitative characterization, standardization method, product and application
By designing a compact promoter characterization plasmid (pLIP) and a dual-luciferase system, standardized comparisons of promoter activity in different plant systems were achieved, solving the problem of poor data repeatability in existing technologies and improving the accuracy of detection and the reproducibility of experimental results.
Patent Information
- Application Number
- CN202511237782.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-01
- Publication Date
- 2025-12-05
- Estimated Expiration
- 2045-09-01
AI Technical Summary
The lack of unified experimental tools and standardized analytical procedures in existing technologies makes it difficult to compare promoter activity data in different plant expression systems. The complex structure of vectors affects transformation efficiency, and the lack of a unified normalization method for luciferase quantitative systems leads to poor data reproducibility, which limits the standardized application and communication of results in promoter research.
A compact promoter characterization plasmid (pLIP) was designed, containing a firefly luciferase driven by the target promoter and a Renilla luciferase internal control module driven by the 35S promoter. Combined with a dual-luciferase system, promoter activity was standardized and compared using the RPU method. This approach is suitable for cross-system compatibility between protoplast transient expression systems and leaf transient expression systems. Furthermore, the dual-luciferase system, using the RPU method, achieves cross-system compatibility of the promoter. The standardized comparison of promoter activity data is also achieved through a standardization method, making it suitable for standardized comparisons between plant expression systems and leaf transient expression systems.
This method enables standardized comparison of promoter activity across different plant expression systems, improves the accuracy and reliability of detection, solves the problem of poor data repeatability in existing technologies, enhances the reproducibility and cross-system compatibility of experimental results, and simplifies the vector construction and transformation process.
Smart Images

Figure CN121065240A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the field of plant synthetic biology and plant gene expression regulation, and particularly relates to a vector for plant promoter dual system quantitative characterization, a standardization method, a product and application. BACKGROUND
[0002] In the field of plant science research, the analysis of gene expression regulation mechanism is the core link to reveal the laws of plant growth and development, stress response and other life activities. As the "switch" of gene expression, the expression strength and spatiotemporal specificity of promoter directly determine the transcriptional activity of downstream genes, so the precise quantitative analysis of promoter function is of great significance. This analysis not only provides a key basis for the functional verification of functional genes, but also lays a foundation for the design and optimization of artificial gene circuits in synthetic biology, such as the controllable expression of target genes by regulating promoter activity, thereby improving plant traits or increasing the yield of biological products.
[0003] At present, the quantitative research of promoter expression strength mainly relies on protoplast transient expression system and Agrobacterium-mediated leaf transient expression system. The protoplast transient expression system, with the advantages of simple operation process and short experimental period, can complete the detection of a large number of samples in a short time, and is very suitable for high-throughput promoter screening and preliminary functional analysis, especially in the research of molecular mechanisms such as the interaction between promoter and transcription factor. On the contrary, the Agrobacterium-mediated leaf transient expression system retains the natural tissue environment and intercellular communication of plant cells, and its detection results are closer to the gene expression situation under the growth state of whole plant, so it has unique value in verifying the actual expression activity of promoter in complex tissues, and is often used for final functional confirmation experiment.
[0004] However, these two systems have significant limitations in practical applications, which seriously restrict the depth and breadth of promoter research. First, the lack of unified experimental tools and standardized analysis procedures makes it difficult to directly compare the promoter activity data obtained from different systems. For example, the vector backbone commonly used in protoplast systems differs from the vector used in leaf transient expression systems in terms of element composition and transfection efficiency, making it difficult to compare the detection results of the same promoter in the two systems, which greatly increases the difficulty of researchers integrating different experimental data. Second, the conventional vectors used for promoter research are usually complex in structure and large in molecular weight, which not only increases the difficulty of assembly during vector construction and reduces the construction efficiency, but also affects the transformation efficiency to some extent. In particular, in protoplast and other systems that are sensitive to transformation conditions, the large molecular weight of the vector may significantly reduce the success rate of transformation. In addition, the lack of a unified normalization method in the widely used luciferase quantification system is a major problem. Due to the influence of different experimental batches, different transformation efficiencies, and different cell states, the absolute expression of luciferase fluctuates greatly, and the existing normalization methods often vary from laboratory to laboratory, resulting in poor data reproducibility of the same promoter in different studies and the inability to form a unified reference standard, which greatly limits the standardized application of promoter elements and the exchange and integration of research results between different studies.
[0005] Therefore, developing a compact structure that can be applied to various plant expression systems and can realize the standardized characterization of promoter activity has become a key problem that needs to be solved in the field of plant gene expression regulation research. SUMMARY
[0006] To address the above shortcomings, the present application provides a promoter quantification characterization technology scheme suitable for tobacco systems, aiming to realize the standardized comparison of promoter activity between protoplast systems and leaf transient expression systems. The innovation of this scheme lies in the design and use of a compact structure, dual-system compatible promoter characterization plasmid (pLIP), combined with a dual-luciferase system, to realize the comparison of promoter activity in two systems through a standardized method (RPU), providing standardized tools for plant gene circuit design and synthetic element construction.
[0007] The technical scheme of the present application is: On the one hand, the present application provides a vector pLIP for dual-system quantification characterization of plant promoters, which is based on the modification of pUC19, retains the prokaryotic replication origin and resistance gene, inserts the Agrobacterium-compatible replication origin pSa ori and T-DNA left and right border sequences, designs Prefix and Suffix as assembly interfaces, and constructs an expression vector skeleton smaller than 3000 bp. The region of the T-DNA comprises two expression modules: a firefly luciferase reporter gene module driven by a to-be-tested promoter and a Renilla luciferase internal reference module driven by a 35S promoter.
[0008] Specifically, the sequence of the expression vector skeleton is shown in SEQ ID NO. 1.
[0009] Specifically, the sequence of the Prefix is shown in SEQ ID NO. 2; and the sequence of the Suffix is shown in SEQ ID NO. 3.
[0010] In another aspect, the present application provides a protoplast transfection expression system comprising the aforementioned vector pLIP.
[0011] Specifically, the pLIP vector is introduced into protoplasts by a PEG-CaCl2-mediated transformation method.
[0012] Specifically, the protoplasts are prepared by a tape stripping method and enzymolysis. Specifically, the protoplasts can also be prepared with the aid of a specially designed special device, such as a protoplast preparation pretreatment device.
[0013] The protoplast preparation pretreatment device realizes precise pressure and adhesion treatment of plant tissues through a specific mechanical structure, can efficiently separate leaf epidermis tissues and mesophyll cells, and provides purer initial materials for subsequent protoplast release; the design is in line with the characteristics of the tissue structure of plants, can improve the efficiency of tissue separation and reduce impurity interference on the premise of maintaining cell activity, thereby assisting in improving the overall effect of protoplast preparation, and belongs to a special auxiliary device optimized for specific materials. The use of the device in cooperation with conventional devices can further optimize the preparation process. In some embodiments, a plant epidermis tearing device is used in the protoplast preparation process, and the structure of the device comprises a pair of openable and closable clamping arms. The inner side of the clamping arms is provided with a soft rubber pad with a certain friction. During operation, the clamping arms are closed by manual or mechanical control, and the rubber pad can gently clamp the edge of the tobacco leaf epidermis. Subsequently, a linear slide rail driven by a motor is used to smoothly pull the clamping arms, thereby tearing the plant epidermis. The device can accurately control the force and speed to prevent excessive pulling and damage to the epidermal cells, and provide high-quality materials for subsequent protoplast preparation. In some embodiments, a plant epidermis tearing device based on the principle of negative pressure adsorption is used. The device is equipped with an adsorption plate with multiple micro adsorption holes. When the adsorption plate is close to the plant epidermis, a vacuum pump is started to form a negative pressure at the adsorption holes, tightly adsorbing the plant epidermis. At the same time, the mechanical arm of the device moves according to the preset trajectory, driving the adsorption plate to tear the plant epidermis from the leaf body. This device can adapt to plant epidermis of different thickness and toughness by adjusting the size of the negative pressure, greatly improving the adaptability and stability of the operation, and helping to improve the efficiency and quality of the plant epidermis processing link in the protoplast preparation process.
[0014] In another aspect, the present application provides a plant source transient expression system, comprising the aforementioned vector pLIP and a host system; the host system includes but is not limited to at least one of the following: a plant leaf transient expression system, a plant root hair system, a suspension cell line or a cell-free system.
[0015] Specifically, the host system is a plant leaf transient expression system; the vector pLIP is introduced into the host system by Agrobacterium-mediated method.
[0016] In some embodiments, the Agrobacterium-mediated method can also be used with a plant negative pressure infiltration device, a leaf vacuum infiltration device, a plant spray infiltration device, etc. The function of the device is to optimize the contact efficiency of Agrobacterium and tobacco tissue and enhance the infiltration effect.
[0017] The plant negative pressure infiltration device generally includes a sealed infiltration cavity, a negative pressure control system, an infiltration liquid circulation component and a plant fixing rack, etc. During operation, the plant (or detached leaf) to be processed is fixed on the rack in the cavity, so that the leaf fully contacts the infiltration liquid; the internal pressure of the cavity is reduced to a preset value (usually -0.05 to -0.08 MPa) by a negative pressure pump, and the stomata and intercellular spaces of the leaf are passively expanded under the action of the pressure difference, prompting the infiltration liquid to enter the tissue more efficiently; at the same time, the circulation system can make the infiltration liquid flow continuously to ensure uniform contact of the leaf in each part.
[0018] The leaf vacuum infiltration device places the plant material and the treatment liquid in a vacuum environment by constructing a sealed space, and uses the pressure difference to promote the infiltration of the liquid into the leaf tissue.
[0019] The plant spray infiltration device is equipped with a precision spray head and an adjustable bracket, which can uniformly spray the infiltration liquid on the surface of the plant, combined with an environmental control module (such as humidity and temperature adjustment), to provide suitable culture conditions for the plant after infiltration.
[0020] Specifically, the Agrobacterium includes but is not limited to GV3101, LBA4404, EHA105 or C58; the plant leaf is selected from Nicotiana benthamiana, cultivated tobacco or Arabidopsis thaliana.
[0021] Preferably, the Agrobacterium is GV3101; and the plant is Nicotiana benthamiana.
[0022] In another aspect, the present application provides a method for comparing the activities of promoters across systems, which comprises the following steps: The relative activity is calculated by the formula: relative activity = (fLUC 待测 / rLUC 待测 ) / (fLUC 35S / rLUC 35S ).
[0023] Specifically, in the protoplast transfection expression system, the cells are lysed 12-16 hours after transfection, and the expression levels of fLUC and rLUC are determined.
[0024] Preferably, in the protoplast transfection expression system, the cells are lysed 12-13 hours after transfection, and the expression levels of fLUC and rLUC are determined.
[0025] Preferably, in the protoplast transfection expression system, the cells are lysed 12 hours after transfection, and the expression levels of fLUC and rLUC are determined.
[0026] Specifically, in the plant leaf transient expression system, the leaf tissues are collected 24-72 hours after infection, and the expression levels of fLUC and rLUC are determined.
[0027] Preferably, in the plant leaf transient expression system, the leaf tissues are collected 72 hours after infection, and the expression levels of fLUC and rLUC are determined.
[0028] Preferably, in the plant leaf transient expression system, the leaf tissues are collected 48 hours after infection, and the expression levels of fLUC and rLUC are determined.
[0029] In another aspect, the present application provides a kit comprising the aforementioned pLIP vector or protoplast transfection expression system or plant-derived transient expression system.
[0030] In another aspect, the present application provides a method for normalizing and standardizing the activities of promoters, which comprises the following steps: (1) setting the relative activity of the 35S promoter as 1.0 RPU as a reference standard; (2) For the tested promoter, the fLUC / rLUC is detected by the aforementioned pLIP vector or protoplast transfection expression system or plant source transient expression system, and the ratio is normalized to the relative activity relative to the 35S promoter to realize the standardization and comparison of the promoter activity data.
[0031] Specifically, the tested promoter includes but is not limited to: plant source UBQ10 or ATC2, Agrobacterium source NOS, OCS or MAS, virus source 35S, MMV (Mirabalis Mosaic Virus) or CsVMV (Cassava Vein Mosaic Virus).
[0032] In another aspect, the application provides an application of the aforementioned pLIP vector or protoplast transfection expression system or plant source transient expression system or comparison method or kit or method in the quantitative characterization or standardized comparison of plant promoters.
[0033] In another aspect, the application provides a promoter function evaluation platform, which core comprises any of the following key components: (1) the aforementioned pLIP vector; (2) the aforementioned protoplast transfection expression system; (3) the aforementioned plant source transient expression system.
[0034] The application has the following beneficial effects: (1) The application realizes efficient quantitative characterization of plant promoters by combining protoplast transient expression system and Agrobacterium-mediated leaf transient expression system, overcoming the shortcomings of traditional methods such as time-consuming, labor-intensive and difficult to perform large-scale screening.
[0035] (2) The application adopts a compact promoter characterization plasmid (pLIP) design, which contains a firefly luciferase (fLUC) module driven by the tested promoter and a Renilla luciferase (rLUC) internal reference module driven by the 35S promoter, effectively eliminating background interference and improving the accuracy and reliability of detection.
[0036] (3) The application calculates the ratio of double luciferase and introduces the RPU (Relative Promoter Unit) method, taking the standard promoter (35S, 200 bp) as a reference, to realize the normalization and direct comparison of promoter activity in different systems, solving the problem of lack of standardization method in the prior art.
[0037] (4) The double-system standardization method of the application has good cross-system compatibility and is suitable for efficient screening and standardized characterization of regulatory elements in plant synthetic biology, improving the repeatability of experimental results.
[0038] (5) The plasmid tool pLIP of the present application is designed compactly, easy to operate, easy to transform and use, overcomes the incompatibility of existing plasmids of protoplast transient expression system and Agrobacterium-mediated leaf transient expression system, and improves the speed and convenience of detection. BRIEF DESCRIPTION OF DRAWINGS
[0039] Figure 1 A compact promoter test vector pLIP suitable for plant double-platform expression.
[0040] Figure 2 A preparation process and preparation effect comparison chart of tobacco protoplast.
[0041] Figure 3 A schematic diagram of tobacco leaf mixed sampling method.
[0042] Figure 4 A protoplast and leaf transient expression system promoter activity correlation analysis and RPU standardization effect chart; wherein a is the relative fluorescence activity value of the protoplast and leaf transient expression system; b is the linear regression analysis of RPU standardization.
[0043] Figure 5 A protoplast (a) and tobacco leaf system (b) double system promoter activity correlation analysis and RPU standardization effect chart (c); wherein, orange: UBQ10, purple: 35S, red: ACT2, blue: NOS.
[0044] Figure 6 A schematic diagram of tobacco protoplast transfection efficiency of pLIP plasmid. DETAILED DESCRIPTION
[0045] The present application will be further clarified by the following examples. The following examples are only a part of the present application and are not used to limit the present application, but only to illustrate the present application. The experimental methods used in the following examples are conventional experiments, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial channels.
[0046] Example 1 1.1 pLIP vector construction A compact binary vector (SEQ ID NO. 1) of 2813 bp was synthesized based on pUC19, retaining the replication origin pUC19 ori and the resistance gene region Kan after deleting unnecessary sequences, inserting the Agrobacterium replication origin pSa ori, and the left and right border sequences (LB and RB sequences) of T-DNA. Assembly sites Prefix (SEQ ID NO. 2: ggtgaagactaTGCC) and Suffix (SEQ ID NO. 3: AGGGCCCATTTCTGGATATA) were set in the T-DNA region for modular insertion of a dual reporter system (GATEWAY®) Figure 1 ): a firefly luciferase (fLUC) module driven by the tested promoter, and a Renilla luciferase (rLUC) module driven by 35S, assembled using the Gibson method. In this example, the tested promoters were selected from 35S, UBQ10, ATC2, and NOS.
[0047] SEQ ID NO. 1:
[0048] Promoter 35S sequence (SEQ ID NO. 4): AGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGA.
[0049] Promoter UBQ10 sequence (SEQ ID NO. 5): GTCGACGAGTCAGTAATAAACGGCGTCAAAGTGGTTGCAGCCGGCACACACGAGTCGTGTTTATCAACTCAAAGCACAAATACTTTTCCTCAACCTAAAAATAAGGCAATTAGCCAAAAACAACTTTGCGTGTAAACAACGCTCAATACACGTGTCATTTTATTATTAGCTATTGCTTCACCGCCTTAGCTTTCTCGTGACCTAGTCGTCCTCGTCTTTTCTTCTTCTTCTTCTATAAAACAATACCCAAAGAGCTCTTCTTCTTCACAATTCAGATTTCAATTTCTCAAAATCTTAAAAACTTTCTCTCAATTCTCTCTACCGTGATCAAGGTAAATTTCTGTGTTCCTTATTCTCTCAAAATCTTCGATTTTGTTTTCGTTCGATCCCAATTTCGTATATGTTCTTTGGTTTAGATTCTGTTAATCTTAGATCGAAGACGATTTTCTGGGTTTGATCGTTAGATATCATCTTAATTCTCGATTAGGGTTTCATAGATATCATCCGATTTGTTCAAATAATTTGAGTTTTGTCGAATAATTACTCTTCGATTTGTGATTTCTATCTAGATCTGGTGTTAGTTTCTAGTTTGTGCGATCGAATTTGTCGATTAATCTGAGTTTTTCTGATTAACAG.
[0050] Promoter ACT2 sequence (SEQ ID NO. 6): TCGACAAAATTTAGAACGAACTTAATTATGATCTCAAATACATTGATACATATCTCATCTAGATCTAGGTTATCATTATGTAAGAAAGTTTTGACGAATATGGCACGACAAAATGGCTAGACTCGATGTAATTGGTATCTCAACTCAACATTATACTTATACCAAACATTAGTTAGACAAAATTTAAACAACTATTTTTTATGTATGCAAGAGTCAGCATATGTATAATTGATTCAGAATCGTTTTGACGAGTTCGGATGTAGTAGTAGCCATTATTTAATGTACATACTAATCGTGAATAGTGAATATGATGAAACATTGTATCTTATTGTATAAATATCCATAAACACATCATGAAAGACACTTTCTTTCACGGTCTGAATTAATTATGATACAATTCTAATAGAAAACGAATTAAATTACGTTGAATTGTATGAAATCTAATTGAACAAGCCAACCACGACGACGACTAACGTTGCCTGGATTGACTCGGTTTAAGTTAACCACTAAAAAAACGGAGCTGTCATGTAACACGCGGATCGAGCAGGTCACAGTCATGAAGCCATCAAAGCAAAAGAACTAATCCAAGGGCTGAGATGATTAATTAGTTTAAAAATTAGTTAACACGAGGGAAAAGGCTGTCTGACAGCCAGGTCACGTTATCTTTACCTGTGGTCGAAATGATTCGTGTCTGTCGATTTTAATTATTTTTTTGAAAGGCCGAAAATAAAGTTGTAAGAGATAAACCCGCCTATATAAATTCATATATTTTCCTCTCCGCTTTGAA.
[0051] Promoter NOS sequence (SEQ ID NO. 7): GAACCGCAACGATTGAAGGAGCCACTCAGCCGCGGGTTTCTGGAGTTTAATGAGCTAAGCACATACGTCAGAAACCATTATTGCGCGTTCAAAAGTCGCCTAAGGTCACTATCAGCTAGCAAATATTTCTTGTCAAAAATGCTCCACTGACGTTCCATAAATTCCCCTCGGTATCCAATTA.
[0052] 1.2 Comparison of protoplast preparation methods (1) Protoplasts prepared by tape-sandwich method Select 4-6 leaf stage N. benthamiana leaves, wash with sterile water, remove the main veins and peel off the lower epidermis with adhesive tape, place the exposed tissue face down in an enzyme solution containing 1% (m / v) cellulase R10 (Yakult L0012) and 0.3% (m / v) macerozyme (Yakult L0021), and shake at 50 rpm for 2.5 h of enzymolysis. Terminate the reaction with W5 buffer (154 mM NaCl, 125 mM CaCl2, 5 mM KCl, 2 mM MES (pH 5.7)), filter and centrifuge to obtain protoplasts, and adjust the concentration to 1-2 x 10 6 cells / mL.
[0053] (2) Protoplasts prepared by leaf strips method Select 4-6 leaf stage N. benthamiana leaves, wash with sterile water, remove the main veins and cut them into 0.5-1 mm long filaments with a double-edged blade, and suspend them in an enzyme solution containing 1% (m / v) cellulase R10 and 0.3% (m / v) macerozyme, and shake at 50 rpm for 3.5 h of enzymolysis. Terminate the reaction with W5 buffer, filter and centrifuge to obtain protoplasts, and adjust the concentration to 1-2 x 10 6 cells / mL.
[0054] By comparing the purity of protoplasts prepared by the two methods, it can be found that the protoplasts prepared by the tape-sandwich method have more intact round protoplast cells and fewer broken impurities Figure 2 ).
[0055] 1.3 Protoplast transfection Prepare PEG-CaCl2 solution of 40% (m / v) PEG4000 (Sigma 95904), 0.2 M mannitol (sigma, M1902), 100 mM CaCl2 (sigma, V900266) on demand. Prepare WI buffer of 0.5 M mannitol, 20 mM KCl, 4 mM MES (pH 5.7) on demand.
[0056] Take 5 μL of pLIP test vector at a concentration of 1500 ng / μL, add 50 μL of protoplasts prepared by the adhesive tape stripping method to the bottom of a 2 mL round-bottom centrifuge tube, mix gently, then add 55 μL of PEG-CaCl2 transformation solution, i.e. plasmid: protoplast: transformation solution = 1:10:11, mix by flicking the tube bottom, and incubate at room temperature for 10 min; after the reaction is complete, slowly add 220 μL of W5 solution to each tube, mix, then use a refrigerated centrifuge with a horizontal rotor to centrifuge at 100 x g for 5 min; discard the supernatant containing the transformation solution, resuspend with 120 μL of WI solution, and place in a 48-well plate for incubation for 12 h to express the foreign gene.
[0057] 1.4 Tobacco leaf transient expression pLIP plasmids were transformed into GV3101 (pSoup-p19) strain, amplified after resistance selection, resuspended in injection buffer containing 10 mM MES, 10 mM MgCl2 and 100 μM acetosyringone, adjusted to OD600 = 1.0, injected into the back of the suitable age N. benthamiana leaves of three independent tobacco plants after standing at room temperature for 2 h. After 48 h, sample using the mixed sampling method, for luciferase detection Figure 3 ).
[0058] Mixed sampling method. Use a handheld puncher to punch three holes in each injection area (e.g. A1), and obtain leaf discs. Then mix individual leaf discs from three independent plants into one tube to obtain a mixed sample (e.g. AM1).
[0059] 1.5 Dual luciferase detection and normalization analysis Protoplasts and leaf tissues were lysed separately, and the lysates were detected for fLUC and rLUC expression intensity, and the fLUC / rLUC ratio was calculated as the promoter activity. Take the 35S promoter as 1.0 RPU, and express the activities of other promoters according to their relative values, to obtain the relative activity, relative activity = (fLUC 待测 / rLUC 待测 ) / (fLUC 35S / rLUC 35S ).
[0060] 1.6 Experimental data processing and visualization Using 35S and NOS promoters as test promoters, the original fluorescence activity values of each promoter in the protoplast system (sampled at 12 h, x-axis) and the leaf system (sampled at 48 h and 72 h respectively, y-axis) showed significant deviations. Nine experimental replicates are shown as data points in the figure: the regression slope at 48 h was only 0.52, while it further decreased to 0.32 at 72 h. Figure 4 (a) Using a standardized calculation method, comparing the RPU results of the two systems: after RPU correction, the regression slopes of both systems increased to 1.17 (R²=0.96) at 48 h and reached 1.10 (R²=0.93) at 72 h. Figure 4 (b) indicates that standardization effectively eliminates the incomparability of absolute signal strength between platforms. Furthermore, RPU significantly reduces the impact of time-point differences on data correlation (the slope difference between 48 h and 72 h decreased from 0.20 to 0.07), suggesting that this method can improve the reproducibility of experiments across time points. These results demonstrate that RPU standardization can not only correct for technical biases in protoplast and leaf systems but also reduce the interference of transient expression kinetic fluctuations on data stability, providing a universal framework for multi-platform collaborative promoter function studies.
[0061] Furthermore, UBQ10 and ATC2 were added as promoters to construct the pLIP plasmid. This plasmid was then transfected into protoplasts prepared by the tape peeling method, with three replicates performed. The RPU value was calculated using the method described above. Figure 5 (a) Similarly, the pLIP plasmid containing the UBQ10 and ATC2 promoters to be tested was injected into tobacco leaves as described above. After 48 hours of mixed sampling from multiple plants, the RPU value was calculated. Nine experimental replicates are shown as data points in the figure. Figure 5 (b) Comparing the RPU values of the protoplast system and the leaf system and performing correlation regression analysis, the regression slopes of the protoplast and leaf systems are close to 1.0 (slope=1.001, R²=0.8958), indicating that the cross-platform activity values are highly comparable. Figure 5 (c in the text)
[0062] This embodiment provides a complete workflow from plasmid construction, protoplast and leaf transfection to signal detection and normalization analysis, ensuring that the expression performance of the promoter in the two plant expression systems can be directly compared, which has important tool value and application prospects.
[0063] Example 2 compares the transfection efficiency of commonly used high-expression plasmid pEAQ and pLIP vector in tobacco leaves. Transfection efficiency comparison vector construction method. Insert 35S promoter driven GFP report module in pLIP vector LB / RB boundary interval to construct pLIP-35S_GFP report plasmid. Insert GFP in pEAQ-HT (BioVector NTCC plasmid vector strain cell gene preservation center) vector multiple cloning enzyme cutting site to construct pEAQ-35S_GFP plasmid.
[0064] Protoplast transfection method. Take 5 μL of plasmid pEAQ-35S_GFP and pLIP-35S_GFP vector with concentration of 1500 ng / μL, respectively, at the bottom of 2 mL round-bottom centrifuge tube, each add 50 μL protoplast prepared by adhesive tape peeling method, mix gently, then add 55 μL PEG-CaCl2 transformation solution, namely plasmid: protoplast: transformation solution = 1:10:11, and mix gently, incubate at room temperature for 10 min; after reaction is completed, slowly add 220 μL W5 solution to each tube, mix, then use refrigerated centrifuge horizontal rotor to centrifuge at 100 x g for 5 min; discard supernatant containing transformation solution, resuspend with 120 μL WI solution, place in 48-well plate, incubate for 12 h to express exogenous gene. By comparing the proportion of positive cells in protoplast population driven by the same promoter (35S), it can be found that the transfection efficiency of pLIP vector skeleton reaches 50%, which is 5 times higher than that of pEAQ vector skeleton (~10%) Figure 6 ).
[0065] The above detailed description is a specific description of one of the feasible embodiments of the present application, which is not used to limit the patent scope of the present application. It should be noted that any equivalent implementation or change made without departing from the present application should be included in the scope of the technical solutions of the present application. Therefore, the protection scope of the present application patent should be subject to the appended claims.
Claims
1. A vector pLIP for quantitative characterization of plant promoter dual system, characterized in that, The vector backbone is based on pUC19 modification, retaining the original prokaryotic replication origin and resistance genes, inserting Agrobacterium-compatible replication origin pSa ori and T-DNA left and right border sequences, designing Prefix and Suffix as assembly interfaces, and constructing an expression vector backbone smaller than 3000 bp; The region of the T-DNA comprises two expression modules: a firefly luciferase reporter gene module driven by the to-be-tested promoter and a Renilla luciferase internal reference module driven by the 35S promoter.
2. The vector pLIP according to claim 1, characterized in that, The sequence of the expression vector backbone is shown in SEQ ID NO.
1.
3. The vector pLIP according to claim 1, wherein, The sequence of the Prefix is shown in SEQ ID NO. 2; the sequence of the Suffix is shown in SEQ ID NO.
3.
4. A protoplast transfection expression system, characterized by, The vector pLIP of any one of claims 1-3.
5. The protoplast transfection expression system of claim 4, wherein The pLIP vector is introduced into protoplasts by a PEG-CaCl2-mediated transformation method.
6. The protoplast transfection expression system of claim 5, wherein, The protoplasts are prepared by a tape-stripping method and enzymatic digestion.
7. A plant-based transient expression system, characterized in that, The vector pLIP of any one of claims 1-3 and a host system; the host system comprises at least one of a plant leaf transient expression system, a plant root hair system, a suspension cell line, or a cell-free system.
8. The transient expression system of plant origin according to claim 7, characterized in that, The host system is a plant leaf transient expression system; the vector pLIP is introduced into the host system by an Agrobacterium-mediated method.
9. The transient expression system of plant origin according to claim 8, characterized in that, The Agrobacterium is GV3101, LBA4404, EHA105, K599, or C58; the plant leaf is selected from Nicotiana benthamiana, cultivated tobacco, or Arabidopsis thaliana.
10. The transient expression system of plant origin according to claim 8, characterized in that, The Agrobacterium is GV3101; the plant source is Nicotiana benthamiana.
11. A method for comparing plant promoters across systems, comprising: The fLUC / rLUC of the to-be-tested promoter is detected by the pLIP vector of any one of claims 1-3 or the protoplast transfection expression system of any one of claims 4-6 or the plant source transient expression system of any one of claims 7-10, and the relative activity of the to-be-tested promoter is calculated with the fLUC / rLUC ratio of the 35S promoter as a reference of 1.0 RPU, thereby realizing cross-system comparison; The relative activity is calculated by the formula: relative activity = (fLUC 待测 / rLUC 待测 ) / (fLUC 35S / rLUC 35S ).
12. The comparison method of claim 11, wherein, In the protoplast transfection expression system, the cells are lysed 12-16 hours after transfection, and the expression levels of fLUC and rLUC are determined.
13. The comparison method of claim 11, wherein, In the plant leaf transient expression system, the leaf tissue is collected 24-72 hours after infection, and the expression levels of fLUC and rLUC are determined.
14. A kit characterized in that, The pLIP vector of any one of claims 1-3 or the protoplast transfection expression system of any one of claims 4-6 or the plant source transient expression system of any one of claims 7-10.
15. A method of promoter activity normalization and standardization, characterized in that, The steps include: (1) setting the relative activity of the 35S promoter as 1.0 RPU as a reference standard; (2) detecting the fLUC / rLUC of the to-be-tested promoter by the pLIP vector of any one of claims 1-3 or the protoplast transfection expression system of any one of claims 4-6 or the plant source transient expression system of any one of claims 7-10, and normalizing the ratio to the relative activity of the 35S promoter, thereby realizing standardization and comparison of the promoter activity data.
16. The method of claim 15, wherein, The to-be-tested promoter is plant-derived UBQ10 or ATC2, Agrobacterium-derived NOS, OCS or MAS, virus-derived 35S, MMV or CsVMV.
17. Use of the pLIP vector of any one of claims 1-3 or the protoplast transfection expression system of any one of claims 4-6 or the plant-derived transient expression system of any one of claims 7-10 or the comparative method of any one of claims 11-13 or the kit of claim 14 or the method of claim 15 or 16 in quantitative characterization or normalized comparison of plant promoters.
18. A platform for promoter function evaluation, characterized in that, The platform core comprises any one of the following key components: (1) the pLIP vector of any one of claims 1-3; (2) the protoplast transfection expression system of any one of claims 4-6; (3) the plant-derived transient expression system of any one of claims 7-10.
Citation Information
Patent Citations
Abiotic-stress induction type ultrastrong promoter in rice and application thereof
CN103387986A
Ochrobactrum-mediated transformation of plants
CN108513584A
Plant over-expression luciferase reporter gene recombinant vector, and construction method and application thereof
CN112126658A
Method for creating plant insufficient in sexual gamete formation
JP2007289042A
Variegation in plants
US20110126311A1