Application of GmCDPKb gene in regulation and control of soybean symbiotic nodulation number
By knocking out or overexpressing the soybean GmCDPKb gene, and using CRISPR-GE and Gateway technology to regulate the number of soybean symbiotic nodules, the problem of unclear molecular regulation of soybean symbiotic nodulation process was solved, and a new soybean variety with high efficiency in nitrogen fixation was developed.
Patent Information
- Application Number
- CN202511614009.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-06
- Publication Date
- 2025-12-05
- Estimated Expiration
- 2045-11-06
AI Technical Summary
In existing technologies, the symbiotic nodulation process between soybeans and rhizobia is complex and easily affected by environmental factors. The molecular regulatory mechanism is unclear, which limits the breeding of high-efficiency nitrogen-fixing soybean varieties.
By knocking out or overexpressing the GmCDPKb gene in soybean, a gene editing system was constructed using CRISPR-GE and Gateway technologies to regulate the number of symbiotic nodules in soybean, thus establishing an efficient gene editing technology and soybean cotyledon node transformation system.
The GmCDPKb gene mutant and overexpression plants were successfully created, which significantly regulated the number of symbiotic nodules in soybeans, providing gene resources and germplasm materials for elucidating the molecular mechanism of soybean symbiotic nitrogen fixation and for breeding new varieties of soybeans with high efficiency in nitrogen fixation.
Smart Images

Figure CN121065256A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of plant genetic engineering and soybean breeding, and particularly relates to GmCDPKb Application of a gene in regulating the number of symbiotic nodulation of soybean. BACKGROUND
[0002] Calcium-dependent protein kinases (CDPKs) are a class of serine / threonine-specific protein kinases that exist widely in plants and are important calcium ion sensors in plants. The functions of CDPK genes are diverse. Overexpression of some CDPK genes, such as AtCPK1, AtCPK4, AtCPK6, etc., can enhance the tolerance of plants to drought, salt stress, etc., as shown by increased proline content, reduced malondialdehyde (MDA) and hydrogen peroxide (H2O2) content, and decreased stomatal opening, thereby reducing water loss and improving the survival ability of plants in adversity. CDPKs are also concerned about the regulation of plant secondary metabolism. Studies have found that CDPKs can affect the synthesis of plant secondary metabolites by phosphorylating enzymes involved in secondary metabolism, such as phenylalanine ammonia lyase (PAL), and transcription factors regulating the expression of secondary metabolism-related genes. Therefore, CDPKs play a crucial role in plant cells, and in-depth study of the functions of CDPKs is of great significance for cultivating excellent crop varieties and improving agricultural production efficiency.
[0003] Soybean, an important food, oil, and feed crop originating from China, plays a central role in agricultural production and food supply due to its high protein content. Nitrogen is an essential nutrient for soybean growth and development, and its acquisition mainly relies on the symbiotic nitrogen fixation system established with rhizobium. The root nodules formed by soybean roots can convert atmospheric nitrogen into available ammonium, which not only meets the nitrogen demand of the plant but also improves soil nitrogen levels, which is of great significance to agricultural ecology.
[0004] However, the symbiotic nodulation of soybean and rhizobium is a complex process involving rhizobium recognition and infection, symbiotic signal transduction, and root nodule organ formation, and is easily affected by environmental factors. The molecular regulation mechanism has not been fully elucidated. This lack of understanding limits the precise regulation of the symbiotic nitrogen fixation system and restricts the cultivation of high-efficiency nitrogen fixation soybean varieties. Therefore, identifying key genes that regulate symbiotic nodulation has important scientific value and application prospects for analyzing the molecular mechanism of symbiotic nitrogen fixation and promoting sustainable agricultural development. SUMMARY
[0005] The purpose of the present application is to provide GmCDPKbThe application of this gene in regulating the number of symbiotic nodules in soybeans aims to fill the gap in existing research on the role of this gene in regulating symbiotic nodules in soybeans, and to provide gene resources and germplasm materials for elucidating the molecular mechanism of symbiotic nitrogen fixation in soybeans and for breeding new varieties of soybeans with high efficiency in nitrogen fixation.
[0006] To achieve the above objectives, the present invention provides GmCDPKb The application of genes or their encoded proteins in regulating the number of symbiotic nodules in soybeans, the GmCDPKb The nucleotide sequence of the gene is shown in SEQ ID NO.1.
[0007] Furthermore, knocking out soybeans GmCDPKb Genes that reduce the number of symbiotic nodules in soybeans and overexpress the gene in soybeans GmCDPKb Genes that increase the number of symbiotic nodules in soybeans.
[0008] The present invention also provides GmCDPKb Application of protein in regulating the number of symbiotic nodules in soybeans GmCDPKb The amino acid sequence of the protein is shown in SEQ ID NO.2. GmCDPKb The gene encoding the protein is GmCDPKb Gene, GmCDPKb The nucleotide sequence of the gene is shown in SEQ ID NO.1.
[0009] This invention also provides a method for regulating the number of symbiotic nodules in soybeans, by knocking out nodules in soybeans. GmCDPKb Genes that reduce the number of symbiotic nodules in soybeans and overexpress the gene in soybeans GmCDPKb Genes that increase the number of symbiotic nodules in soybeans; GmCDPKb The nucleotide sequence of the gene is shown in SEQ ID NO.1.
[0010] Furthermore, methods to reduce the number of symbiotic nodules in soybeans include the following steps: S1. Designing targets using CRISPR-GE online tools GmCDPKb The sgRNA in the gene coding region is modified with adapter bases according to the sequence information of the vector to ensure efficient binding of the sgRNA to the Cas9 protein; S2. Obtain double-stranded oligonucleotides using PCR amplification technology; S3. The sgRNA sequence was constructed into the pCBSG015 vector using homologous recombination. S4. The successfully constructed sgRNA-pCBSG015 vector was introduced into EHA105 Agrobacterium competent cells; S5. Use the Agrobacterium obtained in step S4 to infect soybeans; S6. Perform plant tissue culture on the soybean tissue obtained in step S5; S7. Extract DNA from the tissue culture seedlings obtained in step S6, perform PCR amplification of sgRNA, and select positive plants by agarose gel electrophoresis and DNA sequencing to obtain... GmCDPKb Soybean plants with genetic mutations.
[0011] Furthermore, in step S1, the target sequences of the sgRNA are GACGGTGATGCCGTTGTGGTGGG, as shown in SEQ ID NO.5 and GCTTGGGGAGTTGGGGTGAAGGG, as shown in SEQ ID NO.6.
[0012] Furthermore, methods to increase the number of symbiotic nodules in soybeans include the following steps: S1: Using reverse-transcribed Dongnong 50 cDNA as a template, amplification... GmCDPKb Encoding area; S2: Using the enzyme digestion ligation method, GmCDPKb Constructed onto the Fu28 vector; S3: Utilizing Gateway technology, GmCDPKb LR reacts onto the target vector pSOYI; S4: Successfully constructed GmCDPKb -pSOYI vector was introduced into EHA105 Agrobacterium competent cells; S5: Soybeans infected with Agrobacterium obtained using S4; S6: Plant tissue culture was performed on the soybean tissue obtained in S5; S7: Positive plants were selected by qRT-PCR and Western blot detection to obtain... GmCDPKb Soybean plants with overexpressed genes.
[0013] Therefore, the present invention provides GmCDPKb The advantages and positive effects of using genes to regulate the number of symbiotic nodules in soybeans are: (1) The invention establishes GmCDPKb Gene editing technology and soybean cotyledon node transformation system are highly efficient and stable, providing important materials for elucidating the molecular mechanism of soybean symbiotic nodulation and for breeding new soybean varieties with high efficiency in nitrogen fixation.
[0014] (2) This invention creates a protein kinase that does not contain calcium-dependent protein kinase. GmCDPKb Soybean mutant plants, and GmCDPKb Overexpression of the transgenic plant. CDPK, as an important protein kinase, is closely related to plant growth and development. Knockout of this gene significantly reduced the number of soybean nodules, while overexpression significantly increased the number of nodules, revealing its positive regulatory role in soybean nodulation. This invention provides a basis for analysis... GmCDPKbIt provides important genetic material for the establishment of the soybean-rhizobium symbiotic nitrogen fixation relationship.
[0015] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description
[0016] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0017] Figure 1 for GmCDPKb The expression pattern analysis diagram, where A is GmCDPKb Gene expression in 50 tissues of Dongnong, B is GmCDPKb Gene expression at different stages after inoculation; Figure 2 A map of the sgRNA-pCBSG015 recombinant vector; Figure 3 Electrophoresis image of bacterial culture constructed using the sgRNA-pCBSG015 vector; Figure 4 for gmcdpkb Mutant construction process; Figure 5 for gmcdpkb Mutation type detection diagram, where A is the agarose gel electrophoresis detection of PCR amplification products of the sgRNA target region in T2 generation transgenic seedlings, and B is the wild-type (WT) and... gmcdpkb Mutant lines (Line 1, Line 2, Line 3) GmCDPKb Sequence alignment of gene target regions; Figure 6 for GmCDPKb Spectrum of the -pSOYI recombinant vector; Figure 7 for GmCDPKb PCR electrophoresis detection image of bacterial culture constructed with the -pSOYI vector; Figure 8 for GmCDPKb Image showing detection of overexpression-positive plants, where A represents T2 generation plants. GmCDPKb Expression level detection, B represents protein level detection in T2 generation plants; Figure 9 for GmCDPKb The effect of gene mutation and overexpression on soybean nodule number is shown in the figure, where A represents wild type (WT). gmcdpkbMutants (cdpkb-1, cdpkb-2, cdpkb-3) and GmCDPKb Comparison of nodule phenotype of overexpression plants (OE1, OE2), B is the wild type, the number of single plants of each mutant strain and overexpression strain is counted and the histogram is shown. DETAILED DESCRIPTION
[0018] The technical solutions of the present application are further described below by means of the accompanying drawings and examples.
[0019] In order to make the purpose, technical solutions and advantages of the present application more clear, thorough and complete, the technical solutions of the present application are described clearly and completely below by means of the accompanying drawings and examples. The following detailed description is a description of the examples, which aims to provide further detailed description of the present application. Unless otherwise specified, all technical terms used in the present application have the same meaning as generally understood by those skilled in the art to which the present application belongs.
[0020] The instruments and reagents used in the examples are obtained through commercial channels; the method steps not described in detail in the examples are conventional technical means in the art.
[0021] The soybean cultivar used in the examples is Dongnong 50. Dongnong 50 is an Electron small bean variety introduced from Canada in 2003, which is a typical medium-ripe soybean with developed root system and stable nodule phenotype, and is suitable for genetic transformation research. The approval number is Heishen Dou 2007022.
[0022] The pCBSG vector (containing Cas9 nuclease coding sequence and glufosinate resistance screening marker) is one of the commonly used expression vectors in plant genetic engineering. The vector has been safety evaluated and has stable replication and expression ability in E. coli and Agrobacterium.
[0023] pSOYI vector, Fu28 vector, Gateway reaction kit: Gateway® LR Clonase® II is purchased in the market.
[0024] GmCDPKb The gene is independently screened by the inventor, and through whole genome feature analysis (WGS sequencing) and expression amount analysis (RNA sequencing) of the CDPK family of soybean, the gene GmCDPKb The gene can participate in the symbiotic nodule formation process of soybean.
[0025] In the present application, GmCDPKb The CDS sequence of the gene is shown as SEQ ID NO. 1:
[0026] GmCDPKb The amino acid sequence encoded by the gene is shown as SEQ ID NO. 2: MGNCSSGAGAPTTYSDDHPHHNGITVLPPNSNPSPQLPKPPPTSSSSSSLGRVLGRPMEDVRSIYIFGRELGRGQFGVTYLVTHKATKEQFACKSIATRKLVNRDDIDDIRREVQIMHHLTGHRNIVELKGAYEDRHSVNLVMELCAGGELFDRIITKGHYSERAAANSCRQIVTVVHNCHSMGVMHRDLKPENFLLLNKNDDSPLKATDFGLSVFFKPGDVFRDLVGSAYYVAPEVLRRSYGPEADIWSAGVILYILLSGVPPFWAENEQGIFDAILRGHIDFASDPWPSISSSAKDLVKKMLRADPKERLSAVEVLNHPWMRVDGDAPDKPLDIAVLTRMKQFRAMNKLKKVALKVIAENLSEEEIIGLKEMFKSMDTDNSGTITFEELKAGLPKLGTKLSESEVRQLMEAADVDGNGTIDYIEFITATMHMNRMEREDHLYKAFEYFDNDKSGYITMEELESALKKYNMGDEKTIKEIIAEVDTDNDGRINYDEFVAMMRKGNPDITHITQRRRK.
[0027] Example 1 Soybean GmCDPKb Gene tissue specificity and expression pattern analysis Firstly, real-time quantitative primers qRT-F (sequence shown as SEQ ID NO. 3) and qRT-R (sequence shown as SEQ ID NO. 4) were designed GmCDPKb The expression of the gene was measured, and the primer sequences are as follows: SEQ ID NO. 3: CATATTTTGGCTGCAGAGGTAC; SEQ ID NO. 4: ACTGATGTTCGTATATAGCGCA.
[0028] Figure 1 The expression pattern of the gene in each tissue of Dongnong 50 is shown in GmCDPKb A. Based on the statistical analysis of real-time fluorescence quantitative PCR, it can be seen that GmCDPKbThe gene exhibited distinct tissue-specific expression characteristics, with significantly higher transcription levels in root tissues compared to other organs. Furthermore, expression levels were also relatively high in root nodules. Fresh roots were collected at different time points after Dongnong 50 plants were inoculated with rhizobium HH103 for analysis. Figure 1 Expression patterns at different stages of rhizobium infection. For example... GmCDPKb As shown in Figure B, the quantitative results indicate that... GmCDPKb Gene expression levels exhibited an alternating trend of upregulation and downregulation. This further illustrates... gmcdpkb It plays a role in the symbiotic nodulation process of soybean-rhizobium.
[0029] Example 2 Soybean mutant GmCDPKb Construction First, through the CRISPR-GE website design Figure 2 sgRNA targets from genomic sequences. Based on rigorous target design principles (including PAM sequence matching, GC content optimization, and off-target effect assessment), two high-priority target sequences were ultimately identified: GACGGTGATGCCGTTGTGGTGGG (SEQ ID NO.5) and GCTTGGGGAGTTGGGGTGAAGGG (SEQ ID NO.6). The targets were amplified by PCR and ligated into the pCBSG015 vector. Figure 3 After transformation into Agrobacterium EHA105 competent cells, detection was performed by colony PCR using a combination of vector-specific primers and target primers for amplification, such as... GmCDPKb As shown, the target sequence was finally detected between 1000-2000 bp (the expected target band was 1488 bp). Combined with the company's sequencing results, it was preliminarily confirmed that the sgRNA target was successfully ligated into the pCBSG015 vector.
[0030] Based on an optimized soybean cotyledon node transformation method, through infection and co-culture, screening, shoot induction, elongation, and hardening, a successful system was constructed. gmcdpkb Stable genetic mutant lines ( Figure 4 The conversion process is as follows: gmcdpkb As shown.
[0031] The specific implementation steps are as follows: S1. Co-cultivation: Select plump, disease-free Dongnong 50 soybean seeds and sterilize them by chlorine fumigation. Transfer the sterilized seeds to sterile petri dishes and soak them overnight. Use EHA105 Agrobacterium containing the target vector as the infection solution. After the seeds have swelled, remove the seed coat with a sterile scalpel, divide the seeds in half, and remove the true leaves. Make multiple incisions at the cotyledon growing point with a sterile scalpel to create wounds, and place the treated seeds in the infection solution for co-cultivation for 30 min. After infection, insert the cotyledons diagonally into a solid culture medium and cultivate for 2 weeks at 25℃ under 16 h light / 8 h dark conditions.
[0032] S2. Screening and bud induction: Observe the growth of the clustered buds, cut off the clustered buds with a sterile scalpel, and put the clustered buds back into the elongation medium. Continue to culture for 3-5 weeks at 25℃ under 16 h light / 8 h dark conditions.
[0033] S3. Elongation and Hardening-off: Using a sterile scalpel, cut the appropriately elongated seedlings from the base and insert them into rooting medium for 2-3 weeks, observing the rooting progress regularly. Transplant healthy seedlings into sterile peat moss and continue culturing at 25℃ under 16h light / 8h darkness conditions for 1-2 weeks.
[0034] Soybean mutant Figure 5 The seeds are cultivated using the following methods: High-quality soil and vermiculite were mixed in a 3:1 ratio and sterilized at high temperature to serve as the cultivation substrate. Soybean mutant T2 generation seeds were sown in the sterilized substrate and cultured in an incubator with 16 hours of light and a constant temperature of 25℃, during which precise water and fertilizer management was implemented according to the plant growth stages. After the plants were robust and stable, young leaf tissue was collected for DNA extraction. Using the extracted DNA as a template, PCR detection of sgRNA in the T2 generation transgenic seedlings yielded the target band (580 bp). gmcdpkb As shown in Figure A, the PCR product of the expected size was sequenced for DNA. Soybean mutant. Figure 5 mutation information such as GmCDPKb As shown in B, 3 out of 16 lines caused GmCDPKb The early termination.
[0035] Example 3 Soybean overexpression plants GmCDPKb Construction First, PCR amplification was obtained. BamH The coding region sequence and primer sequences are as follows: GmCDPKb I- Hind -F: CGCGGATCCATGGGAAACTGCAGCAGC (SEQ ID NO.7); GmCDPKb III- GmCDPKb-R: CCAAGCTTTGCGACGTCTTTGGGTT (SEQ ID NO. 8); the construction was performed by enzyme digestion and ligation BamH -Fu28 vector, and the selected endonuclease was Hind I and GmCDPKb III. By the Gateway recombination technology (Gateway reaction kit: LR Clonase II), the Figure 6 LR reaction was performed on the pSOYI vector ( Figure 7 ).
[0036] After the successful sequencing plasmid was transformed into Agrobacterium EHA105 competent cells, liquid bacterial PCR was performed for detection, and finally the target sequence was detected between 1000-2000 bp ( GmCDPKb ). According to the soybean cotyledon node genetic transformation process in Example 2, the overexpression strain was successfully created. Figure 8 Example 3: Overexpression of the gene in soybean
[0037] The overexpression T2 generation plants were cultivated by the soybean seed planting method in Example 2. After the plants were stable and robust, young leaf tissues were collected, and RNA extraction and plant protein extraction were performed. Through RNA and protein level detection, as shown in GmCDPKb , 2 overexpression positive strains were screened.
[0038] Example 4: Wild-type soybean (WT), gmcdpkb knockout and overexpression plant nodule phenotype identification The chlorinated soybean was planted in a double-layer pot, and was cultured in a constant temperature incubator with a light length of 16 hours and a constant temperature of 25°C. When the seedlings grew to the three-leaf stage, the rhizobium HH103 (OD 600 = 0.6-0.8) was injected by a sterile syringe, and the root nodule phenotype of the plants was investigated when the plants entered the nodule peak period. The wild-type (WT), GmCDPKb mutant and Figure 9 overexpression root system phenotype and nodule number as shown in GmCDPKb . The investigation results showed that GmCDPKb the homozygous mutant plant nodule number was significantly reduced, and the overexpression plant nodule number was significantly increased.
[0039] Therefore, the application adopts the above-mentioned gene in the application of regulating the number of soybean symbiotic nodules, fills the blank of the prior art about the gene in the regulation of soybean symbiotic nodules, and provides gene resources and germplasm materials for analyzing the molecular mechanism of soybean symbiotic nitrogen fixation and cultivating new varieties of high-efficiency nitrogen fixation soybean.
[0040] It should be pointed out finally that the above examples are only used to illustrate the technical solutions of the present application but not to limit it, and although the present application has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that the technical solutions of the present application can still be modified or replaced equivalently, and these modifications or equivalent replacements should not make the modified technical solutions deviate from the spirit and scope of the technical solutions of the present application.
Claims
1. GmCDPKb The use of a gene in modulating the number of soybean symbiotic nodules, characterized in that: The GmCDPKb The nucleotide sequence of the gene is shown as SEQ ID NO.
1.
2. Use according to claim 1, characterized in that, Knocking out genes in soybean reduces the number of symbiotic nodules in soybean GmCDPKb Overexpressing genes in soybean increases the number of symbiotic nodules in soybean GmCDPKb Overexpressing genes in soybean increases the number of symbiotic nodules in soybean 3. GmCDPKb The use of a protein in modulating the number of symbiotic nodules on soybean plants, characterized in that: GmCDPKb The amino acid sequence of the protein is shown as SEQ ID NO. 2, GmCDPKb The coding gene of the protein is GmCDPKb Gene, GmCDPKb The nucleotide sequence of the gene is shown as SEQ ID NO.
1.
4. A method of modulating the number of symbiotic nodules of soybean, characterized by, Knocking out a gene in soybean, reducing the number of soybean symbiotic nodulation, overexpressing a gene in soybean, increasing the number of soybean symbiotic nodulation GmCDPKb The nucleotide sequence of the gene is shown as SEQ ID NO.
1. GmCDPKb The nucleotide sequence of the gene is shown as SEQ ID NO.
1. GmCDPKb The nucleotide sequence of the gene is shown as SEQ ID NO.
1.
5. The method of claim 4, wherein, A method for reducing the number of symbiotic nodules of soybean includes the following steps: 1) Design targeting GmCDPKb sgRNA targeting the coding region of the gene, add linker bases according to the sequence information of the vector, ensure efficient binding of sgRNA with Cas9 protein; 2) obtaining double-stranded oligonucleotides by PCR amplification technology; 3) constructing sgRNA sequence to pCBSG015 vector by homologous recombination reaction; 4) introducing the successfully constructed sgRNA-pCBSG015 vector into EHA105 Agrobacterium competent cells; 5) using the Agrobacterium obtained in step 4) to infect soybean; 6) performing plant tissue culture on the soybean tissue obtained in step 5); 7) DNA of the tissue culture seedlings obtained in step 6) was extracted, sgRNA was amplified by PCR, positive plants were selected by agarose gel electrophoresis detection and DNA sequencing, and sgRNA was obtained GmCDPKb soybean plants with gene mutation.
6. The method of claim 5, wherein, In step 1), the target sequence of sgRNA is GACGGTGATGCCGTTGTGGTGGG, as shown in SEQ ID NO. 5, and GCTTGGGGAGTTGGGGTGAAGGG, as shown in SEQ ID NO.
6.
7. The method of claim 4, wherein, A method for increasing the number of symbiotic nodules of soybean includes the following steps: S1, Dongnong 50 cDNA was used as template to amplify GmCDPKb coding region; S2. Using the enzyme digestion and ligation method, GmCDPKb Constructed onto the Fu28 vector; S3, using Gateway technology, the LR reaction into the target vector pSOYI; GmCDPKb LR reaction into the target vector pSOYI; S4, the successfully constructed GmCDPKb - Introducing the pSOYI vector into EHA105 Agrobacterium competent cells; S5, using the Agrobacterium obtained in S4 to infect soybean; S6, performing plant tissue culture on the soybean tissue obtained in S5; S7, the positive plants were selected by qRT-PCR and western-blot detection, and the GmCDPKb soybean plants with gene overexpression.
Citation Information
Patent Citations
Transgenic plants for nitrogen fixation
CN105874070A
Application of AhPUGN1.1 in regulation and control of peanut nodulation
CN120699992A
Cited By
SONAR gene for regulating heat resistance, nodulation and immunity of plants and application of SONAR gene
CN121378436A